EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 31 (2024) Parasite, 31 (2024) 63 Full HTML
Open Access
Issue
Parasite
Volume 31, 2024
Article Number 63
Number of page(s) 12
DOI https://doi.org/10.1051/parasite/2024064
Published online 08 October 2024

© Y-Y. Xie et al., published by EDP Sciences, 2024

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

The phylum Acanthocephala, commonly known as spiny- or thorny-headed worms, is an important group of zooparasites of veterinary, medical, and economic importance [45, 48, 49, 61]. It includes over 1,300 species assigned into 4 classes (Archiacanthocephala, Eoacanthocephala, Polyacanthocephala, and Palaeacanthocephala) and 10 orders [3, 25, 64]. Among them, Echinorhynchida Southwell & Macfie, 1925 is the largest order in Acanthocephala with 470 species occurring in teleost fishes, amphibians, and reptiles globally, which is divided into 15 families [2, 3, 6, 13, 25, 50, 55]. However, the evolutionary relationships of these 15 families remain unclear, due to the paucity and inaccessibility of genetic data.

The family Heteracanthocephalidae Petrochenko, 1956 is a rare group of acanthocephalans mainly parasitic in fishes [4, 31, 49, 51, 54]. It was erected by Petrochenko [49] and currently includes only three genera, namely Aspersentis Van Cleave, 1929 (type genus), Bullockrhynchus Chandra, Hanumantha-Rao & Shyamasundari, 1985 and Sachalinorhynchus Krotov & Petrochenko in Petrochenko, 1956 [3]. However, the systematic status of the Heteracanthocephalidae and the genus Aspersentis has been under debate for a long time [3, 4, 51]. Van Cleave [59] established the genus Aspersentis and assigned it to the family Rhadinorhynchidae Lühe, 1912. Later, Petrochenko [49] transferred Aspersentis into the family Arhythmacanthidae Yamaguti, 1935. Golvan [21] erected the family Aspersentidae Golvan, 1960 for the genus Aspersentis, which was subsequently reduced to a subfamily Aspersentinae Golvan, 1960 in the Heteracanthocephalidae [1, 3, 22].

Some previous studies proved that the nuclear and mitochondrial sequence data, including mitochondrial genomes, play important roles in the integrated taxonomy, population genetics, and phylogenetics of acanthocephalans [7, 9, 10, 18, 19, 33–35, 39–44, 56, 63]. However, GenBank contains limited sequence data from only two representatives of the Heteracanthocephalidae, A. megarhynchus (18S) and Aspersentis sp. (18S, 28S, and cox1). There are no data on the mitochondrial genome of heteracanthocephalid species reported so far.

In the present study, in order to enrich the genetic data and reveal the characterization of the complete mitochondrial genome of the Heteracanthocephalidae, the nuclear ribosomal DNA [including small ribosomal subunit (18S), large ribosomal subunit (28S), and internal transcribed spacer (ITS) sequences] of A. megarhynchus was sequenced, and the mitogenome of A. megarhynchus was annotated for the first time. Moreover, to evaluate the validity of the Heteracanthocephalidae and clarify the phylogenetic relationships among the families within the order Echinorhynchida, phylogenetic analyses based on concatenated amino acid sequences of 12 protein-coding genes (PCGs) of mitochondrial genomes were performed using maximum likelihood (ML) and Bayesian inference (BI), respectively.

Material and methods

Ethics and permits

The fish sampling was carried out in accordance with the National permit (series AP No. 046-14 from 11-2-2014) issued under the provisions of the Protocol on Environmental Protection to the Antarctic Treaty.

Parasite collection and species identification

Acanthocephalans were isolated from the intestine of Antarctic black rockcod Notothenia coriiceps Richardson (Perciformes: Nototheniidae) off Galindez Island, Argentine Islands, West Antarctica (65°15′S, 64°16′W) during the 19th Ukrainian Antarctic expedition to the Ukrainian Antarctic Station (UAS) “Akademik Vernadsky” in April 2014–February 2015. Specimens were collected from fish intestines and stored in 70% ethanol for further study. The specimens were identified as A. megarhynchus based on morphological characters (Fig. 1), according to the previous studies [4, 30]. Voucher specimens of A. megarhynchus were deposited at the I. I. Schmalhausen Institute of Zoology, National Academy of Sciences of Ukraine, Kyiv, Ukraine (NC-49-2014-Acanth; NC-63-2014-Acanth; NC-72-2014-Acanth) and the College of Life Sciences, Hebei Normal University, Hebei Province, China (HBNU-A-F20240720CL).

thumbnail Figure 1

Photomicrographs of Aspersentis megarhynchus collected from Notothenia coriiceps. A: mature male; B: proboscis; C: eggs; D: mature female.

Molecular procedures

For molecular analysis, the total genomic DNA of A. megarhynchus was extracted using a Magnetic Universal Genomic DNA Kit (DP705) [Sangon Biotech (Shanghai) Co., Ltd., Shanghai, China], following the manufacturer’s instructions. The partial 18S region was amplified by polymerase chain reaction (PCR) using the forward primer (5′–AGATTAAGCCATGCATGCGTAA–3′) and the reverse primer (5′–TGATCCTTCTGCAGGTTCACCTAC–3′) [15]. The partial 28S region was amplified by PCR using four overlapping PCR fragments of 700–800 bp. Primers for 28S amplicon 1 were forward 5′–CAAGTACCGTGAGGGAAAGTTGC–3′ and reverse 5′–CAGCTATCCTGAGGGAAAC–3′; amplicon 2, forward 5′–ACCCGAAAGATGGTGAACTATG–3′ and reverse 5′–CTTCTCCAAC(T/G)TCAGTCTTCAA–3′; amplicon 3, forward 5′–CTAAGGAGTGTGTAACAACTCACC–3′ and reverse 5′–AATGACGAGGCATTTGGCTACCTT–3′; amplicon 4, forward 5′–GATCCGTAACTTCGGGAAAAGGAT–3′ and reverse 5′–CTTCGCAATGATAGGAAGAGCC–3′ [12]. The partial ITS region was amplified by PCR using the forward primer (5′–GTCGTAACAAGGTTTCCGTA–3′) and the reverse primer (5′–TATGCTTAAATTCAGCGGGT–3′) [29]. The cycling conditions were as described previously [35]. PCR products were checked on GoldView-stained 1.5% agarose gels and purified with a Column PCR Product Purification Kit (Sangon, Shanghai, China). Sequencing for each amplification product was carried out from both directions. Sequences were aligned using ClustalW2 and adjusted manually. The DNA sequences obtained herein were compared (using the algorithm BLASTn) with that available in the National Center for Biotechnology Information (NCBI) database (https://www.ncbi.nlm.nih.gov).

Mitochondrial genome sequencing, assembly, and annotation

Total genomic DNA was sent to Novogene (Tianjin, China), where the library was prepared according to an internal protocol, before being sequenced on an Illumina NovaSeq 6000 platform. A total of 50 GB of clean 150 bp paired-end reads were obtained. GetOrganelle v1.7.2a [26] was used to assemble the mitochondrial genome. The mitochondrial genome was roughly annotated for the protein-coding genes (PCGs), transfer RNA (tRNA), and ribosomal RNA (rRNA) using the MitoS web server (http://mitos.bioinf.uni-leipzig.de/index.py) and MitoZ v2.4 [36]. The open reading frame (ORF) of each PCG was manually confirmed based on the invertebrate mitochondrial genetic code using the ORF finder (https://www.ncbi.nlm.nih.gov/orffinder/). Some tRNA genes unidentified by MitoS or MitoZ were discovered through BLAST, based on a database of the existing tRNA sequences of Acanthocephala. The secondary structures of tRNAs were predicted by the ViennaRNA module [23], building on MitoS2 [5] and RNA structure v6.3 [52], and manually corrected. The CGView online server V1.0 (http://stothard.afns.ualberta.ca/cgview_server/) was employed to visualize and depict gene element features. Base composition, amino acid usage, and relative synonymous codon usage (RSCU) were calculated by using a Python script (Supplementary file 1) referencing the codon adaptation index (CAI) [8]. Strand asymmetry was calculated using the formulae: AT skew = (A − T)/(A + T); GC skew = (G − C)/(G + C). The complete mitochondrial genome of A. megarhynchus obtained in this study has been deposited in the GenBank database (https://www.ncbi.nlm.nih.gov) under the accession number PP965112.

Phylogenetic analyses

Phylogenetic analyses were conducted based on concatenated amino acid (AA) sequences of the 12 PCGs using maximum likelihood (ML) and Bayesian inference (BI). Rotaria rotatoria and Philodina citrina (Rotifera: Bdelloidea) were chosen as the out-group. The in-group included the newly sequenced A. megarhynchus and the other 39 species of acanthocephalans with mitogenomic data. Detailed information on the representatives of Acanthocephala included in the present phylogeny is provided in Table 1. The extracted amino acid sequences were aligned separately using MAFFT v7.313 under the iterative refinement method of E-INS-I [28]. The aligned AAs sequences were concatenated into a single alignment matrix by PhyloSuite v1.2.2 [62]. Substitution models were compared and selected according to the Bayesian Information Criterion (BIC) by using ModelFinder [27]. VT + F + I + G4 was identified as the best-fit substitution model. The Bayesian Information Criterion analysis was generated using MrBayes v3.2, with running for sampling tree topologies every 1,000 generations. The Markov Chain Monte Carlo process used randomly starting trees and involved four chains each in two parallel runs for 500,000 generations, with the first 25% of trees discarded as burn-in. The standard deviation of the split frequency value is lower than 0.01.

Table 1

Detailed information on representatives of Acanthocephala included in the present phylogeny.

The maximum likelihood (ML) inference was executed in IQTREE v2.1.2. Substitution models were compared and selected according to the Akaike Information Criterion (AIC) using ModelFinder. mtInv+F+R6 was identified as the best-fit substitution model. Nodal support for the ML tree was assessed using 1,000 bootstrap pseudoreplicates with ultrafast bootstrap approximation [24], while the other parameters were kept at their default values [20, 38]. The phylogenetic trees were visualized in iTOL v6.1.1 [32].

Results

Molecular characterization of nuclear ribosomal DNA of Aspersentis megarhynchus

Partial 18S region

Two 18S sequences of A. megarhynchus obtained herein had a length of 1,665 bp and were identical. GenBank contains 18S sequence data for two representatives of Aspersentis/Heteracanthocephalidae, namely A. megarhynchus (MW916820, MW916821) and Aspersentis sp. (OQ942219). Pairwise comparison of the 18S sequences of A. megarhynchus obtained herein with that of Aspersentis spp. showed no nucleotide variation (A. megarhynchus, MW916821) to 0.83% (Aspersentis sp., OQ942219) nucleotide divergence. The 18S sequences of A. megarhynchus obtained herein were deposited in GenBank (https://www.ncbi.nlm.nih.gov) (under accession numbers PP956812, PP956813).

Partial 28S region

Two 28S sequences of A. megarhynchus obtained herein are both 2,698 bp in length, with no nucleotide divergence detected. GenBank contains 28S sequence data for only one representative of Aspersentis/Heteracanthocephalidae: Aspersentis sp. (OQ947383). A pairwise comparison of the 28S sequences of A. megarhynchus obtained herein with that of Aspersentis sp. showed 7.38% nucleotide divergence. The 28S sequences of A. megarhynchus obtained herein were deposited in GenBank (https://www.ncbi.nlm.nih.gov) (under accession numbers PP958581, PP958582).

Partial ITS region

Two ITS sequences of A. megarhynchus obtained herein are both 533 bp in length, with no nucleotide divergence detected. In Aspersentis/Heteracanthocephalidae, there is no species with ITS sequences available in GenBank. The ITS sequences of A. megarhynchus obtained herein were deposited in GenBank (https://www.ncbi.nlm.nih.gov) (under accession numbers PP971137, PP971138).

General characterization of the complete mitogenome of Aspersentis megarhynchus

The complete mitogenome of A. megarhynchus is 14,661 bp in length and includes 36 genes, containing 12 PCGs (cox1-3, nad1-6, nad4L, cytb and atp6; missing atp8), 22 tRNA genes and 2 ribosomal RNAs (rrnS and rrnL), plus two non-coding regions (NCR1 is 967 bp, located between trnW and trnK; NCR2 is 366 bp, located between trnT and trnM) (Fig. 2, Table 2). All mitochondrial genes are encoded on the same strand and in the same direction. The overall A + T content in the mitogenome of A. megarhynchus is 64.6%, displaying a strong A + T bias. The nucleotide content of the mitogenome of A. megarhynchus is provided in Table 3.

thumbnail Figure 2

Gene map of the mitochondrial genome of Aspersentis megarhynchus. All 22 tRNA genes are nominated by the one-letter code with numbers differentiating each of the two tRNAs, serine and leucine. All genes are transcribed in the clockwise direction on the same strand. The outermost circle shows the GC content and the innermost circle shows the GC skew.

Table 2

Organization of the mitochondrial genome of Aspersentis megarhynchus. “Ini/Ter cod” and “Int seq” indicates initial/terminal codons and the length of intergenic sequences, respectively.

Table 3

Base composition and skewness of Aspersentis megarhynchus.

The 12 PCGs of the present mitogenome is 10,489 bp in length (excluding termination codons) and encoded 3,495 amino acids. The size of 12 PCGs varied from 276 bp (nad4L) to 1,662 bp (nad5) (Fig. 2, Table 2). Among the 12 PCGs of A. megarhynchus, 7 genes (cox1, cox2, nad2, nad3, nad4L, nad5, and cytb) used GTG as the start codon, while 3 genes (nad1, nad6, and cox3) used ATG. Meanwhile, ATA and ATT were used by the atp6 and nad4 genes, respectively. There are 4 genes (cox1, cox3, cytb, and atp6) that used TAA as a termination codon, and 4 genes (nad4L, nad5, cox2, and nad2) that used TAG as a termination codon. The 4 remaining genes (nad1, nad3, nad4, and nad6) were inferred to terminate with incomplete stop codon T (Table 2). In the 12 PCGs of the mitogenome of A. megarhynchus, TTA for leucine (8.30%) is the most frequently used codon, followed by TTT for phenylalanine (6.35%) and ATA for methionine (4.92%), ATA for isoleucine (4.92%), while CGG for arginine is the least used codons (0.09%) (Table 4). Leucine (16. 5%) is the most frequently used amino acid in the PCGs of A. megarhynchus, followed by valine (12.1%) and serine (11.0%) (Table 4). Detailed information on overall codon usage and RSCU for the construction of 12 PCGs is shown in Figure 3.

thumbnail Figure 3

Relative synonymous codon usage (RSCU) of Aspersentis megarhynchus. The codon families (in alphabetical order) are labelled on the x-axis. Values on the top of each bar represent amino acid usage in percentage.

Table 4

Genetic code and codon usage for 12 PCGs in the mitochondrial genome of Aspersentis megarhynchus.

Two ribosomal RNAs, rrnL and rrnS, are 912 bp and 575 bp in size, with 69.0% and 70.3% A + T content, respectively. The rrnL is located between trnY and trnL1, and rrnS is located between trnM and trnF. In the complete mitogenome of A. megarhynchus, 22 tRNAs are identified with lengths ranging from 50 bp (trnR) to 67 bp (trnQ). Among them, three tRNAs (trnN, trnW, and trnV) were predicted to be folded into a typical cloverleaf secondary structure. The four tRNAs (trnR, trnC, trnQ, and trnS1) lack a (DHU) arm. The remaining tRNAs lack a TψC (T) arm. The lengths of 22 tRNAs and their anticodon secondary structures are provided in Table 2 and Supplementary file 2.

In the mitogenome of A. megarhynchus, the gene arrangement of PCGs and rRNAs is in the typical order of acanthocephalans: cox1, rrnL, nad6, atp6, nad3, nad4L, nad4, nad5, cytb, nad1, rrnS, cox2, cox3, and nad2. However, the rearrangement of several tRNAs (trnV + trnE + trnT located between trnI and trnM) occurred in the mitogenome of A. megarhynchus (Figs. 2 and 4).

thumbnail Figure 4

Comparison of the linearized mitochondrial genome arrangement for acanthocephalans species. All genes are transcribed in the same direction from left to right. The tRNAs are labelled by a single-letter code for the corresponding amino acid. Aspersentis megarhynchus is indicated using an asterisk (*).

Phylogenetic analyses

Phylogenetic results based on concatenated amino acid sequences of 12 protein-coding genes using the ML and BI methods have almost identical topologies, which supported the division of the phylum Acanthocephala into three large monophyletic clades (clades I, II, and III) (Fig. 5). Clade I consists of Macracanthorhynchus hirudinaceus (Pallas, 1781), Oncicola luehei (Travassos, 1917), Moniliformis tupaia Chen, Yu, Ma, Zhao, Cao & Li, 2024, and Moniliformis sp., representing the class Archiacanthocephala. Clade II includes the representatives of Gyracanthocephala and Neoechinorhynchida, representing the class Eoacanthocephala (Polyacanthorhynchus caballeroi Diaz-Ungria et Rodrigo, 1960 belonging to the class Polyacanthocephala nested into representatives of Eoacanthocephala). Clade III contains species of Echinorhynchida and Polymorphida, representing the class Palaeacanthocephala. Aspersentis megarhynchus belonging to the family Heteracanthocephalidae displayed a sister relationship with Echinorhynchus truttae Schrank, 1788 belonging to the family Echinorhynchidae in the order Echinorhynchida.

thumbnail Figure 5

Phylogenetic analyses of Acanthocephala inferred from the ML and BI methods based on concatenating amino acid sequences of 12 protein-coding genes (PCGs) of mitochondrial genome. Rotaria rotatoria and Philodina citrina are the out-group. Aspersentis megarhynchus is indicated using an asterisk (*).

Discussion

In the order Echinorhynchida, only 14 acanthocephalan species belonging to seven different families have been sequenced for the mitogenomes [11, 41, 57, 58, 60, 63], and over 45% of families in Echinorhynchida still have all representatives with unknown mitogenomic data. In the present study, the complete mitochondrial genome of A. megarhynchus was provided for the first time, which represented the first mitogenomic data for the genus Aspersentis and also for the family Heteracanthocephalidae.

In Echinorhynchida, the size of the mitogenome of A. megarhynchus (14,661 bp) is similar to that of two pomphorhynchid species Pomphorhynchus zhoushanensis Li, Chen, Amin & Yang, 2017 and Longicollum sp. (both 14,632 bp), but the overall A + T content in the mitogenome of A. megarhynchus (64.6%) is higher than that of P. zhoushanensis and Longicollum sp. (both 55.8%), and is similar to that of the echinorhynchid species Echinorhynchus truttae (63.1%) [60]. Previous studies proved that the organization and arrangements of the 12 PCGs and 2 rRNAs in the phylum Acanthocephala are conserved, whereas the position of tRNAs tends to be highly variable among different families or genera [9, 10, 16, 18, 63]. Comparative mitochondrial genomic analysis revealed that several tRNA gene (trnV, trnE and trnT) rearrangement events occurred in the mitogenomes of A. megarhynchus. The tRNA gene arrangement in the mitogenome of A. megarhynchus is different from all of the known mitogenomes of acanthocephalans.

Amin et al. [4] sequenced the 18S data of A. megarhynchus and constructed the phylogenetic tree of Echinorhynchida based on the 18S sequences using the ML and BI methods, whose results supported the validity of the Heteracanthocephalidae, but did not solve the phylogenetic relationships between the Heteracanthocephalidae and some other families in Echinorhynchida (i.e., Echinorhynchidae, Pomphorhynchidae, Paracanthocephalidae, Rhadinorhynchidae, and Arhythmacanthidae). The present mitogenomic phylogeny also indicated that Heteracanthocephalidae represented a separate family, which was consistent with the phylogenetic results based only on 18S data. Moreover, the present study represented the first attempt to investigate the systematic position of the Heteracanthocephalidae in the order Echinorhynchida using phylogenetic analyses based on mitogenomic data. The phylogenetic results based on concatenating the amino acid sequences of 12 PCGs strongly suggested a close affinity between the families Heteracanthocephalidae and Echinorhynchidae in the order Echinorhynchida, which rejected the previous proposals by Van Cleave [59] and Petrochenko [49]. The present study enriched the resource of genetic data and contributed to revealing the patterns of mitogenomic evolution of the Heteracanthocephalidae, and represented a substantial step towards clarifying the phylogenetic relationships of different families in Echinorhynchida.

Funding

This study was supported by the National Natural Science Foundation of China (Grant No. 31872197) and the National Key R&D Program of China (Grant No. 2022YFC2601200). The participation of Olga Lisitsyna and Tetiana Kuzmina in this study was partially supported by Next Generation EU through the Recovery and Resilience Plan for Slovakia (No. 09103-03-V0l-00016) and by the National Antarctic Scientific Center, Ministry of Education and Science of Ukraine (project number H/01-2024).

Conflicts of interest

The authors declare that they have no competing interests.

Author contribution statement

Y.-Y. X. and L.L. contributed to the study design, annotated mitogenome, and conducted the phylogenetic analyses. H.-X.C. sequenced and analyzed nuclear ribosomal DNA data. T.A.K. and O.L. collected and identified acanthocephalan specimens. Y.-Y.X. and L.L. wrote the manuscript. All authors read and approved the final manuscript.

Supplementary information

Supplementary file 1: Python script used for calculating relative synonymous codon usage (RSCU). Access here

thumbnail Supplementary file 2:

The predicted secondary structures of 22 tRNAs in the mitogenome of Aspersentis megarhynchus (Watson-Crick bonds indicated by lines, GU bonds indicated by dots, red bases representing anticodons). The tRNAs are labelled with the abbreviations of their corresponding amino acids according to the IUPAC-IUB code.

References

  1. Amin OM. 1985. Classification, in Biology of the Acanthocephala. Crompton DWT, Editor Cambridge University Press: Cambridge. p. 27–72. [Google Scholar]
  2. Amin OM. 1987. Key to the families and subfamilies of Acanthocephala, with the erection of a new class (Polyacanthocephala) and a new order (Polyacanthorhynchida). Journal of Parasitology, 73, 1216–1219. [CrossRef] [Google Scholar]
  3. Amin OM. 2013. Classification of the Acanthocephala. Folia Parasitologica, 60, 273–305. [CrossRef] [PubMed] [Google Scholar]
  4. Amin OM, Heckmann RA, Dallarés S, Constenla M, Yu Rubtsova N, Kuzmina T. 2021. New perspectives on Aspersentis megarhynchus (Acanthocephala: Heteracanthocephalidae) from Notothenia coriiceps Richardson (Nototheniidae) in the West Antarctic, with emended generic diagnosis. Journal of Helminthology, 95, e27. [CrossRef] [PubMed] [Google Scholar]
  5. Bernt M, Merkle D, Ramsch K, Fritzsch G, Perseke M, Bernhard D, Schlegel M, Stadler PF, Middendorf M. 2007. CREx: inferring genomic rearrangements based on common intervals. Bioinformatics (Oxford, England), 23, 2957–2958. [PubMed] [Google Scholar]
  6. Braicovich PE, Lanfranchi AL, Farber MD, Marvaldi AE, Luque JL, Timi JT. 2014. Genetic and morphological evidence reveals the existence of a new family, genus and species of Echinorhynchida (Acanthocephala). Folia Parasitologica, 61, 377–384. [CrossRef] [PubMed] [Google Scholar]
  7. Chen H-X, Yu Z-J, Ma J, Zhao C-H, Cao F-Q, Li L. 2024. Morphology, genetic characterization and phylogeny of Moniliformis tupaia n. sp. (Acanthocephala: Moniliformidae) from the northern tree shrew Tupaia belangeri chinensis Anderson (Mammalia: Scandentia). Parasitology, 151, 440–448. [CrossRef] [PubMed] [Google Scholar]
  8. Cock PJ, Antao T, Chang JT, Chapman BA, Cox CJ, Dalke A, Friedberg I, Hamelryck T, Kauff F, Wilczynski B, de Hoon MJ. 2009. Biopython: freely available Python tools for computational molecular biology and bioinformatics. Bioinformatics (Oxford, England), 25, 1422–1423. [PubMed] [Google Scholar]
  9. Dai GD, Yan HB, Li L, Zhang LS, Liu ZL, Gao SZ, Ohiolei JA, Wu YD, Guo AM, Fu BQ, Jia WZ. 2022. Molecular characterization of a new Moniliformis sp. from a Plateau Zokor (Eospalax fontanierii baileyi) in China. Frontiers in Microbiology, 13, 806–882. [Google Scholar]
  10. Gao JW, Yuan XP, Wu H, Xiang CY, Xie M, Song R, Chen ZY, Wu YA, Ou DS. 2022. Mitochondrial phylogenomics of Acanthocephala: nucleotide alignments produce long-branch attraction artefacts. Parasites & Vectors, 15, 376. [CrossRef] [PubMed] [Google Scholar]
  11. Gao JW, Yuan XP, Jakovlic I, Wu H, Xiang CY, Xie M, Song R, Xie ZG, Wu YA, Ou DS. 2023. The mitochondrial genome of Heterosentis pseudobagri (Wang & Zhang, 1987) Pichelin & Cribb, 1999 reveals novel aspects of tRNA genes evolution in Acanthocephala. BMC Genomics, 24, 95. [CrossRef] [PubMed] [Google Scholar]
  12. García-Varela M, Nadler SA. 2006. Phylogenetic relationships among Syndermata inferred from nuclear and mitochondrial gene sequences. Molecular Phylogenetics and Evolution, 40, 61–72. [CrossRef] [PubMed] [Google Scholar]
  13. García-Varela M, Andrade-Gómez L. 2021. First steps to understand the systematics of Echinorhynchidae Cobbold, 1876 (Acanthocephala), inferred through nuclear gene sequences. Parasitology International, 81, 102–264. [Google Scholar]
  14. García-Gallego A, Raga JA, Fraija-Fernández N, Aznar FJ. 2023. Temporal and geographical changes in the intestinal helminth fauna of striped dolphins, Stenella coeruleoalba, in the western Mediterranean: a long-term analysis (1982–2016). Frontiers in Marine Science, 10, 1–17. [Google Scholar]
  15. Garey JR, Near TJ, Nonnemacher MR, Nadler SA. 1996. Molecular evidence for Acanthocephala as a subtaxon of Rotifera. Journal of Molecular Evolution, 43, 287–292. [CrossRef] [PubMed] [Google Scholar]
  16. Gazi M, Sultana T, Min GS, Park YC, García-Varela M, Nadler SA, Park JK. 2012. The complete mitochondrial genome sequence of Oncicola luehei (Acanthocephala: Archiacanthocephala) and its phylogenetic position within Syndermata. Parasitology International, 61, 307–316. [CrossRef] [PubMed] [Google Scholar]
  17. Gazi M, Kim J, Park JK. 2015. The complete mitochondrial genome sequence of Southwellina hispida supports monophyly of Palaeacanthocephala (Acanthocephala: Polymorphida). Parasitology International, 64, 64–68. [CrossRef] [PubMed] [Google Scholar]
  18. Gazi M, Kim J, García-Varela M, Park C, Littlewood DTJ, Park J-K. 2016. Mitogenomic phylogeny of Acanthocephala reveals novel Class relationships. Zoologica Scripta, 45, 437–454. [CrossRef] [Google Scholar]
  19. Gissi C, Iannelli F, Pesole G. 2008. Evolution of the mitochondrial genome of Metazoa as exemplified by comparison of congeneric species. Heredity, 101, 301–320. [CrossRef] [PubMed] [Google Scholar]
  20. Golombek A, Tobergte S, Struck TH. 2015. Elucidating the phylogenetic position of Gnathostomulida and first mitochondrial genomes of Gnathostomulida, Gastrotricha and Polycladida (Platyhelminthes). Molecular Phylogenetics and Evolution, 86, 49–63. [CrossRef] [PubMed] [Google Scholar]
  21. Golvan YJ. 1960. Le Phylum des Acanthocephala. Troisième note. La Classe des Palaeacanthocephala (Meyer, 1931) (à suivre). Annales de Parasitologie Humaine et Comparée, 35, 138–165. [CrossRef] [EDP Sciences] [Google Scholar]
  22. Golvan YJ. 1969. Systématique des acanthocéphales (Acanthocephala Rudolphi 1801) Première Partie. L’Ordre des Palæacanthocephala Meyer 1931. Premier fascicule. La Superfamille des Echinorhynchoidea (Cobbold 1876) Golvan et Houin 1963. Mémoires du Muséum National d’Histoire Naturelle, Série A, Zoologie, 57, 1–373. [Google Scholar]
  23. Gruber AR, Bernhart SH, Lorenz R. 2015. The ViennaRNA web services. Methods in Molecular Biology, 1269, 307–326. [CrossRef] [PubMed] [Google Scholar]
  24. Hoang DT, Chernomor O, Von Haeseler A, Vinh LS. 2018. UFBoot2: improving the ultrafast bootstrap approximation. Molecular Biology and Evolution, 35, 518–522. [CrossRef] [PubMed] [Google Scholar]
  25. Huston DC, Smales LR. 2020. Proposal of Spinulacorpus biforme (Smales, 2014) n. g., n. comb. and the Spinulacorpidae n. fam. to resolve paraphyly of the acanthocephalan family Rhadinorhynchidae Lühe, 1912. Systematic Parasitology, 97, 477–490. [CrossRef] [PubMed] [Google Scholar]
  26. Jin JJ, Yu WB, Yang JB, Song Y, dePamphilis CW, Yi TS, Li DZ. 2020. GetOrganelle: a fast and versatile toolkit for accurate de novo assembly of organelle genomes. Genome Biology, 21, 241. [CrossRef] [PubMed] [Google Scholar]
  27. Kalyaanamoorthy S, Minh BQ, Wong TKF, Von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods, 14, 587–589. [CrossRef] [PubMed] [Google Scholar]
  28. Katoh K, Standley DM. 2013. MAFFT multiple sequence alignment software version 7: improvements in performance and usability. Molecular Biology and Evolution, 30, 772–780. [CrossRef] [Google Scholar]
  29. Králová-Hromadová I, Scholz T, Shinn AP, Cunningham CO, Wootten R, Hanzelová V, Sommerville C. 2003. A molecular study of Eubothrium rugosum (Batsch, 1786) (Cestoda: Pseudophyllidea) using ITS rDNA sequences, with notes on the distribution and intraspecific sequence variation of Eubothrium crassum (Bloch, 1779). Parasitology International, 89, 473–479. [CrossRef] [PubMed] [Google Scholar]
  30. Kuzmina TA, Salganskij OO, Lisitsyna OI, Korol EM. 2020. Helminths of Antarctic Rockcod Notothenia coriiceps (Perciformes, Nototheniidae) from the Akademik Vernadsky Station Area (Argentine Islands, West Antarctica): new data on the parasite community. Zoodiversity, 54, 99–110. [CrossRef] [Google Scholar]
  31. Laskowski Z, Zdzitowiecki K. 2004. New morphological data on a sub-Antarctic acanthocephalan, Aspersentis johni (Baylis, 1929) (Palaeacanthocephala: Heteracanthocephalidae). Systematic Parasitology, 59, 39–44. [CrossRef] [PubMed] [Google Scholar]
  32. Letunic I, Bork P. 2021. Interactive Tree Of Life (iTOL) v5: an online tool for phylogenetic tree display and annotation. Nucleic Acids Research, 49, 293–296. [Google Scholar]
  33. Li D-X, Yang R-J, Chen H-X, Kuzmina TA, Spraker TR, Li L. 2024. Characterization of the complete mitochondrial genomes of the zoonotic parasites Bolbosoma nipponicum and Corynosoma villosum (Acanthocephala: Polymorphida) and the molecular phylogeny of the order Polymorphida. Parasitology, 151, 45–57. [CrossRef] [PubMed] [Google Scholar]
  34. Li L, Chen H-X, Amin OM, Yang Y. 2017. Morphological variability and molecular characterization of Pomphorhynchus zhoushanensis sp. nov. (Acanthocephala: Pomphorhynchidae), with comments on the systematic status of Pomphorhynchus monticelli, 1905. Parasitology International, 66, 693–698. [CrossRef] [PubMed] [Google Scholar]
  35. Li L, Wayland MT, Chen H-X, Yang Y. 2019. Remarkable morphological variation in the proboscis of Neorhadinorhynchus nudus (Harada, 1938) (Acanthocephala: Echinorhynchida). Parasitology, 146, 348–355. [CrossRef] [PubMed] [Google Scholar]
  36. Meng G, Li Y, Yang C, Liu S. 2019. MitoZ: a toolkit for animal mitochondrial genome assembly, annotation and visualization. Nucleic Acids Research, 47, e63. [CrossRef] [PubMed] [Google Scholar]
  37. Min GS, Park JK. 2009. Eurotatorian paraphyly: revisiting phylogenetic relationships based on the complete mitochondrial genome sequence of Rotaria rotatoria (Bdelloidea: Rotifera: Syndermata). BMC Genomics, 10, 533. [CrossRef] [PubMed] [Google Scholar]
  38. Minh BQ, Schmidt HA, Chernomor O, Schrempf D, Woodhams MD, Haeseler A, Lanfear R. 2020. IQ-TREE 2: new models and efficient methods for phylogenetic inference in the genomic era. Molecular Biology and Evolution, 37, 1530–1534. [CrossRef] [PubMed] [Google Scholar]
  39. Muhammad N, Suleman Ma J, Khan MS, Li L, Zhao Q, Ahmad MS, Zhu XQ. 2019. Characterization of the complete mitochondrial genome of Sphaerirostris picae (Rudolphi, 1819) (Acanthocephala: Centrorhynchidae), representative of the genus Sphaerirostris. Parasitology Research, 118, 2213–2221. [CrossRef] [PubMed] [Google Scholar]
  40. Muhammad N, Ma J, Khan MS, Wu SS, Zhu XQ, Li L. 2019. Characterization of the complete mitochondrial genome of Centrorhynchus milvus (Acanthocephala: Polymorphida) and its phylogenetic implications. Infection, Genetics and Evolution, 75, 103–946. [Google Scholar]
  41. Muhammad N, Li L, Suleman Zhao Q, Bannai MA, Mohammad ET, Khan MS, Zhu XQ, Ma J. 2020. Characterization of the complete mitochondrial genome of Cavisoma magnum (Acanthocephala: Palaeacanthocephala), first representative of the family Cavisomidae, and its phylogenetic implications. Infection, Genetics and Evolution, 80, 104–173. [Google Scholar]
  42. Muhammad N, Suleman Ahmad MS, Li L, Zhao Q, Ullah H, Zhu XQ, Ma J. 2020. Mitochondrial DNA dataset suggest that the genus Sphaerirostris Golvan, 1956 is a synonym of the genus Centrorhynchus Lühe, 1911. Parasitology, 147, 1149–1157. [CrossRef] [PubMed] [Google Scholar]
  43. Muhammad N, Suleman Khan MS, Li L, Zhao Q, Ullah H, Zhu XQ, Ma J. 2020. Characterization of the complete mitogenome of Centrorhynchus clitorideus (Meyer, 1931) (Palaeacanthocephala: Centrorhynchidae), the largest mitochondrial genome in Acanthocephala, and its phylogenetic implications. Molecular and Biochemical Parasitology, 237, 111–274. [Google Scholar]
  44. Muhammad N, Li DX, Ru SS, Suleman Saood D, Alvi MA, Li L. 2023. Characterization of the complete mitochondrial genome of Acanthogyrus (Acanthosentis) bilaspurensis Chowhan, Gupta & Khera, 1987 (Eoacanthocephala: Quadrigyridae), the smallest mitochondrial genome in Acanthocephala, and its phylogenetic implications. Journal of Helminthology, 97, e87. [CrossRef] [PubMed] [Google Scholar]
  45. Nickol BB. 1985. Epizootiology, in Biology of the Acanthocephala. Crompton DWT, Nickol BB, Editors. Cambridge University Press: Cambridge. p. 307–346. [Google Scholar]
  46. Pan TS, Jiang H. 2018. The complete mitochondrial genome of Hebesoma violentum (Acanthocephala). Mitochondrial DNA Part B, 3, 582–583. [CrossRef] [Google Scholar]
  47. Pan TS, Nie P. 2013. The complete mitochondrial genome of Pallisentis celatus (Acanthocephala) with phylogenetic analysis of acanthocephalans and rotifers. Folia Parasitologica, 60, 181–191. [CrossRef] [PubMed] [Google Scholar]
  48. Perrot-Minnot MJ, Cozzarolo CS, Amin O, Barčák D, Bauer A, Filipović Marijić V, García-Varela M, Servando Hernández-Orts J, Yen Le TT, Nachev M, Orosová M, Rigaud T, Šariri S, Wattier R, Reyda F, Sures B. 2023. Hooking the scientific community on thorny-headed worms: interesting and exciting facts, knowledge gaps and perspectives for research directions on Acanthocephala. Parasite, 30, 23. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  49. Petrochenko VI. 1956. Acanthocephala of domestic and wild animals. Moscow: Izdatelstvo Akademii Nauk SSSR. p. 435 (Vol. Vol. 1) [Google Scholar]
  50. Pichelin S, Cribb TH. 2001. The status of the Diplosentidae (Acanthocephala: Paleacanthocephala) and a new family of acanthocephalans from Australian wrasses (Pisces: Labridae). Folia Parasitologica, 48, 208–303. [Google Scholar]
  51. Pichelin S, Smales L, Bray RA. 2002. A discussion on the Heteracanthocephalidae Petrochenko, 1956 (Acanthocephala: Palaeacanthocephala). Systematic Parasitology, 52, 145–152. [CrossRef] [PubMed] [Google Scholar]
  52. Reuter JS, Mathews DH. 2010. RNAstructure: software for RNA secondary structure prediction and analysis. BMC Bioinformatics, 11, 129. [CrossRef] [PubMed] [Google Scholar]
  53. Sarwar H, Zhao WT, Kibet CJ, Sitko J, Nie P. 2021. Morphological and complete mitogenomic characterisation of the acanthocephalan Polymorphus minutus infecting the duck Anas platyrhynchos. Folia Parasitologica, 68, e015. [CrossRef] [Google Scholar]
  54. Smales LR. 1996. A redescription of Aspersentis zanclorhynchi (Johnston and Best, 1937) comb. nov. (Heteracanthocephalidae: Acanthocephala). Transactions of the Royal Society of South Australia, 120, 167–171. [Google Scholar]
  55. Smales LR. 2012. A new acanthocephalan family, the Isthmosacanthidae (Acanthocephala: Echinorhynchida), with the description of Isthmosacanthus fitzroyensis n. g., n. sp. from threadfin fishes (Polynemidae) of northern Australia. Systematic Parasitology, 82, 105–111. [CrossRef] [PubMed] [Google Scholar]
  56. Song R, Zhang D, Deng S, Ding D, Liao F, Liu L. 2016. The complete mitochondrial genome of Acanthosentis cheni (Acanthocephala: Quadrigyridae). Mitochondrial DNA Part B, 1, 797–798. [CrossRef] [Google Scholar]
  57. Song R, Zhang D, Gao JW, Cheng XF, Xie M, Li H, Wu YA. 2019. Characterization of the complete mitochondrial genome of Brentisentis yangtzensis Yu and Wu, 1989 (Acanthocephala, Illiosentidae). ZooKeys, 861, 1–14. [CrossRef] [PubMed] [Google Scholar]
  58. Steinauer ML, Nickol BB, Broughton R, Ortí G. 2005. First sequenced mitochondrial genome from the phylum Acanthocephala (Leptorhynchoides thecatus) and its phylogenetic position within Metazoa. Journal of Molecular Evolution, 60, 706–715. [CrossRef] [PubMed] [Google Scholar]
  59. Van Cleave HJ. 1929. A new genus and new species of Acanthocephala from the Antarctic. Annals and Magazine of Natural History, 4, 229–331. [CrossRef] [Google Scholar]
  60. Weber M, Wey-Fabrizius AR, Podsiadlowski L, Witek A, Schill RO, Sugar L, Herlyn H, Hankeln T. 2013. Phylogenetic analyses of endoparasitic Acanthocephala based on mitochondrial genomes suggest secondary loss of sensory organs. Molecular Phylogenetics and Evolution, 66, 182–189. [CrossRef] [PubMed] [Google Scholar]
  61. Yamaguti S. 1963. Systema Helminthum. Volume V: Acanthocephala. New York, NY: Interscience Publisher Inc.. p. 422 p. [Google Scholar]
  62. Zhang D, Gao F, Jakovlić I, Zou H, Zhang J, Li WX, Wang GT. 2020. PhyloSuite: an integrated and scalable desktop platform for streamlined molecular sequence data management and evolutionary phylogenetics studies. Molecular Ecology Resources, 20, 348–355. [CrossRef] [PubMed] [Google Scholar]
  63. Zhao TY, Yang RJ, Lu L, Ru SS, Wayland MT, Chen HX, Li YH, Li L. 2023. Phylomitogenomic analyses provided further evidence for the resurrection of the family Pseudoacanthocephalidae (Acanthocephala: Echinorhynchida). Animals, 13, 1256. [CrossRef] [PubMed] [Google Scholar]
  64. Zhang ZQ. 2011. Animal biodiversity: An outline of higher-level classification and survey of taxonomic richness. Zootaxa, 3148, 6395. [Google Scholar]

Cite this article as: Xie Y-Y, Chen H-X, Kuzmina TA, Lisitsyna O & Li L. 2024. Novel gene arrangement in the mitochondrial genome of Aspersentis megarhynchus (Acanthocephala, Echinorhynchida, Heteracanthocephalidae), and its phylogenetic implications. Parasite 31, 63.

All Tables

Table 1

Detailed information on representatives of Acanthocephala included in the present phylogeny.

In the text
Table 2

Organization of the mitochondrial genome of Aspersentis megarhynchus. “Ini/Ter cod” and “Int seq” indicates initial/terminal codons and the length of intergenic sequences, respectively.

In the text
Table 3

Base composition and skewness of Aspersentis megarhynchus.

In the text
Table 4

Genetic code and codon usage for 12 PCGs in the mitochondrial genome of Aspersentis megarhynchus.

In the text

All Figures

thumbnail Figure 1

Photomicrographs of Aspersentis megarhynchus collected from Notothenia coriiceps. A: mature male; B: proboscis; C: eggs; D: mature female.
In the text
thumbnail Figure 2

Gene map of the mitochondrial genome of Aspersentis megarhynchus. All 22 tRNA genes are nominated by the one-letter code with numbers differentiating each of the two tRNAs, serine and leucine. All genes are transcribed in the clockwise direction on the same strand. The outermost circle shows the GC content and the innermost circle shows the GC skew.
In the text
thumbnail Figure 3

Relative synonymous codon usage (RSCU) of Aspersentis megarhynchus. The codon families (in alphabetical order) are labelled on the x-axis. Values on the top of each bar represent amino acid usage in percentage.
In the text
thumbnail Figure 4

Comparison of the linearized mitochondrial genome arrangement for acanthocephalans species. All genes are transcribed in the same direction from left to right. The tRNAs are labelled by a single-letter code for the corresponding amino acid. Aspersentis megarhynchus is indicated using an asterisk (*).
In the text
thumbnail Figure 5

Phylogenetic analyses of Acanthocephala inferred from the ML and BI methods based on concatenating amino acid sequences of 12 protein-coding genes (PCGs) of mitochondrial genome. Rotaria rotatoria and Philodina citrina are the out-group. Aspersentis megarhynchus is indicated using an asterisk (*).
In the text
thumbnail Supplementary file 2:

The predicted secondary structures of 22 tRNAs in the mitogenome of Aspersentis megarhynchus (Watson-Crick bonds indicated by lines, GU bonds indicated by dots, red bases representing anticodons). The tRNAs are labelled with the abbreviations of their corresponding amino acids according to the IUPAC-IUB code.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.