A. The original version of the primers-probe set of Homo sapiens ribonuclease P (RP forward: AGATTTGGACCTGCGAGCG; RP probe: TTCTGACCTGAAGGCTCTGCGCG; RP reverse: GAGCGGCTGTCTCCACAAGT) designed by Fan et al. [11] is shown in red letters and the modified version (RP-human forward: TCAGCATGGCGGTGTTT; RP-human probe: TTCTGACCTGAAGGCTCTGCGC; RP-human reverse: CGGCTGTCTCCACAAGTC) is in yellow highlight. Both sets were designed from the reference sequence (GenBank accession number): NM_006413.4. B. Results of Blastn of the fragment of 65 bp of the original primers-probe set. C. Results of Blastn of the fragment of 81 bp of the modified version.