A. The original version of the primers-probe set of Homo sapiens ribonuclease P (RP forward: AGATTTGGACCTGCGAGCG; RP probe: TTCTGACCTGAAGGCTCTGCGCG; RP reverse: GAGCGGCTGTCTCCACAAGT) designed by Fan et al. [11] is shown in red letters and the modified version (RP-human forward: TCAGCATGGCGGTGTTT; RP-human probe: TTCTGACCTGAAGGCTCTGCGC; RP-human reverse: CGGCTGTCTCCACAAGTC) is in yellow highlight. Both sets were designed from the reference sequence (GenBank accession number): NM_006413.4. B. Results of Blastn of the fragment of 65 bp of the original primers-probe set. C. Results of Blastn of the fragment of 81 bp of the modified version.

Representative of optimization for the multiplex qPCR assay using primers-probe concentration for each target at (i) 250 nM primers/100 nM probe, (ii) 125 nM primers/50 nM probe, and (iii) 62.5 nM primers/25 nM probe and 102 fg/reaction for (A) L. martiniquensis, (B) L. orientalis, and (C) Crithidia sp. (CLA-KP1) as templates. The qPCR reactions were conducted according to the recommended thermal cycling protocol: 1 cycle of polymerase activation at 95 °C for 5 min, followed by 45 cycles of PCR at 95 °C for 15 s, and 60 °C for 1 min.

PCR products of the ITS1 fragment of 149 bp using ITS1-L. mar primers, the ITS1 fragment of 146 bp using ITS1-L. ori/cha primers, and the ITS1 conserved fragment of 77 bp using ITS1-Tryps primers. Lanes: MW = Molecular weight markers; 1 = Negative control; 2 = human DNA; 3 = L. martiniquensis; 4 = L. orientalis; 5 = L. chancei; 6 = L. infantum; 7 = L. braziliensis; 8 = Crithidia sp. (CLA-KP1); 9 = L. martiniquensis + human DNA; 10 = L. orientalis + human DNA.

Receiver operating characteristic (ROC) analysis for cut-off estimation for (A) L. martiniquensis, (B) L. orientalis, and (C) Crithidia sp. (CLA-KP1).

Limit of detection (LOD95) of the multiplex qPCR for (A) L. martiniquensis, (B) L. orientalis, and (C) Crithidia sp. (CLA-KP1) was estimated by fitting a logistic regression model with detection results. Each dot indicates an actual detection rate at each dilution. The dashed line in the figure indicates the dilution ratio corresponding to a 95% probability.