EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 32 (2025) Parasite, 32 (2025) 41 Full HTML
Open Access
Issue
Parasite
Volume 32, 2025
Article Number 41
Number of page(s) 13
DOI https://doi.org/10.1051/parasite/2025033
Published online 04 July 2025

© L. Králová-Hromadová et al., published by EDP Sciences, 2025

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

The tapeworms Dibothriocephalus dendriticus (Nitzsch, 1824) (syn. Diphyllobothrium dendriticum) and Dibothriocephalus ditremus (Creplin, 1825) (syn. Diphyllobothrium ditremum) (Cestoda: Diphyllobothriidea) have sympatric distribution in the Arctic and subarctic regions of the Northern Hemisphere and an overlapping spectrum of intermediate and definitive hosts [5, 13, 22, 31]. Dibothriocephalus dendriticus has also been introduced into Patagonia in the southern cone region of South America, particularly in Chile [50] and Argentina [54]. Although the studied species are not closely related, they belong together with Dibothriocephalus latus, Dibothriocephalus nihonkaiensis and Dibothriocephalus ursi to the monophyletic genus Dibothriocephalus, which forms the most derived lineage within the family Diphyllobothriidae [64].

The life cycle of both species requires copepods and freshwater or anadromous fish as the first and the second intermediate hosts, respectively [36, 63]. The plerocercoids (the second larval stages) of both species are usually encapsulated in irregularly shaped capsules on the alimentary canal or the internal organs (stomach, liver, gonads, swim bladder, and peritoneum); rarely they can be found free in the heart or the body cavity of infected fish [5, 21, 22, 48]. The dominant intermediate hosts of both tapeworms are salmonids (family Salmonidae), mainly the genera Coregonus [7, 60], Salvelinus [23, 51], Salmo [62, 68], and Oncorhynchus [5, 42]. Plerocercoids were also found in fishes of the families Gasterosteidae, Cottidae, Osmeridae, and Lotidae [7, 42, 45, 59, 61]. The dominant definitive hosts of both tapeworms are piscivorous birds, mainly from the family Laridae [26, 55]. In addition, D. dendriticus can infect mammals, such as dogs [57], foxes [56], and bears [15], and is also one of the causative agents of dibothriocephalosis, a fish-borne parasitic zoonosis [33, 55].

The exact taxonomic identification of plerocercoids of both Dibothriocephalus species has been complicated due to the frequent co-infection in fish hosts [24, 37]. Both species can be histologically distinguished utilizing different microscopy techniques [5, 6, 21]. In other types of studies (e.g. ecology, distribution, genetics, etc.), plerocercoids have to be identified based on their external morphology using stereomicroscopy immediately after dissection of the fish.

The external morphology of the larvae of both Dibothriocephalus species, mainly their size and shape, may vary depending on methods of fixation, but also on the fish host, with the most profound differences between the infection of the three-spined stickleback (Gasterosteus aculeatus) and the brown trout (Salmo trutta) [5, 21]. As a result, the identification of larvae to the species level was not performed and larvae were assigned as “Diphyllobothrium spp.” in several studies from Europe, such as those conducted in Iceland [19, 32, 41] and Great Britain [28, 49], as well as in North America, including Canada [8, 20], and the USA [11, 65]. In addition, identification of parasitic material deposited in institutional or museum collections faces even greater challenges, since specimens have been collected and processed by various researchers using different procedures, fixatives and media. Adult tapeworms are sometimes fragmented, missing the scolex, or are immature, making a reliable taxonomic identification of species more difficult. According to our experience, adult tapeworms obtained from free-living carnivores are often decomposed due to prolonged time between death of the host and necropsy. Although plerocercoids of D. dendriticus and D. ditremus could be morphologically identified immediately after dissection [3, 4, 6], the identification of larvae (or their fragments) preserved in ethanol can be challenging.

Molecular tools have played an important role in the taxonomic identification of diphyllobothriid tapeworms, e.g. [39, 67, 68]. Wicht et al. [66] developed a set of four species-specific primers within the mitochondrial cytochrome c oxidase subunit 1 gene (cox1 mtDNA) to distinguish the most common diphyllobothriid species infecting humans, namely D. latus, D. dendriticus, D. nihonkaiensis, and Adenocephalus pacificus by multiplex PCR. The authors designed the D. dendriticus-specific primers, which amplified a 308 bp part of the cox1 gene specifically in D. dendriticus. A recent population genetic study on D. dendriticus showed that D. dendriticus-specific primers also yielded a non-specific amplification product for D. ditremus DNA [31]. This made the identification of D. dendriticus and its differentiation from D. ditremus based solely on PCR amplification unreliable and each PCR product had to be sequenced. However, sequencing increases financial costs and reduces time-effectiveness, particularly in population genetic studies involving several hundred individuals.

The aim of this study was to develop species-specific PCR-based method for single-step discrimination between D. dendriticus and D. ditremus. For this purpose, intraspecific variation and interspecific differences were analysed in the most frequently investigated DNA regions, the subunits and spacers of the nuclear ribosomal RNA (rRNA) genes and the protein-coding genes of mitochondrial DNA (mtDNA), which have been applied in studies on taxonomy, phylogeny and population genetics of Diphyllobothriidea. However, previously published studies were mainly focused on diphyllobothriideans infecting humans and D. ditremus was either not included in the analyses [2, 18, 46, 68], or only a limited number and selected populations of D. ditremus were analysed [1, 9, 38, 40, 58, 64]. Therefore, we decided to summarise all molecular data on D. dendriticus and D. ditremus to provide comprehensive analyses of the structure and variation of rRNA and mitochondrial genes and to assess their potential as discriminative markers. DNA regions without intraspecific variation but with substantial interspecific differences were selected as target regions for the design of primer sets, the specificity of which was validated on the DNA of both species.

Microsatellites, or short tandem repeats (STR), are biparentally inherited polymorphic nuclear markers that have been developed as one of the most popular genetic markers owing to their high reproducibility, multi-allelic nature, codominant mode of inheritance, abundance and wide genome coverage [52]. Microsatellites are scattered throughout a broad spectrum of prokaryotic and eukaryotic genomes in multiple copies, both in protein-coding and non-coding regions [70] and their density and distribution vary markedly across genomes [16]. For newly analysed taxa, the microsatellites need to be de novo characterized and the primers used for their PCR amplification are usually species-specific [70]. Microsatellite markers were originally designed for D. dendriticus by library screening using a next-generation sequencing (NGS) approach [10] and have recently been applied in the study of genetic diversity and intercontinental dispersal of temperate and subarctic populations of D. dendriticus [31]. Since the primers for STR loci in D. dendriticus should be species-specific, their cross-reactivity was tested on D. ditremus DNA. The specificity of primers was assessed with the aim of identifying suitable candidates for differentiation between both congeners.

Materials and methods

Ethics

Fishes were caught and killed by local professional fishermen and provided to the authors who performed an autopsy and isolated the larvae.

Parasitic material and its molecular identification

The specificity of primers was tested on 32 tapeworms, namely 16 D. dendriticus (Dde) and 16 D. ditremus (Ddi) plerocercoids from four localities; lakes Takvatn (NO-TA) and Kalandsvatn (NO-KA) in Norway (NO) and lakes Hafravatn (IS-HA) and Thingvallavatn (IS-TH) in Iceland (IS) (Table 1). Each population of both species was represented by four larvae. The plerocercoids from NO-TA, NO-KA and IS-HA were isolated from the brown trout (Salmo trutta) and larvae from IS-TH were obtained from the Arctic char (Salvelinus alpinus). The larvae were isolated from capsules localized in the abdominal cavity and on the internal organs of infected fish, rinsed in physiological saline solution, identified by their size and morphology, and preserved in 96% ethanol. Genomic DNA of 32 larvae was isolated using a QIAamp® DNA Mini Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s recommendations. The DNA was stored in deionized water at −20 °C.

Table 1

Details on Dibothriocephalus dendriticus and Dibothriocephalus ditremus specimens used in the current study for tests of specificity of primers.

The initial molecular genotyping of all 32 larvae was performed by PCR amplification using the universal reverse primer MulRevCom (5′–ATGATAAGGGAYAGGRGCYCA–3′) and the D. dendriticus-specific forward primer MulDen4 (5′–GTGTTTTTCATTTGATGATGACCAGTC–3′) (Table 2), which were designed for the amplification of a 308 bp fragment of the mitochondrial cox1 gene specifically in D. dendriticus [66]. The PCR was performed in a total volume of 20 μL with 10–20 ng of genomic DNA, 10 pmol of each of the two primers and 1× PCR Master Mix (Thermo Fisher Scientific Inc., Waltham, MA, USA). The PCR amplification conditions were 5 min at 95 °C as an initial denaturation step, followed by 40 cycles of 30 s at 95 °C, 1 min at 60 °C, 1 min at 72 °C, and a final polymerization step of 10 min at 72 °C. The PCR products were visualized on a 1.5% agarose gel. Figure 1 shows that the PCR products were amplified not only in 16 D. dendriticus individuals, but also in 16 D. ditremus specimens from all four localities (NO-TA, NO-KA, IS-HA and IS-TH). The D. dendriticus-specific primers evidently lacked specificity, as a single-step PCR-based discrimination between D. dendriticus and D. ditremus was not effective and PCR products had to be sequenced to confirm the identity of each individual.

thumbnail Figure 1

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using D. dendriticus-specific cox1 primers designed by Wicht et al. (2010). Lane M: 100 bp ladder.

Table 2

Details on primers used for tests of their specificity for Dibothriocephalus dendriticus and Dibothriocephalus ditremus.

The PCR products (Fig. 1) were purified using ExoProStarTM 1-Step (IllustraTM, GE Healthcare, Little Chalfont, UK), and sequenced from both sides with MulDen4 and MulRevCom primers using a 3500 Genetic Analyzer (Thermo Fisher Scientific) and the BigDye Terminator v3.1 Cycle Sequencing Kit (Thermo Fisher Scientific). Contiguous sequences were assembled and analyzed for errors using Geneious software (version 10.0.5, Biomatters, Auckland, New Zealand). All 16 D. dendriticus sequences were compared to the reference cox1 sequence of D. dendriticus from Coregonus lavaretus from Loch Lomond in Scotland, United Kingdom (GU997618). The 16 D. ditremus sequences were aligned with the reference sequence of D. ditremus from S. alpinus from Loch Doyne in Scotland (FM209182). The partial cox1 sequences of the 32 Dibothriocephalus specimens were deposited in GenBank under the accession numbers indicated in Table 1.

Data on rRNA and mtDNA genes sequences of D. dendriticus and D. ditremus from GenBank

Data on the ribosomal and the mitochondrial genes for D. dendriticus and D. ditremus were retrieved from GenBank (https://www.ncbi.nlm.nih.gov/genbank/). Summary data on the sequences of the small rRNA gene subunit (ssrDNA), the large rRNA gene subunit (lsrDNA), and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 rDNA) are presented in Supplementary Table 1. Supplementary Table 2 provides data on the sequences of mtDNA genes of D. dendriticus and D. ditremus. The most frequently studied mitochondrial gene was cox1, followed by cytochrome b (cob). Only a limited number of records were available for subunit 6 of adenosine triphosphatase (atp6), subunit 3 of nicotinamide dehydrogenase (nad3), and the small (12S) and large (16S) subunits of the mitochondrial rRNA gene.

The sequences were downloaded from GenBank and analyzed using Geneious software and Clustal Omega Multiple Sequence Alignment (https://www.ebi.ac.uk/jdispatcher/msa/clustalo). The analyses were focused on (i) the determination of intraspecific variation of the respective DNA region/gene within both species; (ii) the assessment of interspecific differences between corresponding DNA regions of both species; (iii) the determination of DNA regions suitable for design of species-specific primers, particularly regions with a sufficient level of interspecific differences and, at the same time, without intraspecific variation. Primers designed as potential candidates were tested by PCR amplification using DNA of 16 D. dendriticus and 16 D. ditremus individuals (Table 1), under the PCR conditions described above.

Test of specificity of STR primers designed for D. dendriticus

The sequences of forward and reverse primers of STR loci designed by Bazsalovicsová et al. [10] are listed in Table 2. Since they were specifically designed for D. dendriticus and were supposed to be D. dendriticus-specific, their specificity was also tested on 16 individuals of D. ditremus (Table 1) using the PCR conditions published by Bazsalovicsová et al. [10].

Results

Interspecific differences of rRNA gene subunits and spacers

The determination of interspecific differences and intraspecific variations of ssrDNA, lsrDNA, ITS1 and ITS2 was based on alignments of all sequences available in GenBank which are summarized in Supplementary Table 1. The alignments resulted in the final contiguous sequences and determination of the mutation sites, which are graphically displayed in Figure 2. The contiguous ssrDNA (2,035 bp; partial) and lsrDNA (1,527 bp; partial) each contained six non-specific mutations. Sequence alignments of ITS1 resulted in the contiguous 516 bp (complete) ITS1 region with 13 non-specific mutations. The length of the complete ITS2 spacer varied between 464 bp and 480 bp due to the insertions/deletions and the different number of repetitive motifs. The contiguous ITS2 sequence revealed eight non-specific mutations (Fig. 2).

thumbnail Figure 2

Graphical scheme of mutation sites within the contiguous sequences of the small rRNA gene subunit (ssrDNA), the large rRNA gene subunit (lsrDNA) and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 rDNA) of Dibothriocephalus dendriticus and Dibothriocephalus ditremus based on sequences presented in Supplementary Table 1. ITS2 sequences published by Rozas et al., 2012 (468 bp) were used as the reference sequence. The length of ITS2 spacer varied from 464 bp to 480 bp due to different number of repetitive motifs and insertions/deletions.

The percentage identity between D. dendriticus and D. ditremus was high (99.8–100% for ssrDNA; 99.7–99.9% for lsrDNA; 99.4–100% for ITS1; 96.7–99.6% for ITS2) and similar to the intraspecific sequence identity in all four rRNA gene regions of both species (Table 3).

Table 3

Percentage identity of rRNA gene subunits/spacers and mitochondrial genes within and between Dibothriocephalus dendriticus and Dibothriocephalus ditremus.

The high homogeneity of ribosomal subunits and spacers between both Dibothriocephalus species, the overall low number of mutations in all four rRNA gene regions, and the absence of species-specific mutations did not result in the identification of DNA regions suitable for the design of the species-specific primers.

Interspecific differences of mtDNA genes

A higher level of interspecific differences between D. dendriticus and D. ditremus was detected in the complete cox1 (1,566 bp) and cob (1,107 bp) genes (89.7–91.3% identity for cox1; 89.3–90.9% identity for cob) (Table 3). The protein coding genes atp6 and nad3, as well as the ribosomal subunits 12S and 16S were not analyzed, as the number of records for each of them was low (1–2) in both species (see Supplementary Table 2), and the information was insufficient for an assessment of sequence variation within and between species.

A total of 307 mutations, 68 of which were species-specific, were determined in the complete cox1 gene (Supplementary Table 3; species-specific mutations are in red and bold). Regions with a higher number of species-specific mutations arranged in close proximity were chosen as suitable regions for the design of D. dendriticus-specific (Dde_cox1_F; Dde_cox1_R) and D. ditremus-specific (Ddi_cox1_F; Ddi_cox1_R) primers. The position of the primers is graphically displayed in Supplementary Table 3 (colored boxes) and their details are presented in Table 2.

A total of 70 species-specific mutations out of 160 mutations were determined in the complete cob gene (Supplementary Table 4; species-specific mutations are in red and bold). Two regions with a higher number of species-specific mutations arranged in close proximity were chosen as suitable targets for the design of two sets of D. dendriticus-specific (Dde_cob_F1 + Dde_cob_R1; Dde_cob_F2 + Dde_cob_R2) and two sets of D. ditremus-specific primers (Ddi_cob_F1 + Ddi_cob_R1; Ddi_cob_F2 + Ddi_cob_R2). The positions of the primers are graphically displayed in Supplementary Table 4 (colored boxes) and their details are presented in Table 2.

PCR amplification of 16 D. dendriticus and 16 D. ditremus individuals with one set of cox1 and two sets of cob D. dendriticus-specific and D. ditremus-specific primers did not confirm their specificity. Similarly, D. dendriticus-specific primers also annealed to D. ditremus DNA (Supplementary Figs. 1A, 2A, and 3A) and D. ditremus-specific primers also provided PCR products on D. dendriticus DNA (Supplementary Figs. 1B, 2B, and 3B).

Specificity of primers for STR loci

Fifteen primer pairs designed for the amplification of STR loci in D. dendriticus (Table 2) were tested on DNA from 16 D. dendriticus and 16 D. ditremus individuals (Table 1). Thirteen primer pairs (namely primers for loci Dd_2, 17, 23, 25, 38, 43, 47, 49, 57, 78, 84, 95, 114; see Table 2 for details) also annealed to DNA of D. ditremus, revealing that they are not D. dendriticus-specific. The results of PCR amplification with primers amplifying the loci Dd_38 and Dd_78 are presented in Supplementary Figure 4. Two primer sets amplifying the STR loci Dd_8 and Dd_33 proved to be D. dendriticus-specific as they provided PCR products exclusively in D. dendriticus specimens (Fig. 3).

thumbnail Figure 3

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using (A) primers amplifying the microsatellite locus Dd_8 and (B) primers amplifying the microsatellite locus Dd_33 designed by Bazsalovicsová et al. (2020) for D. dendriticus. Lane M: 100 bp ladder.

Discussion

The current study aimed to develop a species-specific PCR-based method for the single-step discrimination between D. dendriticus and D. ditremus. Intraspecific variation and interspecific differences were initially analyzed in the small and large subunits and spacers of rRNA genes and protein-coding genes of mitochondrial DNA, highly informative molecular tools in taxonomy, diagnostics, phylogeny, evolution and population genetics [27, 29].

Previous studies revealed that ssrDNA and lsrDNA are effective markers in phylogenetic studies and in assessing the evolutionary history of diphyllobothriideans [14, 18, 25, 40, 58, 64]. However, the current data showed that ssrDNA and lsrDNA were not informative enough to distinguish between D. dendriticus and D. ditremus, as their overall sequences were similar, the number of mutations was low, and none of the mutations were species-specific. Even though the ribosomal spacers ITS1 and ITS2 are frequently used for discrimination at the species and subspecies levels [43], they were found to be unsuitable for detection of differences among diphyllobothriideans [38, 40, 64, 66, 69]. The current study supports the previously published results on the low informativeness of the ribosomal spacers, which were not suitable to distinguish between D. dendriticus and D. ditremus, due to their similar ITS1 sequence structure, low number of mutations, and an absence of species-specific mutations. Even though the ITS2 spacer was the most variable rRNA gene region, its variability was mainly due to deletions/insertions and a different number of short repetitive regions, which is a rather variable and not reliable parameter for the design of species-specific primers.

Because ribosomal subunits and spacers were not suitable targets for the design of discrimination tools between D. dendriticus and D. ditremus, mitochondrial DNA, which evolves faster than nuclear genes and is suitable for detection of interrelationships among closely related organisms, was investigated in detail. Previous studies on Diphyllobothriidea showed that mitochondrial cox1 is suitable for molecular identification and discrimination of diphyllobothriid tapeworms and assessment of their phylogeny [25, 38, 64, 66, 69]. The present study revealed a high number of mutations, including species-specific ones, in the cox1 and cob genes. Comparison of the sequences enabled differentiation between D. dendriticus and D. ditremus because intraspecific sequence variation was lower than the differences between the species. Despite careful selection, primers designed in the cox1 and cob regions with accumulation of species-specific mutations did not provide the expected results. The designed primer sets also annealed to DNA of the other congener, likely due to unpredictable intraspecific variability in the DNA regions applied for the design of primers.

Since rDNA and mtDNA were not potential candidates for the design of species-specific primers, we were forced to consider other alternatives. Therefore, we decided to test the specificity of 15 recently designed primer pairs for amplification of microsatellite loci in D. dendriticus [10]. The specificity of 13 primer pairs was not confirmed, as they also annealed to D. ditremus DNA. This was apparently the result of a very similar DNA structure between both congeners especially in the DNA regions used for the design of primers. Two primer sets (for loci Dd_8 and Dd_33) yielded favorable results and amplified the PCR product only in the DNA of D. dendriticus. It is evident that DNA regions, which were used as the targets for the design of Dd_8 and Dd_33 primers, displayed sufficient level of interspecific differences.

The latest data have shown that determining the limitations of PCR-based identification methods for diphyllobothriideans is very important. The non-specific amplification of D. dendriticus-specific primers developed by Wicht et al. [66] on D. ditremus DNA ([31]; current study) is justifiable, as these primers were originally designed, tested and validated for four diphyllobothriids infecting humans. Their cross-reactivity with the DNA of D. ditremus, a parasite of birds, was not tested and could not have been predicted. However, contradictory interpretations of genotyping with the cox1 primers developed by Wicht et al. [66] were documented more than a decade ago. While Esteban et al. [17] identified a tapeworm from a human patient from Spain as D. latus, molecular reassessment by Kuchta et al. [34] led to the identification of the tapeworm as A. pacificus. It is difficult to determine whether these contradictory results are due to the low specificity of the cox1 primers or to technical or human error. Nevertheless, it is evident that molecular studies focused on more populations and species of diphyllobothriids have provided new insights into the intraspecific variability and interspecific differences in mitochondrial genes of this group of cestodes. These findings highlighted either a need to reassess the specificity and effectiveness of existing molecular discrimination tools or to develop and validate new markers.

A broader application of the Dd_8 and Dd_33 primers for discrimination of plerocercoids of other diphyllobothriids infecting salmonids in different continents still needs to be investigated. In Europe, the differentiation between plerocercoids of D. latus and D. dendriticus/D. ditremus has not been considered problematic mainly due to their distinct morphology and characteristic localization in fish [3–5]. Furthermore, the most common hosts of D. latus in Europe are European perch Perca fluviatilis and ruffe Gymnocephalus cernua (Percidae), Northern pike Esox lucius (Esocidae), and burbot Lota lota (Lotidae), while salmonids have only occasionally been reported as accidental hosts (for a review see [30] and references therein). Consequently, a probability of misidentification of D. latus plerocercoids with D. dendriticus/D. ditremus in Europe is rather low due to the different range of fish hosts, and a substantial decline in the prevalence of D. latus in regions where all three species previously co-occurred (e.g. Fennoscandia and the Baltic region) [30].

In South America, D. latus and D. dendriticus have been introduced from the Northern Hemisphere to Patagonia (Argentina and Chile), e.g. [54, 68]. As the main fish hosts of D. latus do not occur in the Southern Hemisphere, the tapeworm has successfully adapted to salmonids as alternative accessible hosts [35]. Although the co-occurrence of D. latus and D. dendriticus in salmonids poses a real risk of misidentification, molecular identification of both tapeworms is possible using D. latus-specific and D. dendriticus-specific cox1 primers designed by Wicht et al. [66]. The broad applicability of these primers has been demonstrated in recent population-genetic studies of worldwide populations (including those from South America) of D. latus [46, 47] and D. dendriticus [31]. We tested the specificity and possible cross-reactivity of the currently presented D. dendriticus-specific primers Dd_8 and Dd_33 using DNA isolated from D. latus from Argentina. Unexpectedly, primers Dd_8 and Dd_33 yielded non-specific products on D. latus DNA (data not shown) and they cannot be used to distinguish between D. latus and D. dendriticus in South America. This suggests that the DNA regions of primers Dd_8 and Dd_33 in D. dendriticus are identical (or nearly identical) to the corresponding DNA regions in D. latus.

In North America, several Dibothriocephalus species, including D. dendriticus and D. ditremus, utilize salmonids as second intermediate hosts. Additionally, D. nihonkaiensis, a parasite of humans and other mammals, and D. ursi, parasitizing bears, occur in western North America (Canada and USA) while D. nihonkaiensis is also distributed along the northern Pacific coast regions of Asia (for a review see [53]). The sockeye salmon Oncorhynchus nerka is an example of a salmonid that serves as a host of more Dibothriocephalus species, namely D. dendriticus, D. ditremus, D. nihonkaiensis, and D. ursi [2, 12, 42, 44, 45, 53]. Since the mitochondrial cox1 primers designed by Wicht et al. [66] did not target D. ditremus and D. ursi, and the STR primers Dd_8 and Dd_33 presented in this study were exclusively validated for discrimination between D. dendriticus and D. ditremus, a reliable single-step genotyping method for identification of Dibothriocephalus larvae from salmonids in North America could be a challenge for future research.

Conclusions

The genomes of D. dendriticus and D. ditremus apparently share several similar/identical DNA regions, which makes their molecular PCR-based differentiation difficult. A high genetic similarity may hypothetically result from cross-hybridization and exchange of genetic material between adults of both species caused by common definitive hosts (piscivorous birds), frequent co-infections and a sympatric occurrence. However, more detailed molecular and genetic studies are necessary to confirm this hypothesis. Although D. dendriticus and D. ditremus could not be discriminated by PCR using cox1 and cob primers designed in the species-specific regions of both congeners, their differentiation is possible by cox1 and cob sequence comparisons because interspecific differences of both mitochondrial genes clearly exceeded their intraspecific variation. The current study confirmed previously published findings that rRNA gene subunits and spacers are not suitable for molecular differentiation between diphyllobothriideans. It was surprising that of the 15 primer sets designed for D. dendriticus to amplify microsatellite loci, only two proved to be species-specific. The broader application of the primer set for the Dd_8 locus was tested on ~3,500 D. dendriticus and D. ditremus plerocercoids from different localities in Iceland (318 D. dendriticus and 1,366 D. ditremus) and Norway (321 D. dendriticus and 1,482 D. ditremus) (data not shown). The results were confirmed by sequence analyses and showed effectiveness and high reproducibility of the Dd_8 primers, which are recommended for future PCR-based molecular differentiation between D. dendriticus and D. ditremus.

Acknowledgments

The authors would like to acknowledge Dr. Jasper Kuhn for providing Dibothriocephalus spp. from Takvatn lake.

Funding

This work was financially supported by the Slovak Research and Development Agency (project no. APVV-23-0390).

Conflicts of interest

The authors declare that there are no conflicts of interest.

Supplementary material

Supplementary Table 1: Summary data on the sequences of the rRNA gene subunits and spacers of Dibothriocephalus dendriticus and Dibothriocephalus ditremus retrieved from GenBank. Access here

Supplementary Table 2: Summary data on the sequences of the mitochondrial DNA genes of Dibothriocephalus dendriticus and Dibothriocephalus ditremus retrieved from GenBank. Access here

Supplementary Table 3: Mutation sites (species-specific mutations are in red) and design of the species-specific primers (in colored boxes) in the cox1 gene of Dibothriocephalus dendriticus and Dibothriocephalus ditremus. Access here

Supplementary Table 4: Mutation sites (species-specific mutations are in red) and design of the species-specific primers (in colored boxes) in the cob gene of Dibothriocephalus dendriticus and Dibothriocephalus ditremus. Access here

thumbnail Supplementary Figure 1:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using (A) D. dendriticus-specific (Dde_cox1_F; Dde_cox1_R) and (B) D. ditremus-specific (Ddi_cox1_F; Ddi_cox1_R) cox1 primers designed in the current study. Lane M: 100 bp ladder.

thumbnail Supplementary Figure 2:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using the first set of (A) D. dendriticus-specific (Dde_cob_F1; Dde_cob_R1) and (B) D. ditremus-specific (Ddi_cob_F1; Ddi_cob_R1) cob primers designed in the current study. Lane M: 100 bp ladder.

thumbnail Supplementary Figure 3:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using the second set of (A) D. dendriticus-specific (Dde_cob_F2; Dde_cob_R2) and (B) D. ditremus-specific (Ddi_cob_F2; Ddi_cob_R2) cob primers designed in the current study. Lane M: 100 bp ladder.

thumbnail Supplementary Figure 4:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using (A) primers amplifying the microsatellite locus Dd_38 and (B) primers amplifying the microsatellite locus Dd_78 designed by Bazsalovicsová et al. (2020) for D. dendriticus. Lane M: 100 bp ladder.

References

  1. Abe N. 2009. Identification of the larval cestode plerocercoid found in the body cavities of the Japanese smelt Hypomesus transpacificus nipponensis, and review of the literature. Seikatsu Eisei, 53, 110–116 [in Japanese]. [Google Scholar]
  2. Abe N, Baba T, Nakamura Y, Murakami S. 2021. Global analysis of cytochrome c oxidase subunit 1 (cox1) gene variation in Dibothriocephalus nihonkaiensis (Cestoda: Diphyllobothriidae). Current Research in Parasitology & Vector-Borne Diseases, 1, 100042. [Google Scholar]
  3. Andersen K. 1975. Studies of the helminth fauna of Norway XXXIV: The morphological stability of Diphyllobothrium Cobbold. A comparison of adult D. dendriticum (Nitzsch), D. latum (L.) and D. ditremum (Creplin) developed in different hosts. Norwegian Journal of Zoology, 23, 45–53. [Google Scholar]
  4. Andersen K. 1978. The development of the tapeworm Diphyllobothrium latum (L. 1756) (Cestoda, Pseudophyllidea) in its definitive hosts, with special references to the growth patterns of D. dendriticum (Nitzsch, 1824) and D. ditremum (Creplin, 1827). Parasitology, 77, 111–120. [Google Scholar]
  5. Andersen K, Ching HL, Vik R. 1987. A review of freshwater species Diphyllobothrium with redescriptions and the distribution of D. dendriticum (Nitzsch, 1824) and D. ditremum (Creplin, 1825) from North America. Canadian Journal of Zoology, 65, 2216–2228. [Google Scholar]
  6. Andersen KI, Gibson DI. 1989. A key to three species of larval Diphyllobothrium Cobbold, 1858 (Cestoda: Pseudophyllidea) occurring in European and North American freshwater fishes. Systematic Parasitology, 13, 3–9. [Google Scholar]
  7. Andersen KI, Valtonen ET. 1992. Segregation and co-occurrence of larval cestodes in freshwater fishes in the Bothnian Bay, Finland. Parasitology, 104, 161–168. [Google Scholar]
  8. Bailey RE, Margolis L. 1987. Comparison of parasite fauna of juvenile sockeye salmon (Oncorhynchus nerka) from southern British Columbian and Washington State lakes. Canadian Journal of Zoology, 65, 420–431. [Google Scholar]
  9. Banzai-Umehara A, Suzuki M, Akiyama T, Ooi H-K, Kawakami Y. 2016. Invalidation of Diphyllobothrium hottai (Cestoda: Diphyllobothriidae) based on morphological and molecular phylogenetic analyses. Parasitology International, 65, 459–462. [Google Scholar]
  10. Bazsalovicsová E, Minárik G, Šoltys K, Radačovská A, Kuhn JA, Karlsbakk E, Skírnisson K, Králová-Hromadová I. 2020. Development of 14 microsatellite markers for zoonotic tapeworm Dibothriocephalus dendriticus (Cestoda: Diphyllobothriidea). Genes, 11, 782. [Google Scholar]
  11. Becker CD, Brunson WD. 1967. Diphyllobothrium (Cestoda) infections in salmonids from three Washington lakes. Journal of Wildlife Management, 31, 813–824. [Google Scholar]
  12. Bennet SN, Adamson ML, Margolis L. 1998. Long-term changes in parasites of sockeye salmon (Oncorhynchus nerka) smolts. Canadian Journal of Fisheries and Aquatic Sciences, 55, 977–986. [Google Scholar]
  13. Borgstrøm R, Trømborg J, Haugen TO, Rosseland BO. 2017. Plerocercoids of the cestode Diphyllobothrium ditremum in brown trout Salmo trutta: substantial increase in infection after establishment of European minnow Phoxinus phoxinus. Journal of Fish Biology, 91, 912–927. [Google Scholar]
  14. Brabec J, Kuchta R, Scholz T. 2006. Paraphyly of the Pseudophyllidea (Platyhelminthes: Cestoda): circumscription of monophyletic clades based on phylogenetic analysis of ribosomal RNA. International Journal for Parasitology, 36, 1535–1541. [Google Scholar]
  15. Catalano S, Lejeune M, Tizzani P, Verocai GG, Schwantje H, Nelson C, Duignan PJ. 2015. Helminths of grizzly bears (Ursus arctos) and American black bears (Ursus americanus) in Alberta and British Columbia, Canada. Canadian Journal of Zoology, 93, 765–772. [Google Scholar]
  16. Dieringer D, Schlötterer C. 2003. Two distinct modes of microsatellite mutation processes: evidence from the complete genomic sequences of nine species. Genome Research, 13, 2242–2251. [Google Scholar]
  17. Esteban JG, Muñoz-Antoli C, Borras M, Colomina J, Toledo R. 2014. Human infection by a “fish tapeworm”, Diphyllobothrium latum, in a non-endemic country. Infection, 42, 191–194. [Google Scholar]
  18. Fraija-Fernández N, Waeschenbach A, Briscoe AG, Hocking S, Kuchta R, Nyman T, Littlewood DTJ. 2021. Evolutionary transitions in broad tapeworms (Cestoda: Diphyllobothriidea) revealed by mitogenome and nuclear ribosomal operon phylogenetics. Molecular Phylogenetics and Evolution, 163, 107262. [Google Scholar]
  19. Frandsen F, Malmquist HJ, Snorrason SS. 1989. Ecological parasitology of polymorphic Arctic charr, Salvelinus alpinus (L.), in Thingvallavatn, Iceland. Journal of Fish Biology, 34, 281–297. [Google Scholar]
  20. Gallagher CP, Dick TA, Babaluk JA, Reist JD. 2009. Parasite community of Arctic char, Salvelinus alpinus, from Lake Hazen and Craig Lake, Quttinirpaaq National Park, Nunavut. Canadian Technical Report of Fisheries and Aquatic Sciences, 2854, vi + 24 p. [Google Scholar]
  21. Halvorsen O. 1970. Studies of the helminth fauna of Norway XV: On the taxonomy and biology of plerocercoids of Diphyllobothrium Cobbold, 1858 (Cestoda, Pseudophyllidea) from north-western Europe. Nytt Magasin for Zoologi (Norwegian Journal of Zoology), 18, 113–174. [Google Scholar]
  22. Halvorsen O, Wissler K. 1973. Studies of the helminth fauna of Norway XXVIII: An experimental study of the ability of Diphyllobothrium latum (L.), D. dendriticum (Nitzsch), and D. ditremum (Creplin) (Cestoda, Pseudophyllidea) to infect paratenic hosts. Norwegian Journal of Zoology, 21, 201–210. [Google Scholar]
  23. Henricson J. 1977. The abundance and distribution of Diphyllobothrium dendriticum (Nitzch) and D. ditremum (Creplin) in the char Salvelinus alpinus (L.) in Sweden. Journal of Fish Biology, 11, 231–248. [Google Scholar]
  24. Henriksen EH, Knudsen R, Kristoffersen R, Kuris AM, Lafferty KD, Siwertsson A, Amundsen P-A. 2016. Ontogenic dynamics of infection with Diphyllobothrium spp. cestodes in sympatric Arctic charr Salvelinus alpinus (L.) and brown trout Salmo trutta L. Hydrobiologia, 783, 37–46. [Google Scholar]
  25. Hernández-Orts JS, Scholz T, Brabec J, Kuzmina T, Kuchta R. 2015. High morphological plasticity and global geographical distribution of the Pacific broad tapeworm Adenocephalus pacificus (syn. Diphyllobothrium pacificum): Molecular and morphological survey. Acta Tropica, 149, 168–178. [Google Scholar]
  26. Hickey MD, Harris JR. 1947. Progress of the Diphyllobothrium epizootic at Poulaphouca reservoir, Co. Wicklow, Ireland. Journal of Helminthology, 22, 13–28. [Google Scholar]
  27. Hillis DM, Dixon MT. 1991. Ribosomal DNA: molecular evolution and phylogenetic inference. Quarterly Review of Biology, 66, 411–453. [CrossRef] [PubMed] [Google Scholar]
  28. Hooker OE, Barry J, Van Leeuwen TE, Lyle A, Newton J, Cunningham P, Adams CE. 2016. Morphological, ecological and behavioural differentiation of sympatric profundal and pelagic Arctic charr (Salvelinus alpinus) in Loch Dughaill Scotland. Hydrobiologia, 783, 209–221. [Google Scholar]
  29. Hu M, Chilton NB, Gasser RB. 2004. The mitochondrial genomics of parasitic nematodes of socio-economic importance: Recent progress and implications for population genetics and systematics. Advances in Parasitology, 56, 133–212. [Google Scholar]
  30. Králová-Hromadová I, Radačovská A, Čisovská Bazsalovicsová E, Kuchta R. 2021. Ups and downs of infections with the broad fish tapeworm Dibothriocephalus latus in Europe from 1900 to 2020: Part I. Advances in Parasitology, 114, 75–166. [Google Scholar]
  31. Králová-Hromadová I, Čisovská Bazsalovicsová E, Radačovská A, Šoltys K, Juhásová L, Minárik G, Kuchta R, Skírnisson K, Karlsbakk E, Štefka J. 2025. Genetic diversity and intercontinental dispersal of temperate and subarctic populations of Dibothriocephalus dendriticus (Cestoda; Diphyllobothriidea), a causative agent of dibothriocephalosis. International Journal for Parasitology, 55, 281–298. [Google Scholar]
  32. Kristmundsson Á, Richter SH. 2009. Parasites of resident arctic charr, Salvelinus alpinus, and brown trout, Salmo trutta, in two lakes in Iceland. Icelandic Agricultural Sciences, 22, 5–18. [Google Scholar]
  33. Kuchta R, Brabec J, Kubáčková P, Scholz T. 2013. Tapeworm Diphyllobothrium dendriticum (Cestoda) – neglected or emerging human parasite? PLoS Neglected Tropical Diseases, 7, e2535. [Google Scholar]
  34. Kuchta R, Esteban JG, Brabec J, Scholz T. 2014. Misidentification of Diphyllobothrium species related to global fish trade, Europe. Emerging Infectious Diseases, 20, 1955–1957. [Google Scholar]
  35. Kuchta R, Radačovská A, Bazsalovicsová E, Viozzi G, Semenas L, Arbetman M, Scholt T. 2019. Host switching of zoonotic broad fish tapeworm (Dibothriocephalus latus) to salmonids, Patagonia. Emerging Infectious Diseases, 25, 2156–2158. [Google Scholar]
  36. Kuhlow F. 1953. Über die Entwicklung und Anatomie von Diphyllobothrium dendriticum, Nitzsch 1824. Zeitschrift für Parasitenkunde, 16, 1–35. [Google Scholar]
  37. Kuhn JA, Kristoffersen R, Knudsen R, Jakobsen J, Marcogliese DJ, Locke SA, Primicerio R, Amundsen PA. 2015. Parasite communities of two three-spined stickleback populations in subarctic Norway – effects of a small spatial-scale host introduction. Parasitology Research, 114, 1327–1339. [Google Scholar]
  38. Kutyrev IA, Mordvinov VA. 2022. Population genetic structure of diphyllobothriid tapeworms (Cestoda: Diphyllobothriidea) parasitising fish in the Baikal Rift Zone. Diseases of Aquatic Organisms, 148, 113–125. [Google Scholar]
  39. Li WX, Fu PP, Zhang D, Boyce K, Xi BW, Zou H, Li M, Wu SG, Wang GT. 2018. Comparative mitogenomics supports synonymy of the genera Ligula and Digramma (Cestoda: Diphyllobothriidae). Parasites & Vectors, 11, 324. [Google Scholar]
  40. Logan FJ, Horák A, Štefka J, Aydogdu A, Scholz T. 2004. The phylogeny of diphyllobothriid tapeworms (Cestoda: Pseudophyllidea) based on ITS-2 rDNA sequences. Parasitology Research, 94, 10–15. [Google Scholar]
  41. Malmquist HJ, Snorrason SS, Skúlason S. 1986. Bleikjan í Þingvallavatni. II. Bandormasýking. [The Arctic charr in Lake Thingvallavatn. II. Tapeworm infection]. Náttúrufræðingurinn, 56, 77–87 [in Icelandic]. [Google Scholar]
  42. McDonald TE, Margolis L. 1995. Synopsis of the parasites of fishes of Canada: Supplement (1978–1993). Department of Fisheries and Oceans, Ottawa, Canada. [Google Scholar]
  43. Nei M, Rooney AP. 2005. Concerted and birth-and-death evolution of multigene families. Annual Review of Genetics, 39, 121–152. [Google Scholar]
  44. Pospekhov VV, Atrashkevich GI, Orlovskaya OM. 2013. Helminths and parasitic crustaceans of diadromous chars (Salmonidae: Salvelinus) in the northern Okhotsk Sea. Izvestiya TINRO, 174, 208–233 [in Russian]. [Google Scholar]
  45. Pugachev ON. 2002. Checklist of the freshwater fish parasites of the Northern Asia: Cnidaria, Monogenea, Cestoda. Proceedings of the Zoological Institute, Russian Academy of Sciences (RAN), Russia. [in Russian]. [Google Scholar]
  46. Radačovská A, Čisovská Bazsalovicsová E, Šoltys K, Štefka J, Minárik G, Gustinelli A, Chugunova JK, Králová-Hromadová I. 2022. Unique genetic structure of the human tapeworm Dibothriocephalus latus from the Alpine lakes region – a successful adaptation? Parasitology, 149, 1106–1118. [Google Scholar]
  47. Radačovská A, Čisovská Bazsalovicsová E, Králová-Hromadová I. 2022. Mitochondrial and microsatellite data show close genetic relationships between Dibothriocephalus latus from South America (Argentina) and Europe (the Alpine lakes region). Parasitology Research, 121, 3635–3639. [Google Scholar]
  48. Rahkonen R, Aalto J, Koski P, Särkkä J, Juntunen K. 1996. Cestode larvae Diphyllobothrium dendriticum as a cause of heart disease leading to mortality in hatchery-reared sea trout and brown trout. Diseases of Aquatic Organisms, 25, 15–22. [Google Scholar]
  49. Rochat EC, Paterson RA, Blasco-Costa I, Power M, Adams CE, Greer R, Knudsen R. 2022. Temporal stability of polymorphic Arctic charr parasite communities reflects sustained divergent trophic niches. Ecology and Evolution, 12, e9460. [Google Scholar]
  50. Rozas M, Bohle H, Sandoval A, Ildefonso R, Navarrete A, Bustos P. 2012. First molecular identification of Diphyllobothrium dendriticum plerocercoids from feral rainbow trout (Oncorhynchus mykiss) in Chile. Journal of Parasitology, 98, 1220–1226. [Google Scholar]
  51. Salonen E, Maunu A, Pukkila H, Heinimaa S, Mutenia A, Niva T, Kotajärvi M. 2002. Säännöstellyn Inarijärven ja sen sivuvesistöjen kalataloudellinen velvoitetarkkailu–Toimintakertomus vuodelta 2001. Kala – ja riistaraportteja nro 254, 53 p. [in Finnish]. [Google Scholar]
  52. Schlötterer C. 2004. The evolution of molecular markers – just a matter of fashion? Nature Reviews Genetics, 5, 63–69. [Google Scholar]
  53. Scholz T, Kuchta R. 2016. Fish-borne, zoonotic cestodes (Diphyllobothrium and relatives) in cold climates: A never-ending story of neglected and (re)-emergent parasites. Food and Waterborne Parasitology, 4, 23–38. [Google Scholar]
  54. Semenas L, Viozzi G, Arbetman M. 2021. A regional study of the zoonotic broad tapeworm Dibothriocephalus spp. in Northwestern Patagonia (Argentina): origin of fishes and coastal cities as factors affecting infection in fishes. Parasitology Research, 120, 2415–2427. [Google Scholar]
  55. Serdyukov AM. 1979. Diphyllobothriids of Western Siberia. Novosibirsk: Nauka. 120 p. [in Russian]. [Google Scholar]
  56. Skírnisson K, Eydal M, Gunnarsson E, Hersteinsson P. 1993. Parasites of the arctic fox (Alopex lagopus) in Iceland. Journal of Wildlife Diseases, 29, 440–446. [Google Scholar]
  57. Skírnisson K, Pálsdóttir GR, Eydal M. 2018. Parasites of dogs and cats imported to Iceland during 1989–2017 with remarks on parasites occurring in the native populations. Icelandic Agricultural Sciences, 31, 49–63. [Google Scholar]
  58. Škeříková A, Brabec J, Kuchta R, Jiménez JA, García HH, Scholz T. 2006. Is the human-infecting Diphyllobothrium pacificum a valid species or just a South American population of the holarctic fish broad tapeworm, D. latum? American Journal of Tropical Medicine and Hygiene, 75, 307–310. [Google Scholar]
  59. Tolonen A, Lappalainen J. 1999. Origin of the large burbot (Lota lota (L.)) caught in an Arctic ice-fishing competition: a case study. Journal of Applied Ichthyology, 15, 122–126. [Google Scholar]
  60. Valtonen ET, Brummer-Korvenkontio H, Rahkonen R. 1988. A survey of the parasites of coregonids from three water bodies in Finland. Finnish Fisheries Research, 9, 313–322. [Google Scholar]
  61. Valtonen ET, Julkunen M. 1995. Influence of the transmission of parasites from prey fishes on the composition of the parasite community of a predatory fish. Canadian Journal of Fisheries and Aquatic Sciences, 52, 233–245. [Google Scholar]
  62. Vik R. 1957. Studies of the helminth fauna of Norway. I. Taxonomy and ecology of Diphyllobothrium norvegicum n. sp. and the plerocercoid of Diphyllobothrium latum (L.). Nytt Magasin for Zoologi (Norwegian Journal of Zoology), 5, 25–93. [Google Scholar]
  63. von Bonsdorff B. 1977. Diphyllobothriasis in man. New York: Academic Press. [Google Scholar]
  64. Waeschenbach A, Brabec J, Scholz T, Littlewood DTJ, Kuchta R. 2017. The catholic taste of broad tapeworms – multiple routes to human infection. International Journal for Parasitology, 47, 831–843. [Google Scholar]
  65. Weiland KA. 1989. Prestocking assessment of the prevalence and intensity of Diphyllobothrium ditremum (Creplin) plerocercoids in freshwater barriered lakes in Alaska. Master Thesis, University of Alaska. [Google Scholar]
  66. Wicht B, Yanagida T, Scholz T, Ito A, Jiménez JA, Brabec J. 2010. Multiplex PCR for differential identification of broad tapeworms (Cestoda: Diphyllobothrium) infecting humans. Journal of Clinical Microbiology, 48, 3111–3116. [Google Scholar]
  67. Yamasaki H, Muto M, Yamada M, Arizono N, Rausch RL. 2012. Validity of the bear tapeworm Diphyllobothrium ursi (Cestoda: Diphyllobothriidae) based on morphological and molecular markers. Journal of Parasitology, 98, 1243–1247. [Google Scholar]
  68. Yamasaki H, Sato MO, Kuramochi T, Mercado R. 2023. Genetic characterization of Dibothriocephalus latus and Dibothriocephalus dendriticus (Cestoda: Diphyllobothriidae) from Chile based on haplotype analysis using mitochondrial DNA markers. Parasitology International, 96, 102767. [Google Scholar]
  69. Yera H, Nicoulaud J, Dupouy-Camet J. 2008. Use of nuclear and mitochondrial DNA PCR and sequencing for molecular identification of Diphyllobothrium isolates potentially infective for humans. Parasite, 15, 402–407. [Google Scholar]
  70. Zane L, Bargelloni L, Patarnello T. 2002. Strategies for microsatellite isolation: a review. Molecular Ecology, 11, 1–16. [Google Scholar]

Cite this article as: Králová-Hromadová I, Dinisová L, Radačovská A, Karlsbakk E, Skírnisson K & Čisovská Bazsalovicsová E. 2025. Usefulness of microsatellite loci for differentiating between Dibothriocephalus dendriticus and Dibothriocephalus ditremus (Cestoda: Diphyllobothriidea). Parasite 32, 41. https://doi.org/10.1051/parasite/2025033.

All Tables

Table 1

Details on Dibothriocephalus dendriticus and Dibothriocephalus ditremus specimens used in the current study for tests of specificity of primers.

In the text
Table 2

Details on primers used for tests of their specificity for Dibothriocephalus dendriticus and Dibothriocephalus ditremus.

In the text
Table 3

Percentage identity of rRNA gene subunits/spacers and mitochondrial genes within and between Dibothriocephalus dendriticus and Dibothriocephalus ditremus.

In the text

All Figures

thumbnail Figure 1

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using D. dendriticus-specific cox1 primers designed by Wicht et al. (2010). Lane M: 100 bp ladder.
In the text
thumbnail Figure 2

Graphical scheme of mutation sites within the contiguous sequences of the small rRNA gene subunit (ssrDNA), the large rRNA gene subunit (lsrDNA) and the internal transcribed spacers 1 and 2 (ITS1 and ITS2 rDNA) of Dibothriocephalus dendriticus and Dibothriocephalus ditremus based on sequences presented in Supplementary Table 1. ITS2 sequences published by Rozas et al., 2012 (468 bp) were used as the reference sequence. The length of ITS2 spacer varied from 464 bp to 480 bp due to different number of repetitive motifs and insertions/deletions.
In the text
thumbnail Figure 3

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using (A) primers amplifying the microsatellite locus Dd_8 and (B) primers amplifying the microsatellite locus Dd_33 designed by Bazsalovicsová et al. (2020) for D. dendriticus. Lane M: 100 bp ladder.
In the text
thumbnail Supplementary Figure 1:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using (A) D. dendriticus-specific (Dde_cox1_F; Dde_cox1_R) and (B) D. ditremus-specific (Ddi_cox1_F; Ddi_cox1_R) cox1 primers designed in the current study. Lane M: 100 bp ladder.
In the text
thumbnail Supplementary Figure 2:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using the first set of (A) D. dendriticus-specific (Dde_cob_F1; Dde_cob_R1) and (B) D. ditremus-specific (Ddi_cob_F1; Ddi_cob_R1) cob primers designed in the current study. Lane M: 100 bp ladder.
In the text
thumbnail Supplementary Figure 3:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using the second set of (A) D. dendriticus-specific (Dde_cob_F2; Dde_cob_R2) and (B) D. ditremus-specific (Ddi_cob_F2; Ddi_cob_R2) cob primers designed in the current study. Lane M: 100 bp ladder.
In the text
thumbnail Supplementary Figure 4:

PCR amplification of genomic DNA of Dibothriocephalus dendriticus (Dde) and Dibothriocephalus ditremus (Ddi) from Takvatn lake, Norway (NO-TA), Kalandsvatn lake, Norway (NO-KA), Hafravatn lake, Iceland (IS-HA) and Thingvallavatn lake, Iceland (IS-TH) using (A) primers amplifying the microsatellite locus Dd_38 and (B) primers amplifying the microsatellite locus Dd_78 designed by Bazsalovicsová et al. (2020) for D. dendriticus. Lane M: 100 bp ladder.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.