File S1.
Download original image
A. The original version of the primers-probe set of Homo sapiens ribonuclease P (RP forward: AGATTTGGACCTGCGAGCG; RP probe: TTCTGACCTGAAGGCTCTGCGCG; RP reverse: GAGCGGCTGTCTCCACAAGT) designed by Fan et al. [11] is shown in red letters and the modified version (RP-human forward: TCAGCATGGCGGTGTTT; RP-human probe: TTCTGACCTGAAGGCTCTGCGC; RP-human reverse: CGGCTGTCTCCACAAGTC) is in yellow highlight. Both sets were designed from the reference sequence (GenBank accession number): NM_006413.4. B. Results of Blastn of the fragment of 65 bp of the original primers-probe set. C. Results of Blastn of the fragment of 81 bp of the modified version.
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
