EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 27 (2020) Parasite, 27 (2020) 29 Full HTML
Open Access
Issue
Parasite
Volume 27, 2020
Article Number 29
Number of page(s) 12
DOI https://doi.org/10.1051/parasite/2020027
Published online 30 April 2020

© G.S.V. Tavares et al., published by EDP Sciences, 2020

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Leishmaniases are diseases caused by parasitic protozoa belonging to more than 20 different Leishmania species [61]. Distinct clinical manifestations of this disease complex are found in infected mammalian hosts, ranging from self-curing cutaneous lesions to life-threatening visceral disease [60]. Visceral leishmaniasis (VL) is caused by Leishmania donovani species in Asia and Africa, and by L. infantum in the Mediterranean Basin, Middle East and the Americas. Acute disease, which is characterized by several symptoms, such as fever, anemia, weight loss and fatigue, can be fatal if left untreated [12, 28]. About 0.2–0.4 million VL cases occur each year, of which the majority are reported in India, where the disease is an important public health problem [52]. In the Americas, Brazil accounts for about 90% of the VL cases recorded annually [60].

Since it is often difficult to rapidly and precisely diagnose VL, and no human vaccines are available, treatment of VL should be improved. However, there are problems associated with the side effects caused by drugs, besides the prolonged hospitalization time, high cost, and/or the emergence of parasite resistance [20, 54]. Amphotericin B (AmpB) is a known antifungal agent that has shown effective antileishmanial activity against distinct Leishmania species [5, 43, 45]. The mechanism of action of the drug was related to binding to ergosterol present in the parasite membrane, hampering cell permeability, and causing the loss of cations and cell death [9]. However, the use of AmpB has been limited, mainly due to drug toxicity, which can cause nephrotoxicity, cardiac changes, hemolysis, and liver damage [50].

AmpB-based liposomal formulations are better tolerated than the free drug. They also present a high therapeutic index, short treatment period, and higher safety for patients [23]. However, these formulations have high cost and, as a consequence, their use is limited [39]. AmBisome® is an AmpB-based liposome formulation used as first-line therapy against VL, and in some countries, such as India, it is provided at a reduced cost and/or as a donation [62]. Miltefosine has also been used to treat VL, administered via the oral route. However, the drug is teratogenic and parasite resistance has been identified [16, 49]. In this context, there is a need to identify new antileishmanial compounds that are effective against different Leishmania species, and that have a low cost, with the aim of improving the quality of treatment.

Not less important, drug delivery systems have been used to circumvent the toxicity of older drugs, but without losing their biological effect [43]. These systems include nanoparticles, microspheres and micelles, which are applied to reduce the toxicity of conventional drugs, such as AmpB [1, 4, 25, 41]. Poloxamer 407® is a thermo-reversible co-polymer with an amphiphilic nature, consisting of hydrophilic and hydrophobic segments. Such compounds are inexpensive and easily manufactured, and have good stability and efficient targeting ability [40]. In this context, Poloxamer 407-based micelles have been developed and evaluated as delivery systems to treat various diseases [59, 63, 31].

Recently, a flavonoid called 8-hydroxyquinoline (8-HQN) was incorporated into a Poloxamer 407-based system (8-HQN/M), and the composition was found to be effective in treating L. amazonensis infection in BALB/c mice [30]. In another study, clioquinol (5-chloro-7-iodoquinolin-8-ol or ICHQ), an 8-HQN derivate, also showed in vitro antileishmanial activity against L. amazonensis and L. infantum species [55], alongside in vivo activity against murine tegumentary leishmaniasis (TL) [56]. In this study, ICHQ was incorporated into Poloxamer 407 micelles (ICHQ/M), and the composition was evaluated in L. amazonensis-infected BALB/c mice versus the use of AmpB and AmBisome®. Results suggested that ICHQ and ICHQ/M-treated mice presented the highest reductions in their average lesion diameter and parasite burden in the infected tissue, spleen, liver and draining lymph nodes of the animals, which were correlated with the development of antileishmanial Th1-type response, based on production of IFN-γ, IL-12, TNF-α, and GM-CSF. No toxicity was found in the treated and infected animals [56].

With the aim of identifying new antileishmanial targets, in the present study, the ICHQ/Mic composition was evaluated against L. infantum infection. Miltefosine was used as a drug control. The compounds were administered by the subcutaneous or oral route (miltefosine) in the infected mice, and the efficacy of the treatments was evaluated one and 15 days after therapy, when parasitological and immunological parameters were investigated by specific techniques, such as a limiting dilution assay, quantitative real-time PCR (RT-PCR), capture ELISA, and flow cytometry.

Materials and methods

Mice and parasites

The study was approved by the Committee for the Ethical Handling of Research Animals of the Federal University of Minas Gerais (UFMG; Belo Horizonte, Minas Gerais, Brazil), under protocol number 085/2017. Female BALB/c mice (8 weeks old) were purchased from the Institute of Biological Sciences of UFMG, and were kept under pathogen-free conditions. The L. infantum (MHOM/BR/1970/BH46) strain was used. Stationary promastigotes were grown in Schneider’s medium (Sigma-Aldrich, USA) containing 20% heat-inactivated fetal bovine serum (FBS; Sigma-Aldrich, USA) and 20 mM L-glutamine at pH 7.4 in 24 °C [10].

Preparation of the ICHQ-containing micelles

Poloxamer 407 (Pluronic® F127), ICHQ, and miltefosine were purchased from Sigma-Aldrich (St. Louis, MO, USA), with catalog numbers 16758, 130-26-7, and 58066-85-6, respectively. ICHQ-containing micelles (ICHQ/M) were prepared as described [56]. Briefly, Poloxamer 407 (18% w/w) was diluted in phosphate buffer (PBS 1×) at pH 7.4 under magnetic agitation for 18 h and 4 °C. Eight milligrams of the molecule were added to 500 μL of dichloromethane and solubilized using vortex. The mixture was added to the previously prepared solution under vigorous magnetic agitation and in an ice bath until a viscous emulsion was obtained. The dichloromethane was evaporated using a rotary evaporator (Buchi, Flawil, Switzerland), and the ICHQ-containing composition was obtained as a transparent yellow gel at room temperature. Empty micelles were prepared (18% w/w) using the same protocol.

Infection and treatment schedule

Mice (n = 12 per group) were infected with 107 L. infantum stationary promastigotes through subcutaneous injection. Forty-five days post-infection, animals were divided into groups and received one of the following treatment schedules by the subcutaneous route, every 2 days for 10 days: (a) control (saline) group: mice received 50 μL of PBS 1× pH 7.4; (b) empty micelle (Mic/B) group: mice received 50 μL of micelles (10 mg/kg body weight); (c) miltefosine group: mice received 2 mg/kg body weight of drug, which was applied by the oral route; (d) ICHQ group: mice received 50 μL of ICHQ (10 mg/kg body weight); and (e) ICHQ/micelle (ICHQ/Mic) group: mice received 50 μL of ICHQ-containing micelles (5 mg/kg body weight). Half of the animals were euthanized one and 15 days after treatment, when parasitological and immunological parameters were evaluated.

Parasite load evaluated by limiting dilution

The parasitism in the treated and infected mice was investigated in their spleen, liver, bone marrow (BM) and draining lymph nodes (dLN), one and 15 days after treatment, by using alimiting dilution assay [15]. Briefly, organs were macerated in a glass tissue grinder using sterile PBS, and tissue debris were removed by centrifugation at 150 ×g. Cells were concentrated by centrifugation at 2,000 ×g, pellets were resuspended in 1 mL of complete Schneider’s medium and a log-fold serial dilution was performed in Schneider’s medium (10−1–10−12 dilution). Each sample was plated in triplicate, and read 7 days after the beginning of the cultures, at 24 °C. Results were expressed as the negative log of the titer (the dilution corresponding to the last positive well) adjusted per milligram of organ.

Splenic parasitism evaluated by RT-PCR

Splenic parasitism was also evaluated using an RT-PCR technique [17]. Briefly, spleen DNA was extracted using a Wizard Genomic DNA Purification Kit (Promega Corporation), according to the manufacturer’s recommendations. The DNA was resuspended in 100 μL of milli-Q water, and the parasite burden was estimated using the following primers to amplify the L. infantum kDNA: Forward (CCTATTTTACACCAACCCCCAGT) and Reverse (GGGTAGGGGCGTTCTGCGAAA). The Mouse β-actin gene (Forward: CAGAGCAAGAGAGGTATCC; Reverse: TCATTGTAGAAGGTGTGGTGC) was used as an endogenous control to normalize nucleated cells and single-copy-number, as well as to verify sample integrity. Standard curves were obtained from DNA extracted from 1 × 108 parasites for kDNA and 1 × 108 peritoneal macrophages for β-actin, under the same conditions used to extract the samples used in the present study. Reactions were processed and analyzed in an ABI Prism 7500 Sequence Detection System (96 well-plate; Applied Biosystems) using 2× SYBRTM Select Master Mix (5 μL; Applied Biosystems), with 2 mM of each primer (1 μL) and 4 μL of DNA (25 ng/μL). Experiments were conducted at the Real-Time PCR Facility – RPT09D PDTIS/René Rachou Institute – FIOCRUZ/MG. The samples were incubated at 95 °C for 10 min, and then submitted to 40 cycles of 95 °C for 15 s and 60 °C for 1 min, and at each time point, fluorescence data were collected. Parasite quantification for each spleen sample was calculated by interpolation from the standard curve, performed in duplicate, and converted into number of parasites per nucleated cells (multiplied by one thousand to facilitate visualization).

Cellular response evaluated by a capture ELISA

IFN-γ, IL-4, IL-10, IL-12p70, and GM-CSF levels were measured in the cell supernatant of spleen cells of the treated and infected animals, one and 15 days after treatment. For this, cells (5 × 106 per mL) were plated in duplicate on 24-well plates (Nunc) and incubated in Dulbecco’s Modified Eagle Medium (DMEM) plus 20% FBS and 20 mM L-glutamine at pH 7.4, or stimulated with L. infantum SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. Cytokine levels were measured by a capture ELISA (BD PharMingen®, San Diego, CA, USA), according to the manufacturer’s instructions. Nitrite production was also evaluated in the cellular supernatant by the Griess reaction.

Cytokine profile investigated by flow cytometry

A flow cytometry assay was performed to evaluate the IFN-γ, TNF-α and IL-10-producing CD4+ and CD8+ T cell frequency in the treated and infected animals, 15 days after treatment. For this, cells (5 × 106 per mL) were incubated in complete RPMI 1640 medium in polypropylene tubes (PharMingen®), and were non-stimulated (medium) or stimulated with L. infantum SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. IFN-γ, TNF-α and IL-10-producing CD4+ and CD8+ T cell frequency was evaluated using an analysis based on their relative flow cytometry size (forward laser scatter – FSC) and granularity (side laser scatter – SSC) graphs. After the selection of the interest region R1 containing FSCLow and SSCLow phenotype cells, graphs of density plot distribution of CD4/FL1 or CD8/FL1 versus IFN-γ/FL2+, TNF-α/FL2+, and IL-10/FL2+ cells were constructed, in order to determine the IFN-γ+, TNF-α+, and IL-10+ T cell frequency. Results were expressed as indexes, which were calculated by the ratio between the cytokine-producing T cell percentages versus the values found in the non-stimulated culture.

Humoral response

The anti-SLA IgG1 and IgG2a isotype levels were evaluated in sera samples of the treated and infected animals, one and 15 days after treatment. L. infantum SLA was used as an antigen (1.0 μg per well), and sera samples were 1:100 diluted in PBS-T (PBS 1× plus 0.05% Tween 20). Both anti-mouse IgG1 and IgG2a horseradish-peroxidase conjugated antibodies (Sigma-Aldrich, USA) were used in a 1:10,000 dilution, which was performed using PBS-T. Reactions were developed by adding H2O2, ortho-phenylenediamine and citrate-phosphate buffer at pH 5.0, for 30 min and in the dark. Reactions were then stopped by adding 2N H2SO4, and the optical density (OD) values were read in an ELISA microplate spectrophotometer (Molecular Devices, Spectra Max Plus, Canada) at 492 nm.

Statistical analysis

Results were entered into Microsoft Excel (version 10.0) spreadsheets and analyzed by GraphPad PrismTM (version 6.0 for Windows; GraphPad Software, La Jolla, CA, USA). The one-way analysis of variance (ANOVA) followed by Bonferroni’s post-test were used for comparisons between the groups. Differences were considered significant with p < 0.05. Experiments were repeated and results were similar.

Results

Cellular profile developed in treated and infected mice

In this study, ICHQ was incorporated in a Poloxamer 407-based micelle system, and the composition was evaluated for the treatment of L. infantum-infected BALB/c mice. The chemical structure of the ICHQ compound is shown in Figure 1. Initially, the cellular profile in the treated and infected animals was investigated, by means of assay of anti-parasite Th1 and Th2-type cytokines in the culture supernatant of the stimulated splenocytes. Performing the evaluations one day after treatment, results showed that spleen cells of the miltefosine, ICHQ or ICHQ/Mic-treated mice produced significantly higher IFN-γ, IL-12 and GM-CSF levels, which were associated with low IL-4 and IL-10 production. On the other hand, mice in the saline and Mic/B groups produced higher antileishmanial IL-4 and IL-10 levels (Fig. 2A). As an indicator of NO production and macrophage activation, the nitrite secretion was evaluated in the culture supernatant, and results showed that miltefosine, ICHQ or ICHQ/Mic-treated animals produced significantly higher nitrite levels, when compared to the controls (Fig. 2B). Ratios between the IFN-γ and IL-10 levels were calculated and results showed a polarized Th1-type response in these animals (Fig. 2C). Evaluating the animals 15 days after treatment, a similar cellular profile was found in the animals, since higher parasite-specific IFN-γ, IL-12, and GM-CSF levels were found, associated with low IL-4 and IL-10 levels (Fig. 3A). By contrast, spleen cells of the mice in the saline and Mic/B groups produced significantly higher IL-4 and IL-10 levels. The nitrite secretion also showed similar results to those obtained when analyses were performed one day after treatment, indicating persistent macrophage activation to kill internalized parasites (Fig. 3B). The ratios between IFN-γ and IL-10 levels were also calculated and results showed the maintenance of Th1-type profiles in these animals (Fig. 3C). A flow cytometry assay indicated that the treatment with miltefosine, ICHQ or ICHQ/Mic induced higher IFN-γ and TNF-α-producing CD4+ and CD8+ T-cell frequency, when compared to the controls (Fig. 4). Comparing the results between the treatments, the ICHQ/Mic composition presented higher Th1-type T cell frequency, when compared to values found in the miltefosine or ICHQ treated groups.

thumbnail Figure 1

Chemical structure of the clioquinol (ICHQ) compound.

thumbnail Figure 2

Cellular response developed in the treated and infected animals, one day after treatment. Splenocytes of the treated and infected animals were collected one day after treatment, and cells (5 × 106 per mL) were non-stimulated (medium) or stimulated with Leishmania infantum SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. IFN-γ, IL-4, IL-10, IL-12p70 and GM-CSF levels were measured in the cell supernatant by a capture ELISA (A). Nitrite production was also evaluated in the cell supernatant using the Griess reaction (B). Ratios between the IFN-γ and IL-10 levels were calculated and results are shown (C). Bars represent the mean ± standard deviation of the groups. (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.0001). (+) indicates a statistically significant difference in relation to the miltefosine, ICHQ, and ICHQ/Mic groups (p < 0.0001).

thumbnail Figure 3

Cellular profile generated in the treated and infected animals, 15 days after treatment. Fifteen days after treatment, cellular response was also evaluated in the treated and infected animals. Spleen cells (5 × 106 per mL) were non-stimulated (medium) or stimulated with Leishmania infantum SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. IFN-γ, IL-4, IL-10, IL-12p70 and GM-CSF levels were measured in the cell supernatant by a capture ELISA (A). Nitrite production was also evaluated in the cell supernatant (B). The ratios between the IFN-γ and IL-10 levels were calculated, and values are also shown (C). Bars represent the mean ± standard deviation of the groups. (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.001). (+) indicates a statistically significant difference in relation to the miltefosine, ICHQ, and ICHQ/Mic groups (p < 0.001).

thumbnail Figure 4

Intracytoplasmic cytokine-producing CD4+ and CD8+ T-cell frequency in the treated and infected animals. BALB/c mice were infected with Leishmania infantum promastigotes and received saline or were treated with empty micelle (B/Mic), miltefosine, ICHQ, or ICHQ/Mic. The animals were euthanized 15 days after treatment, when their splenocytes were collected and non-stimulated or in vitro stimulated with SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. Results were expressed as cytokine indexes (stimulated culture/control culture ratio) to obtain the IFN-γ, TNF-α and IL-10-producing CD4+ and CD8+ T cell frequency. Bars indicate the mean ± standard deviation of the groups. (*) and (**) indicate statistically significant differences in relation to the saline and B/Mic groups, respectively (p < 0.05).

Humoral response generated in the treated and infected animals

Anti-parasite IgG1 and IgG2a isotype antibody levels were evaluated one and 15 days after treatment (Fig. 5). Evaluating the samples one day after treatment, results showed that miltefosine, ICHQ or ICHQ/Mic-treated mice produced higher levels of antileishmanial IgG2a isotype than IgG1 isotype. However, IgG1 production was higher in the control (saline and Mic/B) groups. Results obtained 15 days after treatment indicated maintenance of the humoral profile in the animals, and those treated with ICHQ/Mic presented the most polarized anti-parasite IgG2a-based humoral response, when compared to the values found in the other groups. Again, parasite-specific IgG1 production was higher in the saline and Mic/B groups.

thumbnail Figure 5

Humoral response developed in the treated and infected animals. Serum samples were collected from the treated and infected animals, one (A) and 15 (B) days after treatment, when the anti-parasite IgG1 and IgG2a isotype levels were evaluated. White and grey bars indicate the mean ± standard deviation of the IgG1 and IgG2a levels, respectively. (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.001). (+) indicates a statistically significant difference in relation to the miltefosine, ICHQ, and ICHQ/Mic groups (p < 0.001).

Parasitological evaluation in the treated and infected mice

In vivo antileishmanial activity was evaluated by means of the evaluation of parasite load in distinct organs of the treated and infected mice, one and 15 days after treatment. Results showed that the treatment using miltefosine, ICHQ or ICHQ/Mic induced to most significant reductions in the parasite load in liver, spleen, BM and dLNs of the animals, when compared to the controls, in both periods of time after treatment (Fig. 6). A comparison performed between the treatments suggested that the ICHQ/Mic composition induced to the highest reductions in the parasite burden, when compared to the other groups. Similar results were obtained when the splenic parasite load was evaluated by RT-PCR (Fig. 7). In addition, no organic toxicity was found when ICHQ and ICHQ/Mic were used in the animals.

thumbnail Figure 6

Parasite load evaluated by a limiting dilution assay. To evaluate the in vivo antileishmanial action of ICHQ incorporated or not in a micellar system, BALB/c mice (n = 12 per group) were subcutaneously infected with 107 Leishmania infantum stationary promastigotes. 45 days after infection, they received subcutaneous injections every 2 days for 10 days with: saline, empty micelle (Mic/B), ICHQ, ICHQ/Mic, or miltefosine (oral route). Half of the animals per group were euthanized one and 15 days after treatment, when liver, spleen, bone marrow and draining lymph nodes were collected for evaluation of the parasite load. White and grey bars indicate the mean ± standard deviation of the groups, one and 15 days after treatment, respectively, in liver (A), spleen (B), bone marrow (C), and draining lymph nodes (D). (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.001). (#) indicates a statistically significant difference in relation to the miltefosine and ICHQ groups (p < 0.01).

thumbnail Figure 7

Splenic parasitism evaluated by RT-PCR. Splenic parasitism was also evaluated by RT-PCR, one and 15 days after treatment. Results were converted into number of parasites (in log) per nucleated cell (multiplied by one thousand to facilitate visualization). Bars indicate the mean ± standard deviation of the groups. (*), (#) and (Δ) indicate statistically significant differences in comparison to the saline, Mic/B and miltefosine groups, respectively (p < 0.05).

Discussion

Visceral leishmaniasis is a neglected tropical disease in the world, which affects mainly poorer populations in developing countries [61]. Current treatment is based on the use of pentavalent antimonials; however, they can cause severe side effects in patients, such as hepatic, cardiac and renal toxicity [53]. In addition, less toxic drugs are more expensive or have limited availability. In this context, the identification of new antileishmanial agents should be performed. Interest in the use of natural products to treat diseases such as leishmaniasis has increased in recent decades. For instance, naphthoquinones and quinolines have been used in in vitro experiments against various Leishmania spp., and positive results have been obtained [2, 7]. These compounds are natural aromatic metabolites found in several plant families, and they present relevant biological activity, such as antileishmanial action [37, 46].

In a recent study, our research group identified a quinoline-derived molecule called clioquinol or ICHQ, which was tested in vitro against L. amazonensis and L. infantum. Results showed significant antileishmanial activity against both parasite species, in addition to low toxicity in murine and human cells and efficacy in treating infected macrophages [55]. In addition, ICHQ was incorporated in a Poloxamer 407-based polymeric system, and the composition showed in vivo efficacy against L. amazonensis infection in BALB/c mice, since significant reductions in the average lesion diameter and parasite burden were found, along with the development of an antileishmanial Th1-type response [56]. With the aim of identifying new antileishmanial agents, in the present study, ICHQ/Mic was evaluated against L. infantum infection.

Results obtained demonstrated that the treatment of the infected mice induced significant reductions in the parasite load in all evaluated organs, and animals developed anti-parasite Th1-type immunity, which was based on the production of high levels of IFN-γ, IL-12 and GM-CSF, associated with low IL-4 and IL-10 production, with predominance of anti-SLA IgG2a isotype antibody. More importantly, parasitological and immunological correlates were similar when two different endpoints were evaluated, one and 15 days after treatment, suggesting possible long-term activity of the composition against L. infantum infection. This is important mainly because studies usually evaluate one endpoint after antileishmanial therapy [6, 13, 42].

Miltefosine is a drug used to treat leishmaniasis [22, 58]. It has been shown to be effective against various parasite species, such as those causing visceral leishmaniasis and/or tegumentary leishmaniasis [8, 19, 44]. However, recent reports have shown that miltefosine can cause adverse effects such as nausea and vomiting during and/or after administration as well as teratogenicity. As a consequence, the compound is contra-indicated in pregnancy [51]. In addition, disease relapse and the occurrence of post kala-azar dermal leishmaniasis after treatment have been reported [14].

In the present study, we used ICHQ/Mic, which was recently suggested to be effective against murine TL [56], to treat L. infantum-infected BALB/c mice, a parasite species responsible for VL cases in the Americas. Results showed that the composition was effective in reducing the parasite load in the treated and infected animals, and stimulated the development of Th1-type immune response in such animals, when two distinct endpoints were evaluated. Although we did not perform a full dose-response study comparing the efficacy between ICHQ/Mic and miltefosine, and this is a limitation of our work, our data suggest that ICHQ/Mic could be, at least, considered for future studies as a therapeutic agent for the treatment of VL.

The development of specific Th1-type immunity is a requirement for Leishmania control in infected hosts [48]. In this context, the production of cytokines, such as IFN-γ and IL-12, among other pro-inflammatory molecules, is considered detrimental to stimulate infected cells to kill internalized parasites [33, 64]. Here, the treatment of the infected mice using miltefosine also induced the activation of Th1-type immune cells, with high levels of antileishmanial IFN-γ, IL-12 and GM-CSF cytokines being found in the cell supernatant of the stimulated cells. These findings are consistent with reports in the literature on the protective effect of miltefosine to treat Leishmania infection [38]. ICHQ/Mic-treated mice also presented a Th1-type immune response and, more importantly, they did not show adverse effects and/or inflammatory reactions after the administration of doses. This suggests the absence of toxicity caused by this composition in the animals, as described in other studies [48, 55, 56]. Considering that infected macrophages, when activated by Th1-type cytokines, can kill Leishmania parasites [57], we measured the nitrite levels in the treated and infected animals. Based on the finding that spleen cells of ICHQ/Mic-treated and infected mice responded with higher IFN-γ production after re-stimulation with the parasite protein extract, we suggest a correlation between the cellular response developed in the animals and the reduced parasitism found in the evaluated organs.

Quinoline-derivative molecules have shown antileishmanial activity in both in vitro and/or in vivo experiments against different Leishmania spp., such as L. amazonensis, L. mexicana, and L. donovani, among others [11, 17, 24]. However, when used to treat infected mice, high daily doses (between 10 and 50 mg per kg body weight) are usually administered to the animals [32, 42, 47]. Here, we reported the in vivo efficacy of ICHQ/Mic against L. infantum infection by using 5.0 mg of ICHQ per kg body weight. We administered the composition for 10 days, with a two-day interval, via the subcutaneous route. In this context, only five doses were administered. In other studies, higher numbers of doses and concentrations of antileishmanial compounds are usually employed in the animals, aiming to enhance their efficacy [21, 36, 42]. The results found here indicated a 90% reduction in the parasite load in the treated and infected animals, when compared to the other groups. In addition, the hepatic parasite load was almost completely eliminated, with a 95.0% reduction being found in the ICHQ/Mic-treated animals. This suggests a positive systemic effect of this composition against VL.

Poloxamer 407 (Pluronic F127) is a non-ionic surfactant formed by symmetric tri-block copolymers composed of propylene oxide and ethylene oxide [26]. It has a hydrophobic core and a hydrophilic shell, which can harbor the amphiphilic moiety and prevent the direct exposure to vital organs [29]. The interface formed by the hydrophilic block prevents micellar aggregation, protein recognition, and non-specific adherence, thereby sparing the body from the adverse effects induced by antileishmanial compounds [47]. Poloxamer 407-based formulations have been successfully tested against leishmaniasis, and they present advantages when compared to traditional formulations, such as efficacy, target orientation, low toxicity, and low cost [27]. These formulations have been administered by the subcutaneous route in murine models, since a semi-rigid gel is formed in contact with the local tissue, creating a reservoir system to maintain the product in the extracellular space. In the course of hours, the gel matrix is diluted by body fluids and the product is gradually released into the circulation, enabling its systemic action in a controlled manner [3]. This allows administration of the formulations with a higher time interval between doses, and makes it possible to reduce the number of applications and/or treatment times [18, 34, 35, 56].

The absence of other treatment regimens, such as the use of other antileishmanial products to compare with data obtained using miltefosine and ICHQ/Mic, as well as the absence of parasitological and immunological evaluations performed over longer periods of time after treatment are considered limitations of this study. Nevertheless, our data suggest that ICHQ/Mic presents in vivo antileishmanial activity against L. infantum, and could be tested in future studies as a candidate for the treatment of visceral leishmaniasis.

Conflict of interest

The authors confirm that they have no conflicts of interest in relation to this work.

Acknowledgments

The authors thank the Program for Technological Development in Tools for Health-PDTIS-FIOCRUZ for use of its facilities. The authors would also like to thank CAPES, CNPq, and FAPEMIG for scholarships. The study was supported by grants from CNPq (APQ-408675/2018-7).

References

  1. Aghdam MA, Bagheri R, Mosafer J, Baradaran B, Hashemzaei M, Baghbanzadeh A, de la Guardia M, Mokhtarzadeh A. 2019. Recent advances on thermosensitive and pH-sensitive liposomes employed in controlled release. Journal of Controlled Release, 315, 1–22. [CrossRef] [Google Scholar]
  2. Araújo IAC, Paula RC, Alves CL, Faria KF, Oliveira MM, Mendes GG, Dias EMFA, Ribeiro RR, Oliveira AB, Silva SMD. 2019. Efficacy of lapachol on treatment of cutaneous and visceral leishmaniasis. Experimental Parasitology, 199, 67–73. [CrossRef] [PubMed] [Google Scholar]
  3. Barichello JM, Morishita M, Takayama K, Nagai T. 1999. Absorption of insulin from pluronic F-127 gels following subcutaneous administration in rats. International Journal of Pharmaceutics, 184, 189–198. [CrossRef] [PubMed] [Google Scholar]
  4. Barros D, Costa Lima SA, Cordeiro-da-Silva A. 2015. Surface functionalization of polymeric nanospheres modulates macrophage activation: relevance in leishmaniasis therapy. Nanomedicine (London), 10, 387–403. [CrossRef] [Google Scholar]
  5. Berenguer D, Alcover MM, Sessa M, Halbaut L, Guillén C, Boix-Montañés A, Fisa R, Calpena-Campmany AC, Riera C, Sosa L. 2020. Topical amphotericin B semisolid dosage form for cutaneous leishmaniasis: Physicochemical characterization, ex vivo skin permeation and biological activity. Pharmaceutics, 12, e149. [CrossRef] [PubMed] [Google Scholar]
  6. Cabral LIL, Pomel S, Cojean S, Amado PSM, Loiseau PM, Cristiano MLS. 2020. Synthesis and Antileishmanial Activity of 1,2,4,5-Tetraoxanes against Leishmania donovani. Molecules, 25, e465. [CrossRef] [PubMed] [Google Scholar]
  7. Calixto SL, Glanzmann N, Xavier Silveira MM, Granato JT, Scopel KKG, Aguiar TT, DaMatta RA, Macedo GC, Silva AD, Coimbra ES. 2018. Novel organic salts based on quinoline derivatives: the in vitro activity trigger apoptosis inhibiting autophagy in Leishmania spp. Chemico-Biological Interactions, 293, 141–151. [CrossRef] [PubMed] [Google Scholar]
  8. Carregal VM, Lanza JS, Souza DM, Islam A, Demicheli C, Fujiwara RT, Rivas L, Frézard F. 2019. Combination oral therapy against Leishmania amazonensis infection in BALB/c mice using nanoassemblies made from amphiphilic antimony(V) complex incorporating miltefosine. Parasitology Research, 118, 3077–3084. [CrossRef] [PubMed] [Google Scholar]
  9. Chávez-Fumagalli MA, Ribeiro TG, Castilho RO, Fernandes SO, Cardoso VN, Coelho CS, Mendonça DV, Soto M, Tavares CA, Faraco AA, Coelho EA. 2015. New delivery systems for amphotericin B applied to the improvement of leishmaniasis treatment. Revista da Sociedade Brasileira de Medicina Tropical, 48, 235–242. [CrossRef] [PubMed] [Google Scholar]
  10. Coelho EAF, Tavares CA, Carvalho FA, Chaves KF, Teixeira KN, Rodrigues RC, Charest H, Matlashewski G, Gazzinelli RT, Fernandes AP. 2003. Immune responses induced by the Leishmania (Leishmania) donovani A2 antigen, but not by the LACK antigen, are protective against experimental Leishmania (Leishmania) amazonensis infection. Infection and Immunity, 71, 3988–3994. [CrossRef] [PubMed] [Google Scholar]
  11. Coimbra ES, Antinarelli LM, Silva NP, Souza IO, Meinel RS, Rocha MN, Soares RP, da Silva AD. 2016. Quinoline derivatives: Synthesis, leishmanicidal activity and involvement of mitochondrial oxidative stress as mechanism of action. Chemico-Biological Interactions, 260, 50–57. [CrossRef] [PubMed] [Google Scholar]
  12. Coura-Vital W, Araújo VE, Reis IA, Amancio FF, Reis AB, Carneiro M. 2014. Prognostic factors and scoring system for death from visceral leishmaniasis: an historical cohort study in Brazil. PLOS Neglected Tropical Diseases, 8, e3374. [CrossRef] [PubMed] [Google Scholar]
  13. Cunha-Júnior EF, Pacienza-Lima W, Ribeiro GA, Netto CD, do Canto-Cavalheiro MM, da Silva AJ, Costa PR, Rossi-Bergmann B, Torres-Santos EC. 2011. Effectiveness of the local or oral delivery of the novel naphthopterocarpanquinone LQB-118 against cutaneous leishmaniasis. Journal of Antimicrobial Chemotherapy, 66, 1555–1559. [CrossRef] [Google Scholar]
  14. Deep DK, Singh R, Bhandari V, Verma A, Sharma V, Wajid S, Sundar S, Ramesh V, Dujardin JC, Salotra P. 2017. Increased miltefosine tolerance in clinical isolates of Leishmania donovani is associated with reduced drug accumulation, increased infectivity and resistance to oxidative stress. PLOS Neglected Tropical Diseases, 11, e0005641. [CrossRef] [PubMed] [Google Scholar]
  15. Dias DS, Ribeiro PAF, Martins VT, Lage DP, Costa LE, Chávez-Fumagalli MA, Ramos FF, Santos TTO, Ludolf F, Oliveira JS, Mendes TAO, Silva ES, Galdino AS, Duarte MC, Roatt BM, Menezes-Souza D, Teixeira AL, Coelho EAF. 2018. Vaccination with a CD4+ and CD8+ T-cell epitopes-based recombinant chimeric protein derived from Leishmania infantum proteins confers protective immunity against visceral leishmaniasis. Translational Research, 200, 18–34. [CrossRef] [Google Scholar]
  16. Dorlo TP, Balasegaram M, Beijnen JH, Vries PJ. 2012. Miltefosine: A review of its pharmacology and therapeutic efficacy in the treatment of leishmaniasis. Journal of Antimicrobial Chemotherapy, 67, 2576–2597. [CrossRef] [Google Scholar]
  17. Duarte MC, Lage LM, Lage DP, Martins VT, Carvalho AM, Roatt BM, Menezes-Souza D, Tavares CA, Alves RJ, Barichello JM, Coelho EA. 2016. Treatment of murine visceral leishmaniasis using an 8-hydroxyquinoline-containing polymeric micelle system. Parasitology International, 65, 728–736. [CrossRef] [PubMed] [Google Scholar]
  18. Duarte MC, Lage LM, Lage DP, Martins VT, Carvalho AM, Roatt BM, Menezes-Souza D, Tavares CA, Alves RJ, Barichello JM, Coelho EA. 2016. Treatment of murine visceral leishmaniasis using an 8-hydroxyquinoline-containing polymeric micelle system. Parasitology International, 65, 728–736. [CrossRef] [PubMed] [Google Scholar]
  19. Fernández OL, Diaz-Toro Y, Ovalle C, Valderrama L, Muvdi S, Rodríguez I, Gomez MA, Saravia NG. 2014. Miltefosine and antimonial drug susceptibility of Leishmania Viannia species and populations in regions of high transmission in Colombia. PLOS Neglected Tropical Diseases, 8, e2871. [CrossRef] [PubMed] [Google Scholar]
  20. Frézard F, Demicheli C, Ribeiro RR. 2009. Pentavalent antimonials: new perspectives for old drugs. Molecules, 14, 2317–2336. [CrossRef] [PubMed] [Google Scholar]
  21. Gonçalves GS, Fernandes AP, Souza RC, Cardoso JE, de Oliveira-Silva F, Maciel FC, Rabello A, Ferreira LA. 2005. Activity of a paromomycin hydrophilic formulation for topical treatment of infections by Leishmania (Leishmania) amazonensis and Leishmania (Viannia) braziliensis. Acta Tropica, 93, 161–167. [CrossRef] [PubMed] [Google Scholar]
  22. Goyal V, Burza S, Pandey K, Singh SN, Singh RS, Strub-Wourgaft N, Das VNR, Bern C, Hightower A, Rijal S, Sunyoto T, Alves F, Lima N, Das P, Alvar J. 2019. Field effectiveness of new visceral leishmaniasis regimens after 1 year following treatment within public health facilities in Bihar, India. PLOS Neglected Tropical Diseases, 13, e0007726. [CrossRef] [PubMed] [Google Scholar]
  23. Gupta PK, Jaiswal AK, Kumar V, Verma A, Dwivedi P, Dube A, Mishra PR. 2014. Covalent functionalized self-assembled lipo-polymerosome bearing amphotericin B for better management of leishmaniasis and its toxicity evaluation. Molecular Pharmacology, 11, 951–963. [Google Scholar]
  24. Hernández-Chinea C, Carbajo E, Sojo F, Arvelo F, Kouznetsov VV, Romero-Bohórquez AR, Romero PJ. 2015. In vitro activity of synthetic tetrahydroindeno[2,1-c]quinolines on Leishmania mexicana. Parasitology International, 64, 479–483. [CrossRef] [PubMed] [Google Scholar]
  25. Italia JL, Kumar MN, Carter KC. 2012. Evaluating the potential of polyester nanoparticles for per oral delivery of amphotericin B in treating visceral leishmaniasis. Journal of Biomedical Nanotechnology, 8, 695–702. [CrossRef] [PubMed] [Google Scholar]
  26. James-Smith MA, Shekhawat D, Moudgil BM, Shah DO. 2007. Determination of drug and fatty acid binding capacity to Pluronic F127 in microemulsion. Langmuir, 23, 1640–1644. [CrossRef] [PubMed] [Google Scholar]
  27. Kataoka K, Harada A, Nagasaki Y. 2001. Block copolymer micelles for drug delivery: design, characterization and biological significance. Advanced Drug Delivery Reviews, 47, 113–131. [CrossRef] [PubMed] [Google Scholar]
  28. Kevric I, Cappel MA, Keeling JH. 2015. New World and Old World Leishmania infections: a practical review. Dermatologic Clinics, 33, 579–593. [CrossRef] [PubMed] [Google Scholar]
  29. Kwon GS, Kataoka K. 1995. Block copolymer micelles as long-circulating drug vehicles. Advanced Drug Delivery Reviews, 16, 295–309. [Google Scholar]
  30. Lage LM, Barichello JM, Lage DP, Mendonça DV, Carvalho AM, Rodrigues MR, Menezes-Souza D, Roatt BM, Alves RJ, Tavares CA, Coelho EA, Duarte MC. 2016. An 8-hydroxyquinoline-containing polymeric micelle system is effective for the treatment of murine tegumentary leishmaniasis. Parasitology Research, 115, 4083–4095. [CrossRef] [PubMed] [Google Scholar]
  31. Lamch L, Bazylińska U, Kulbacka J, Pietkiewicz J, Bieżuńska-Kusiak K, Wilk KA. 2014. Polymeric micelles for enhanced Photofrin II® delivery, cytotoxicity and pro-apoptotic activity in human breast and ovarian cancer cells. Photodiagnosis and Photodynamic Therapy, 11, 570–585. [CrossRef] [PubMed] [Google Scholar]
  32. Machín L, Tamargo B, Piñón A, Atíes RC, Scull R, Setzer WN, Monzote L. 2019. Bixa orellana L. (Bixaceae) and Dysphania ambrosioides (L.) Mosyakin & Clemants (Amaranthaceae) essential oils formulated in nanocochleates against Leishmania amazonensis. Molecules, 24, e4222. [CrossRef] [PubMed] [Google Scholar]
  33. Maspi N, Abdoli A, Ghaffarifar F. 2016. Pro- and anti-inflammatory cytokines in cutaneous leishmaniasis: A review. Pathogens and Global Health, 110, 247–260. [CrossRef] [PubMed] [Google Scholar]
  34. Mendonça DVC, Martins VT, Lage DP, Dias DS, Ribeiro PAF, Carvalho AMRS, Dias ALT, Miyazaki CK, Menezes-Souza D, Roatt BM, Tavares CAP, Barichello JM, Duarte MC, Coelho EAF. 2018. Comparing the therapeutic efficacy of different amphotericin B-carrying delivery systems against visceral leishmaniasis. Experimental Parasitology, 186, 24–35. [CrossRef] [PubMed] [Google Scholar]
  35. Mendonça DVC, Tavares GSV, Lage DP, Soyer TG, Carvalho LM, Dias DS, Ribeiro PAF, Ottoni FM, Antinarelli LMR, Vale DL, Ludolf F, Duarte MC, Coimbra ES, Chávez-Fumagalli MA, Roatt BM, Menezes-Souza D, Barichello JM, Alves RJ, Coelho EAF. 2019. In vivo antileishmanial efficacy of a naphthoquinone derivate incorporated into a Pluronic® F127-based polymeric micelle system against Leishmania amazonensis infection. Biomedicine & Pharmacotherapy, 109, 779–787. [CrossRef] [Google Scholar]
  36. Oliveira LFG, Souza-Silva F, Cysne-Finkelstein L, Rabelo K, Amorim JF, Azevedo AS, Bourguignon SC, Ferreira VF, Paes MV, Alves CR. 2017. Evidence for tissue toxicity in BALB/c exposed to a long-term treatment with oxiranes compared to meglumine antimoniate. BioMed Research International, 2017, 9840210. [PubMed] [Google Scholar]
  37. Oliveira LFG, Souza-Silva F, de Castro Côrtes LM, Cysne-Finkelstein L, Souza-Pereira MC, Oliveira-Junior FO, Pinho RT, Corte-Real S, Bourguignon SC, Ferreira VF, Alves CR. 2018. Antileishmanial activity of 2-methoxy-4 h-spiro-[naphthalene-1,2’-oxiran]-4-one (epoxymethoxy-lawsone): A promising new drug candidate for leishmaniasis treatment. Molecules, 23, e864. [CrossRef] [PubMed] [Google Scholar]
  38. Palić S, Bhairosing P, Beijnen JH, Dorlo TPC. 2019. Systematic review of host-mediated activity of miltefosine in leishmaniasis through immunomodulation. Antimicrobial Agents and Chemotherapy, 63, e02507–e02518. [PubMed] [Google Scholar]
  39. Passero LFD, Cruz LA, Santos-Gomes G, Rodrigues E, Laurenti MD, Lago JHG. 2018. Conventional versus natural alternative treatments for leishmaniasis: A review. Current Topics in Medicinal Chemistry, 18, 1275–1286. [CrossRef] [PubMed] [Google Scholar]
  40. Pellosi DS, Moret F, Fraix A, Marino N, Maiolino S, Gaio E, Hioka N, Reddi E, Sortino S, Quaglia F. 2016. Pluronic® P123/F127 mixed micelles delivering sorafenib and its combination with verteporfin in cancer cells. International Journal of Nanomedicine, 11, 4479–4494. [CrossRef] [PubMed] [Google Scholar]
  41. Pham TT, Loiseau PM, Barratt G. 2013. Strategies for the design of orally bioavailable antileishmanial treatments. International Journal of Pharmaceutics, 454, 539–552. [CrossRef] [PubMed] [Google Scholar]
  42. Raja MRC, Velappan AB, Chellappan D, Debnath J, Mahapatra SK. 2017. Eugenol derived immunomodulatory molecules against visceral leishmaniasis. European Journal of Medicinal Chemistry, 139, 503–518. [CrossRef] [PubMed] [Google Scholar]
  43. Ramesh V, Dixit KK, Sharma N, Singh R, Salotra P. 2020. Assessing the efficacy and safety of liposomal amphotericin B and miltefosine in combination for treatment of post kala-azar dermal leishmaniasis. Journal of Infectious Diseases, 22, 608–617. [CrossRef] [Google Scholar]
  44. Rebello KM, Andrade-Neto VV, Gomes CRB, de Souza MVN, Branquinha MH, Santos ALS, Torres-Santos EC, d’Avila-Levy CM. 2019. Miltefosine-lopinavir combination therapy against Leishmania infantum infection: in vitro and in vivo approaches. Frontiers in Cellular and Infection Microbiology, 9, 229. [CrossRef] [PubMed] [Google Scholar]
  45. Ribeiro TG, Chávez-Fumagall MA, Valadares DG, França JR, Rodrigues LB, Duarte MC, Lage PS, Andrade PH, Lage DP, Arruda LV, Abánades DR, Costa LE, Martins VT, Tavares CA, Castilho RO, Coelho EA, Faraco AA. 2014. Novel targeting using nanoparticles: An approach to the development of an effective anti-leishmanial drug-delivery system. International Journal of Nanomedicine, 9, 877–890. [CrossRef] [PubMed] [Google Scholar]
  46. Silva EJ, Bezerra-Souza A, Passero LF, Laurenti MD, Ferreira GM, Fujii DG, Trossini GH, Raminelli C. 2018. Synthesis, leishmanicidal activity, structural descriptors and structure-activity relationship of quinoline derivatives. Future Medicinal Chemistry, 10, 2069–2085. [CrossRef] [PubMed] [Google Scholar]
  47. Singh PK, Pawar VK, Jaiswal AK, Singh Y, Srikanth CH, Chaurasia M, Bora HK, Raval K, Meher JG, Gayen JR, Dube A, Chourasia MK. 2017. Chitosan coated Pluronic F127 micelles for effective delivery of amphotericin B in experimental visceral leishmaniasis. International Journal of Biological Macromolecules, 105, 1220–1231. [CrossRef] [PubMed] [Google Scholar]
  48. Sousa JKT, Antinarelli LMR, Mendonça DVC, Lage DP, Tavares GSV, Dias DS, Ribeiro PAF, Ludolf F, Coelho VTS, Oliveira-da-Silva JA, Perin L, Oliveira BA, Alvarenga DF, Chávez-Fumagalli MA, Brandão GC, Nobre V, Pereira GR, Coimbra ES, Coelho EAF. 2019. A chloroquinoline derivate presents effective in vitro and in vivo antileishmanial activity against Leishmania species that cause tegumentary and visceral leishmaniasis. Parasitology International, 73, 101966. [CrossRef] [PubMed] [Google Scholar]
  49. Srivastava S, Mishra J, Gupta AK, Singh A, Shankar P, Singh S. 2017. Laboratory confirmed miltefosine resistant cases of visceral leishmaniasis from India. Parasite & Vectors, 10, 49. [CrossRef] [Google Scholar]
  50. Sundar S, Chakravarty J. 2013. Leishmaniasis: An update of current pharmacotherapy. Expert Opinion on Pharmacotherapy, 14, 53–63. [CrossRef] [PubMed] [Google Scholar]
  51. Sundar S, Olliaro PL. 2007. Miltefosine in the treatment of leishmaniasis: Clinical evidence for informed clinical risk management. Therapeutics and Clinical Risk Management, 3, 733–740. [PubMed] [Google Scholar]
  52. Sundar S, Pandey K, Thakur CP, Jha TK, Das VN, Verma N, Lal CS, Verma D, Alam S, Das P. 2014. Efficacy and safety of amphotericin B emulsion versus liposomal formulation in Indian patients with visceral leishmaniasis: a randomized, open-label study. PLoS Neglected Tropical Diseases, 8, e3169. [CrossRef] [PubMed] [Google Scholar]
  53. Sundar S, Singh A. 2016. Recent developments and future prospects in the treatment of visceral leishmaniasis. Therapeutic Advances in Infectious Disease, 3, 98–109. [CrossRef] [PubMed] [Google Scholar]
  54. Sundar S, Singh A. 2018. Chemotherapeutics of visceral leishmaniasis: present and future developments. Parasitology, 145, 481–489. [CrossRef] [PubMed] [Google Scholar]
  55. Tavares GSV, Mendonça DVC, Lage DP, Granato JDT, Ottoni FM, Ludolf F, Chávez-Fumagalli MA, Duarte MC, Tavares CAP, Alves RJ, Coimbra ES, Coelho EAF. 2018. Antileishmanial activity, cytotoxicity and mechanism of action of clioquinol against Leishmania infantum and Leishmania amazonensis species. Basic & Clinical Pharmacology & Toxicology, 123, 236–246. [CrossRef] [PubMed] [Google Scholar]
  56. Tavares GSV, Mendonça DVC, Miyazaki CK, Lage DP, Soyer TG, Carvalho LM, Ottoni FM, Dias DS, Ribeiro PAF, Antinarelli LMR, Ludolf F, Duarte MC, Coimbra ES, Chávez-Fumagalli MA, Roatt BM, Menezes-Souza D, Barichello JM, Alves RJ, Coelho EAF. 2019. A Pluronic® F127-based polymeric micelle system containing an antileishmanial molecule is immunotherapeutic and effective in the treatment against Leishmania amazonensis infection. Parasitology International, 68, 63–72. [CrossRef] [PubMed] [Google Scholar]
  57. Tomiotto-Pellissier F, Bortoleti BTDS, Assolini JP, Gonçalves MD, Carloto ACM, Miranda-Sapla MM, Conchon-Costa I, Bordignon J, Pavanelli WR. 2018. Macrophage polarization in leishmaniasis: broadening horizons. Frontiers in Immunology, 9, 2529. [CrossRef] [PubMed] [Google Scholar]
  58. Vijayakumar S, Das P. 2018. Recent progress in drug targets and inhibitors towards combating leishmaniasis. Acta Tropica, 181, 95–104. [CrossRef] [PubMed] [Google Scholar]
  59. Wang Y, Yu L, Han L, Sha X, Fang X. 2007. Difunctional Pluronic copolymer micelles for paclitaxel delivery: Synergistic effect of folate-mediated targeting and Pluronic-mediated overcoming multidrug resistance in tumor cell lines. International Journal of Pharmaceutics, 337, 63–73. [CrossRef] [PubMed] [Google Scholar]
  60. Alvar J, Vélez ID, Bern C, Herrero M, Desjeux P, Cano J, Jannin J, den Boer M, WHO Leishmaniasis Control Team. 2012. Leishmaniasis worldwide and global estimates of its incidence. PLoS One, 7, e35671. [CrossRef] [PubMed] [Google Scholar]
  61. World Health Organization. 2018. Leishmaniasis, http://www.who.int/topics/leishmaniasis/en/, Accessed data: 2 June 2018. [Google Scholar]
  62. World Health Organisation. 2019. WHO and Gilead extend collaboration against visceral leishmaniasis, cited 2019 03/10/2019. [Google Scholar]
  63. Zhang W, Shi Y, Chen Y, Hao J, Sha X, Fang X. 2011. The potential of Pluronic polymeric micelles encapsulated with paclitaxel for the treatment of melanoma using subcutaneous and pulmonary metastatic mice models. Biomaterials, 32, 5934–5944. [CrossRef] [PubMed] [Google Scholar]
  64. Zijlstra EE. 2016. The immunology of post-kala-azar dermal leishmaniasis (PKDL). Parasite & Vectors, 9, 464. [CrossRef] [Google Scholar]

Cite this article as: Tavares GSV, Mendonça DVC, Pereira IAG, Oliveira-da-Silva JA, Ramos FF, Lage DP, Machado AS, Carvalho LM, Reis TAR, Perin L, Carvalho AMRS, Ottoni FM, Ludolf F, Freitas CS, Bandeira RS, Silva AM, Chávez-Fumagalli MA, Duarte MC, Menezes-Souza D, Alves RJ, Roatt BM & Coelho EAF. 2020. A clioquinol-containing Pluronic® F127 polymeric micelle system is effective in the treatment of visceral leishmaniasis in a murine model. Parasite 27, 29.

All Figures

thumbnail Figure 1

Chemical structure of the clioquinol (ICHQ) compound.
In the text
thumbnail Figure 2

Cellular response developed in the treated and infected animals, one day after treatment. Splenocytes of the treated and infected animals were collected one day after treatment, and cells (5 × 106 per mL) were non-stimulated (medium) or stimulated with Leishmania infantum SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. IFN-γ, IL-4, IL-10, IL-12p70 and GM-CSF levels were measured in the cell supernatant by a capture ELISA (A). Nitrite production was also evaluated in the cell supernatant using the Griess reaction (B). Ratios between the IFN-γ and IL-10 levels were calculated and results are shown (C). Bars represent the mean ± standard deviation of the groups. (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.0001). (+) indicates a statistically significant difference in relation to the miltefosine, ICHQ, and ICHQ/Mic groups (p < 0.0001).
In the text
thumbnail Figure 3

Cellular profile generated in the treated and infected animals, 15 days after treatment. Fifteen days after treatment, cellular response was also evaluated in the treated and infected animals. Spleen cells (5 × 106 per mL) were non-stimulated (medium) or stimulated with Leishmania infantum SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. IFN-γ, IL-4, IL-10, IL-12p70 and GM-CSF levels were measured in the cell supernatant by a capture ELISA (A). Nitrite production was also evaluated in the cell supernatant (B). The ratios between the IFN-γ and IL-10 levels were calculated, and values are also shown (C). Bars represent the mean ± standard deviation of the groups. (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.001). (+) indicates a statistically significant difference in relation to the miltefosine, ICHQ, and ICHQ/Mic groups (p < 0.001).
In the text
thumbnail Figure 4

Intracytoplasmic cytokine-producing CD4+ and CD8+ T-cell frequency in the treated and infected animals. BALB/c mice were infected with Leishmania infantum promastigotes and received saline or were treated with empty micelle (B/Mic), miltefosine, ICHQ, or ICHQ/Mic. The animals were euthanized 15 days after treatment, when their splenocytes were collected and non-stimulated or in vitro stimulated with SLA (50 μg/mL) for 48 h at 37 °C in 5% CO2. Results were expressed as cytokine indexes (stimulated culture/control culture ratio) to obtain the IFN-γ, TNF-α and IL-10-producing CD4+ and CD8+ T cell frequency. Bars indicate the mean ± standard deviation of the groups. (*) and (**) indicate statistically significant differences in relation to the saline and B/Mic groups, respectively (p < 0.05).
In the text
thumbnail Figure 5

Humoral response developed in the treated and infected animals. Serum samples were collected from the treated and infected animals, one (A) and 15 (B) days after treatment, when the anti-parasite IgG1 and IgG2a isotype levels were evaluated. White and grey bars indicate the mean ± standard deviation of the IgG1 and IgG2a levels, respectively. (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.001). (+) indicates a statistically significant difference in relation to the miltefosine, ICHQ, and ICHQ/Mic groups (p < 0.001).
In the text
thumbnail Figure 6

Parasite load evaluated by a limiting dilution assay. To evaluate the in vivo antileishmanial action of ICHQ incorporated or not in a micellar system, BALB/c mice (n = 12 per group) were subcutaneously infected with 107 Leishmania infantum stationary promastigotes. 45 days after infection, they received subcutaneous injections every 2 days for 10 days with: saline, empty micelle (Mic/B), ICHQ, ICHQ/Mic, or miltefosine (oral route). Half of the animals per group were euthanized one and 15 days after treatment, when liver, spleen, bone marrow and draining lymph nodes were collected for evaluation of the parasite load. White and grey bars indicate the mean ± standard deviation of the groups, one and 15 days after treatment, respectively, in liver (A), spleen (B), bone marrow (C), and draining lymph nodes (D). (*) indicates a statistically significant difference in relation to the saline and Mic/B groups (p < 0.001). (#) indicates a statistically significant difference in relation to the miltefosine and ICHQ groups (p < 0.01).
In the text
thumbnail Figure 7

Splenic parasitism evaluated by RT-PCR. Splenic parasitism was also evaluated by RT-PCR, one and 15 days after treatment. Results were converted into number of parasites (in log) per nucleated cell (multiplied by one thousand to facilitate visualization). Bars indicate the mean ± standard deviation of the groups. (*), (#) and (Δ) indicate statistically significant differences in comparison to the saline, Mic/B and miltefosine groups, respectively (p < 0.05).
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.