EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 32 (2025) Parasite, 32 (2025) 26 Full HTML
Open Access
Issue
Parasite
Volume 32, 2025
Article Number 26
Number of page(s) 12
DOI https://doi.org/10.1051/parasite/2025018
Published online 16 April 2025

© W. Yu et al., published by EDP Sciences, 2025

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Trichinellosis is a globally prevalent foodborne zoonotic disease caused by the ingestion of raw or inadequately cooked meat containing infectious Trichinella spiralis larvae [18]. Infection with T. spiralis poses a significant challenge to host immunity, as the parasite can complete its entire life cycle within a single host [35]. To achieve this, T. spiralis modifies environmental conditions that support the survival of both the host and the parasite [12, 42]. The parasite develops in humans by employing various mechanisms to evade the host immune response. However, the precise mechanisms underlying immune evasion remain unclear and require further investigation.

Based on different developmental stages, T. spiralis antigens are categorized into worm antigens, surface antigens (SA antigens), and excretory-secretory (ES) antigens. ES antigens activate the nucleotide-binding oligomerization domain-containing protein 1 (NOD1) receptor pathway in mouse peritoneal macrophages, regulating nuclear factor kappa-B (NF-κB) expression and other key downstream factors. Additionally, ES antigens can induce immune tolerance in macrophages for a limited duration [44]. During T. spiralis infection, ES antigens directly enter tissue fluid, lymph, and blood, participating in the host immune response and serving as key target antigens that elicit specific immune responses [33]. These antigens influence the host immune response through antigen-presenting cells (APCs), inducing APCs to activate T helper 2 (Th2) cells and anti-inflammatory responses, while promoting regulatory T-cell activation both in vitro and in vivo [17].

Trichinella spiralis and its immunoregulatory molecules interact with various immune cells, modulating cytokine expression and regulating the host immune system. The immunoregulatory process involves antigen processing and presentation, lymphocyte activation and proliferation, and cytokine release [3]. Infection with T. spiralis enhances the expression of interleukin-4 (IL-4) and interleukin-10 (IL-10), while reducing interferon gamma (IFN-γ) and interleukin-17 (IL-17) levels. The upregulation of Th2 cytokines, particularly IL-4, suppresses the T helper 1 (Th1) cell-mediated immune response against foreign antigens, which may have beneficial effects in autoimmune conditions. Furthermore, T. spiralis induces the Th2 phenotype and promotes cytokine production, including IL-4, IL-5, and IL-13, which are essential for the establishment and maintenance of the Th2 response [1].

The immune system maintains equilibrium between immunity and tolerance to defend the host against infections, while minimizing local tissue damage [24]. Dendritic cells (DCs), like APCs, play a critical role in immune resistance. These cells activate primary T-cells and coordinate immune responses, contributing significantly to immune regulation [20, 30] and T-cell tolerance induction [25]. Indoleamine 2,3-dioxygenase (IDO), an enzyme produced by DCs, facilitates the establishment and maintenance of immunological tolerance [26]. Although several hypotheses have been proposed regarding the mechanism through which IDO mediates immune tolerance, a precise understanding remains elusive. IDO is an immunoregulatory enzyme that catalyzes a rate-limiting step in tryptophan metabolism via the kynurenine pathway, inhibiting T-cell proliferation and enabling antigens to evade immune surveillance [41]. The enzymatic activity of IDO is essential for immune modulation, exerting biological effects through tryptophan metabolism [27]. Numerous studies have validated the role of IDO in immune regulation and tolerance induction [11]. Investigations in both human and mouse models have examined IDO’s involvement in autoimmune diseases, transplant allograft rejection, and tumor progression [23, 34, 36, 41].

Trichinella spiralis has developed mechanisms to establish persistent infections in host skeletal muscles, while evading immune detection [14]. This parasite achieves immune modulation through multiple processes that fine-tune host immune responses. The ES antigen of T. spiralis elicits a robust immune response and aids in the protection of infectious larvae. DCs, like APCs, initiate T-cell activation and subsequently regulate immune function. IDO, as an immunomodulatory enzyme, catalyzes the rate-limiting step in tryptophan metabolism and is inhibited by 1-methyl tryptophan (1-MT). Through IDO expression, DCs can induce regulatory T-cells, promoting immune tolerance to autoantigens [13].

The precise mechanism by which T. spiralis establishes chronic infection in the host, while evading immune recognition and attack, remains unclear. Further research is required to determine whether and how IDO influences the ability of DCs to induce immunological tolerance to T. spiralis. In this study, mouse DCs were cultured in vitro and exposed to purified T. spiralis ES antigen for varying durations. Flow cytometry was employed to assess the surface expression of CD40, MHC-II, CD80, and CD86 on DCs. Additionally, qRT-PCR was used to analyze the mRNA expression levels of IDO, the proinflammatory cytokines IFN-γ and TNF-α, and the anti-inflammatory cytokine IL-10 at different time points. Western blotting (WB) analysis was performed to evaluate IDO protein expression over time. To confirm the impact of ES antigens on IDO expression in DCs, qRT-PCR was used to measure relative cytokine levels in DCs in which IDO expression was knocked down using small interfering RNA (siRNA620). The results indicated that ES antigens upregulated IDO at both the mRNA and protein levels. Collectively, these findings suggest that IDO expression in DCs may play a significant role in T. spiralis infection. This study examined the effect of ES antigens on IDO expression and provided a theoretical basis for further investigation into the molecular mechanisms by which ES antigens influence T. spiralis invasion.

Materials and methods

Ethics

The feeding and experimental procedures involving mice were conducted in compliance with the Chinese Animal Management Ordinance. The standards for animal experiments were approved by the Animal Management Committee of Northeast Agricultural University and were carried out in accordance with established animal ethics guidelines and approved protocols (Animal Ethics Committee approval number SYXK [Hei] 2016–007).

Animals and parasites

Trichinella spiralis (isolate code: ISS3; original host: domestic pig from Poland) was used as the experimental parasite. A total of 80 Kunming mice (6–8 weeks old, both male and female, randomly selected) were obtained from the Experimental Animal Center of Harbin Medical University, China. The use and care of animals followed the guidelines outlined in the Chinese Animal Management Ordinance.

Preparation of the excretory secretion antigen

Each mouse was orally infected with 500 larvae. Muscle larvae from infected mice were isolated using pepsin hydrochloride digestion and maintained at 37 °C in 5% CO2 in RPMI 1640 medium (HyClone, Logan, UT, USA) supplemented with 1% penicillin/streptomycin (PS) for 24–36 h. ES products were subsequently collected from the cultured muscle larvae, concentrated using polyethylene glycol (PEG2000, 400 g/L), and subjected to dialysis. The ES products were then filtered through a 0.22-μm membrane and stored at −80 °C until use. Protein concentration was determined using the bicinchoninic acid (BCA) assay. A standard curve was generated based on the absorbance of the BCA standard at 562 nm, and the protein content of the sample was calculated assuming a linear relationship. ES antigen composition was analyzed using sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE).

Cultivation of dendritic cells

DC2.4 cells were obtained from BeNa Culture Collection Biotechnology Co., Ltd., Langfang, China. Cells were incubated at 37 °C in 5% CO2 for 1.5 h. After nonadherent cells were removed, the remaining cells were washed twice with RPMI 1640 medium (HyClone) supplemented with 10% fetal bovine serum (FBS; Sigma-Aldrich, St. Louis, MO, USA). Fresh cultivation medium (RPMI 1640 + 10% FBS + 1% penicillin/streptomycin) was added, and the cells were maintained at 37 °C in 5% CO2 for 24 h.

In vitro dendritic cells stimulation

DC2.4 cells were prepared according to previously established methods. Briefly, cells (1 × 106 cells/well) were seeded in 12-well plates and incubated for 24 h. Adherent cells were then divided into four groups and stimulated with different treatments: (1) ES products from T. spiralis L1 larvae (final concentration: 15 μg/mL), (2) IFN-γ (final concentration: 1,000 U/mL, positive control), (3) RPMI 1640 (negative control), and (4) blank control. After incubation at 37 °C in 5% CO2, the culture medium was removed. The cells were subsequently washed with PBS and stored at −80 °C for RNA extraction.

Effects of different concentrations of the excretory secretion antigen on the proliferation of dendritic cells

Healthy DCs were seeded in 96-well plates at a density of 1 × 106 cells/well. The culture medium volume was adjusted to 100 μL, and ES antigen at final concentrations of 0, 5, 10, 15, 25, 30, or 40 μg/mL was added to stimulate cells for 24 h. An equal volume of RPMI 1640 was used as a negative control. Following incubation, the supernatant was discarded, and 10 μL of CCK-8 reagent along with 90 μL of culture solution was added to each well in darkness. The cells were incubated at 37 °C for 4 h. Optical density (OD) at 450 nm was measured to assess cell proliferation.

Time effect of the excretory secretion antigen on indoleamine 2, 3-dioxygenase expression in dendritic cells

The optimal ES antigen concentration was used to investigate the time-dependent effect on IDO expression. Healthy DCs were seeded in six-well plates at a density of 1 × 106 cells/well, with the total volume adjusted to 2 mL. The cells were stimulated with ES antigen for 0, 4, 8, 12, 16, 20, 24, and 32 h. Total RNA was extracted at each time point and reverse-transcribed into cDNA. The expression levels of β-actin and IDO mRNA were analyzed using qRT-PCR.

Concentration effect of excretory secretion antigen on the expression of indoleamine 2, 3-dioxygenase in dendritic cells

Healthy DCs were seeded in six-well plates at a density of 1 × 106 cells/well, with the culture medium adjusted to a total volume of 2 mL. ES antigen was added at final concentrations of 0, 5, 10, 15, 20, 30, and 40 μg/mL and incubated for 24 h. An equal volume of RPMI 1640 was used as a negative control, while IFN-γ (1,000 U/mL) served as a positive control. Following incubation, total RNA was extracted, and cDNA was synthesized through reverse transcription. The expression levels of β-actin and IDO mRNA were subsequently quantified using qRT-PCR.

Quantitative real-time polymerase chain reaction

Total RNA was extracted from DCs stimulated for different durations (0, 2, 6, 12, 24, 36, 48, and 72 h) using a Trizol RNA extraction kit (Invitrogen, Vienna, Austria), following the manufacturer’s instructions. cDNA synthesis was performed using a reverse transcription system (Promega, Madison, WI, USA). The primers for PCR were designed using the Primer-BLAST tool from the NCBI website. The primers used were as follows: IDO (accession number, NM_008324), AGCAATCCCCACTGTATCCA, GGTCCACAAAGTCACGCATC, 131 bp; IL-10 (NM_010548), TGGACAACATACTGCTAACCGA, ACCCAGGGAATTCAAATGC, 158 bp; IFN-γ (NM_008337.4), AGTGGCATAGATGTGGAA, CTGTTGCTGAAGAAGGTAG, 200 bp; TNF-α (NM_013693.3), ACGCTCTTCTGTCTACTGA, ACGCTCTTCTGTCTACTGA, 240 bp; β-actin (NM_007393.5), GTTGGAGCAAACATCCCCCA, ACGCGACCATCCTCCTCTTA, 187 bp. Real-time quantitative PCR for IDO, IL-10, IFN-γ, TNF-α, and β-actin was performed in triplicate using the ABI 7500 Real-Time PCR System (Applied Biosystems, Carlsbad, CA, USA) and ChamQTM Universal SYBR qPCR Master Mix (Vazyme Biotech Co., Ltd., Nanjing, China). The qPCR conditions were as follows: initial denaturation at 95 °C for 70 s, followed by 40 cycles of PCR (95 °C for 30 s, 95 °C for 10 s, and 60 °C for 30 s). The melting curve analysis included cycles at 95 °C for 15 s, 60 °C for 1 min, and 95 °C for 15 s. Target gene expression was normalized to β-actin as an internal control. Relative expression levels were determined using the 2–∆∆Ct method.

Western blotting assay

DCs were stimulated with different antigens for specified durations, washed, and collected for total protein extraction using a protein isolation kit (KeyGEN BioTECH Co., Ltd., Nanjing, China). The extracted proteins were separated via 12% SDS-PAGE and subsequently transferred onto nitrocellulose membranes. To block nonspecific binding, membranes were incubated with 5% (w/v) defatted milk powder dissolved in TBST buffer (0.02% Tween 20, 150 mmol/L NaCl, and 20 mmol/L Tris-HCl, pH 7.6). After five washes with TBST (5 min each), membranes were incubated with a primary mouse IDO monoclonal antibody (1:7,000 dilution) and a mouse GAPDH monoclonal antibody (1:7,000 dilution, reference control) (Peprotech, Rocky Hill, NJ, USA) at 37 °C for 2 h. Following another set of five TBST washes (5 min each), membranes were incubated with horseradish peroxidase (HRP)-labeled goat anti-mouse IgG secondary antibodies at 37 °C for 45 min under continuous agitation. After an additional set of TBST washes, enhanced chemiluminescence (ECL) detection (HaiGene Co., Ltd., Harbin, China) was performed, according to the manufacturer’s instructions. IDO protein expression was quantified using ImageJ software, with GAPDH serving as an internal control for normalization.

Flow cytometry

Healthy DCs were seeded in six-well plates and cultured in standard RPMI 1640 medium. Cells were either left untreated, stimulated with ES antigen, or treated with lipopolysaccharide (LPS, positive control) for 24 h, with each condition performed in triplicate. Following incubation, cells were washed with PBS, collected, resuspended, and incubated in the dark with fluorescently labeled antibodies for 40 min. After incubation, cells were washed with PBS, centrifuged at 1,000 rpm for 5 min at room temperature, and resuspended for flow cytometric analysis. Flow cytometry was used to assess the expression levels of MHC-II, CD40, CD80, and CD86.

siRNA interference

Based on the GenBank murine IDO sequence (accession number: NM_008324), three siRNA sequences (siRNA 339, siRNA 620, and siRNA 890) and a control siRNA (Ctrl siRNA) were designed and synthesized by Suzhou Jima Gene Co. Lipofectamine 2000 and siRNA were separately diluted at a 1:40 ratio in serum-free medium and incubated for 5 min. The two solutions were then mixed and allowed to incubate for 20 min to form transfection complexes. DCs were cultured in medium alone (control) or transfected with Ctrl siRNA, siRNA 339, siRNA 620, or siRNA 890 using the prepared transfection reagent. After 6 h of coincubation, cells were stimulated with the ES antigen for 24 h. Subsequently, cells were harvested for qRT-PCR and Western blotting (WB) assays to assess IDO expression levels.

The primers used for these genes were as follows: siRNA620: GCAAUAUUGCUGUUCCCUATT, UAGGGAACAGCAAUAUUGCTT; siRNA890: GCACUGCACGACAUAGCUATT, UAGCUAUGUCGUGCAGUGCTT; siRNA339: GCAGAAUUCCUCCAGGAAATT, UUUCCUGGAGGAAUUCUGCTT; control siRNA: UUCUCCGAACGUGUCACGUTT, ACGUGACACGUUCGGAGAATT; GAPDH: CACUCAAGAUUGUCAGCAATT, UUGCUGACAAUCUUGAGUGAG. The DCs received ES stimulation after transfection and then the relative mRNA expression of IFN-γ, TNF-α, and IL-10 was determined by qRT-PCR analysis.

Statistical analysis

All data are expressed as the mean ± SD and analyzed statistically using GraphPad Prism 5. Band intensities were quantified with ImageJ software. Group differences were evaluated using one-way analysis of variance (ANOVA). A p-value of < 0.05 was considered statistically significant.

Results

Effect of the excretory secretion antigen on the proliferation of dendritic cells

As illustrated in Figure 1, exposure of DCs to the ES antigen for 24 h at a low concentration (0–25 μg/mL) did not influence cell proliferation, with no significant variations observed among different concentrations. However, when the ES antigen concentration exceeded 30 μg/mL, a reduction in cell proliferation activity was noted (p < 0.001), indicating cytotoxic effects at higher concentrations. Thus, ES antigen concentrations below 25 μg/mL exhibited no toxic effects on DCs and did not interfere with the experiment.

thumbnail Figure 1

Effect of ES antigen on DC activity. DCs were treated with 0, 5, 10, 15, 25, 30, or 40 μg/mL ES antigen for 24 h. CCK-8 assay was performed to assess cell proliferation activity, and optical density (OD) was measured at 450 nm. ***p < 0.001.

Effects of different concentrations of the excretory secretion antigen on the expression of indoleamine 2, 3-dioxygenase in dendritic cells

As shown in Figure 2, variations in IDO mRNA expression in DCs were observed in response to different ES antigen concentrations. qRT-PCR assay results indicated that IDO expression was negligible in the absence of ES antigen stimulation. When the ES antigen concentration ranged from 0 to 15 μg/mL, IDO mRNA expression in DCs increased with rising antigen concentrations. However, at concentrations exceeding 20 μg/mL, IDO mRNA expression declined sharply, possibly due to the cytotoxic effects of the ES antigen on cells. Based on these findings, 15 μg/mL was determined to be the optimal concentration for stimulation.

thumbnail Figure 2

Relative IDO mRNA expression in DCs stimulated with different doses of ES antigen. DCs were treated with 0, 5, 10, 15, 20, 30, or 40 μg/mL ES antigen for 24 h. IFN-γ was used as a positive control. Real-time RT-PCR was conducted to quantify the relative expression of IDO mRNA in DCs. **p < 0.01, ***p < 0.001.

Time effect of the excretory secretion antigen on indoleamine 2, 3-dioxygenase expression in dendritic cells

As illustrated in Figures 1 and 2, a 15 μg/mL concentration of ES antigen exhibited no cytotoxic effects on cells and maximized IDO expression in DCs, establishing it as the optimal stimulation concentration. As shown in Figure 3, the relative expression of IDO mRNA in DCs increased within 0–24 h following ES antigen stimulation, followed by a decline after 24 h. At 24 h, IDO mRNA expression was significantly different from that in other groups (p < 0.001). The experimental data demonstrated that the same ES antigen concentration that induced the highest IDO secretion by DCs exerted its strongest effects at 24 h. Therefore, under optimal ES antigen concentration, 24 h was identified as the optimal stimulation duration.

thumbnail Figure 3

Time-dependent effect of ES antigen on IDO mRNA expression in DCs. DCs were treated with ES antigen at the optimal concentration for 0, 4, 8, 12, 16, 20, 24, or 32 h. Real-time RT-PCR was performed to determine the relative expression of IDO mRNA in DCs. **p < 0.01, ***p < 0.001.

Indoleamine 2, 3-dioxygenase mRNA expression in excretory secretion-stimulated dendritic cells

To further investigate the mechanisms through which IDO promotes immunologic tolerance in T. spiralis and to assess whether the ES antigen upregulates IDO in DCs, the expression levels of IDO, TNF-α, IFN-γ, and IL-10 mRNAs were quantified using qRT-PCR. Cells were cultured for 0, 2, 6, 12, 24, 36, 48, or 72 h under different stimuli. The results indicated a positive correlation among the expression levels of IDO, TNF-α, IFN-γ, and IL-10 mRNAs within 24 h of stimulation, followed by a decline in IDO expression from 36 h to 72 h. Stimulation with IFN-γ or the ES antigen led to significantly higher mRNA expression of IDO (Fig. 4A), IFN-γ (Fig. 4B), IL-10 (Fig. 4C), and TNF-α (Fig. 4D) compared to the blank control. Additionally, IDO was constitutively expressed in the presence of the ES antigen, following a pattern similar to that of IFN-γ. No significant difference was observed between the ES group and the IFN-γ group. In contrast, IDO, TNF-α, IFN-γ, and IL-10 were minimally expressed in the RPMI 1640 group, with no significant difference from the blank control group.

thumbnail Figure 4

Effects of T. spiralis ES products on the expression of IDO and cytokine mRNAs in DC2.4 cells. DCs were treated with 15 μg/mL ES products from T. spiralis for 0, 2, 6, 12, 24, 36, 48, or 72 h. IFN-γ was used as a positive control in these experiments. (A–D) Real-time RT-PCR was performed to identify the relative expression of IDO, IFN-γ, IL-10, and TNF-α mRNAs in DCs. *p < 0.05, **p < 0.01, and ***p < 0.001.

Upregulation of indoleamine 2, 3-dioxygenase protein expression in dendritic cells

WB analysis was conducted to determine whether IDO protein production in DCs aligned with the observed transcriptional upregulation. The results confirmed IDO expression in DCs, with sustained elevation observed from 6 h to 36 h following treatment with IFN-γ and the ES antigen (Fig. 5A). Compared to the blank control group, the grayscale ratio of IDO to GAPDH in DCs stimulated by ES or IFN-γ was higher at 36 h (Fig. 5B). An increase in IDO protein levels was detected after treatment with IFN-γ or ES alone (Fig. 5B).

thumbnail Figure 5

Detection of IDO expression by Western blotting after different DC treatments. (A) Representative bands of the IDO protein in each group were analyzed by WB. (B) The gray value of the IDO protein in different treatment groups was analyzed. *p < 0.05, **p < 0.01, and ***p < 0.001.

Expression of surface marker molecules in excretory secretion-stimulated dendritic cells

The maturation of DCs in each group was assessed by analyzing the expression of surface marker molecules (CD40, CD80, CD86, and MHC-II) using flow cytometry. These markers exhibited low expression in both the blank control group and the 1640 group. In contrast, significant overexpression of surface marker molecules was observed in the LPS group compared to the control group (Figs. 6A–6E). A similar increase in expression levels was detected in the ES antigen group relative to the control group; however, the expression was notably lower than that in the LPS group (Figs. 6A–6E).

thumbnail Figure 6

Expression of DC surface marker molecules induced by ES antigen, detected by flow cytometry. DCs were cultured in standard RPMI 1640 medium or stimulated with ES antigen or LPS (positive control) for 24 h. (A–D) Expression levels of CD40, MHC-II, CD80, and CD86 were analyzed by flow cytometry. (E) Ratios of CD40, MHC-II, CD80, and CD86 in different groups. *p < 0.05, **p < 0.01, ***p < 0.001.

siRNA interference

To investigate the role of IDO in immunomodulation, IDO was knocked down in DCs using siRNA. A specific siRNA target for IDO was designed and transfected into DCs for 6 h, followed by stimulation with the ES antigen for 24 h. qRT-PCR analysis revealed that among the three siRNAs tested, siRNA620 achieved a 60% silencing efficiency (Fig. 7A). The protein level in siRNA620-silenced cells was also lower than that in control cells (Fig. 7B). Furthermore, the proinflammatory cytokines IFN-γ (Fig. 8A) and TNF-α (Fig. 8B) exhibited significant increases in mRNA expression, whereas IL-10 mRNA levels showed a contrasting decrease compared to those in the ES antigen group (Fig. 8C).

thumbnail Figure 7

Effects of IDO knockdown on DCs. DCs were cultured in medium alone (control) or transfected with control siRNA (Ctrl siRNA), siRNA 339, siRNA 620, or siRNA 890 for 6 h, followed by stimulation with ES antigen for 24 h. (A) Relative IDO mRNA expression (normalized to GAPDH) was quantified by real-time qRT-PCR. ***p < 0.001. (B) IDO protein levels were analyzed by Western blotting.

thumbnail Figure 8

Relative expression of cytokines after siRNA-mediated IDO knockdown. (A) and (B) Relative mRNA expression levels of IFN-γ and TNF-α were quantified by qRT-PCR. The mRNA levels of IFN-γ and TNF-α were significantly higher in the siRNA620 group than in the control and control siRNA groups (***p < 0.001). (C) qRT-PCR analysis of IL-10 mRNA expression. The IL-10 mRNA level was significantly lower in the siRNA620 group than in the control and control siRNA groups (***p < 0.001).

Discussion

IDO is a key immunomodulatory enzyme present in various cell types, including DCs and macrophages, and plays a role in regulating immune responses. It facilitates tryptophan degradation while suppressing inflammation and immune activation. Tryptophan depletion contributes to immune resistance by enhancing regulatory T-cell activity and inhibiting effector T-cell function [31]. IDO-mediated tryptophan catabolism has been implicated in autoimmune diseases [6], primary tumors and cancer [21, 46], organ transplantation [9], and placental tolerance [16].

Additionally, IDO is expressed in different cell types, such as DCs and macrophages, and influences various physiological and pathological processes, including anticancer and antimicrobial activities, parasite-induced immune tolerance, and immunoregulation [29]. The helminth T. spiralis establishes persistent infections in host skeletal muscles. Depending on the host species, the parasite can survive throughout the host’s lifetime in rodents or persist for months to years in higher mammals and humans, causing chronic parasitic disease [14, 40]. Throughout its life cycle, T. spiralis-derived ES products modulate immunity, benefiting both the host and the parasite. These ES products function as antigens that either stimulate prolonged specific immune responses or act as immunomodulators to alter immune reactions to unrelated antigens [14].

Upon T. spiralis invasion, the parasite and its ES antigen influence the expression of DC surface markers and cytokine secretion, triggering immune responses that impact host immunity. The ES antigen stimulates immune cells, including macrophages and DCs, and modulates adaptive immunity, altering immune cell function [33]. DCs secrete both inflammatory and anti-inflammatory cytokines, which influence resistance to pathogenic invasion, leading to a shift from a Th1-dominant response to a Th2 or mixed Th1/Th2 immune response [22]. Bai et al. [4] reported that stimulation of DCs with the ES antigen of T. spiralis led to a significant increase in CD80 and CD86 expression, activating the inflammatory signaling pathway and inducing inflammatory cytokine production. The promotion of inflammatory factor secretion may serve as a key mechanism through which T. spiralis evades host immune responses.

When tryptophan is depleted in the T-cell microenvironment, T-cell proliferation is inhibited [28]. Metabolites generated from tryptophan degradation contribute to T-cell apoptosis [37], further impairing immune function. The ES antigen of T. spiralis has been shown to stimulate DCs to produce IDO, which indirectly influences T-cell function. In this study, the expression of IDO in DCs following stimulation with the ES antigen of T. spiralis and its role in DC maturation in vitro were examined. The transcriptional and protein expression levels of IDO in DCs stimulated with the ES antigen were assessed. qRT-PCR results demonstrated an increase in the expression of the anti-inflammatory cytokine IL-10 following stimulation with the ES antigen. The anti-inflammatory effects of IL-10 were primarily observed in the inhibition of activation and cytotoxicity of APCs, including macrophages. The level of expression of the IDO mRNA increased, and the level of expression of the anti-inflammatory factor IL-10 also increased. The IL-10 induced by the antigen presented by DCs is closely associated with the ability of the parasite to evade host immunity. Therefore, the stimulatory effect of the ES antigen plays a crucial role in the evasion of host immunity in vitro, self-survival, and growth of T. spiralis [15]. IL-10 can also mobilize the expression of IDO in APCs [2, 19].

In this study, elevated IL-10 mRNA expression was observed to enhance the expression of IDO mRNA. An increase in IDO levels in DCs may contribute to the early immune evasion of parasites by reducing T-cell priming and effector T-cell migration due to localized L-tryptophan depletion. The findings indicated that the ES antigen of T. spiralis induces IDO expression in DCs, while the sustained high expression of IL-10 maintains IDO activity. This mutual regulation between IDO and IL-10 may support the long-term survival of T. spiralis within the host and facilitate immune evasion. The ES antigen of T. spiralis was found to suppress T-cell function by decreasing tryptophan concentrations, enabling the parasite to evade host immune responses while promoting the expression of anti-inflammatory factors. Previous studies have demonstrated that IDO plays a critical role in host-pathogen interactions and the immune evasion mechanisms of parasites. Based on these findings, it was hypothesized that increased IDO expression in DCs may be associated with immunomodulatory effects triggered by the ES antigen. Higher IDO expression in DCs was found to reduce T-cell stimulation while suppressing local T-cell responses against the ES antigen of T. spiralis. This IDO-mediated mechanism supports T. spiralis in evading host immunity, thereby promoting its survival and contributing to chronic parasitic infection.

We also investigated how the ES antigen of T. spiralis trigger IDO activation. IFN-γ is the classic hallmark of inflammation that stimulates immunity. Various inflammatory factors, such as TNF-α, IFN-γ, and IFN-α, can induce IDO in DCs [38]. IDO is also induced by IL-10 in certain cell types [27, 43]. During T. spiralis infection, significant inflammatory responses occur, leading to the release of various factors, including IFN-γ, which may act as IDO-inducing agents. Recent studies have shown that IFN-γ strongly upregulates IDO and plays a critical role in immune tolerance following allogeneic skin transplantation [48]. Therefore, an increase in IFN-γ may enhance IDO expression, suggesting that IFN-γ could induce IDO to facilitate T. spiralis immune evasion. In this study, IL-10 mRNA levels were found to be elevated in DCs following stimulation with the ES antigen of T. spiralis. These findings align with those reported by Yu et al., who observed increased IL-10 mRNA expression and higher serum IL-10 levels in T. spiralis-infected mice [45]. The expression of IDO promotes the degradation of tryptophan and the accumulation of kynurenine metabolites, which suppress T-cell proliferation and contribute to the induction of regulatory T-cells [5].

The activation of DCs is essential for activating the immune response mechanism. Studies have shown that silencing IDO can increase the ability of DCs to stimulate T-cells in vitro [10]. The findings of this study suggest that inhibiting IDO expression in DCs is essential for determining whether IDO contributes to the immune evasion induced by the T. spiralis ES antigen. An effective siRNA targeting IDO was used to interfere with DC function, and a silencing effect was observed at a specific concentration. Prior research has shown that IDO-silenced DCs improve the efficacy of DC immunotherapy by enhancing tumor-specific immune responses [7]. IDO expression is linked to T-cell response suppression, as activated T-cells are highly sensitive to local tryptophan depletion mediated by IDO. Furthermore, tryptophan degradation products contribute to T-cell apoptosis [11, 39]. Silencing IDO promotes tumor antigen-specific T-cell proliferation, enhances tumor cell lysis, and decreases the population of CD4+ CD25+ Foxp3+ regulatory T-cells [8]. In a Lewis lung cancer model, IDO silencing significantly reduced tumor growth and delayed tumor formation [32]. Another study [47] reported that patients with metastatic melanoma exhibited T-cell responses to tumor antigens after receiving an IDO-silenced DC vaccine cotransfected with mRNA, leading to a significant reduction in lung, liver, and skin metastases. These findings indicate that IDO silencing provides clinical benefits by enhancing immune responses against tumors and potentially mitigating immune evasion by parasites such as T. spiralis.

Conclusion

This study demonstrated that the ES antigen increased the expression of IDO mRNA and protein in DCs. Additionally, IDO activation by IFN-γ led to upregulation of TNF-α, IFN-γ, and IL-10. The findings indirectly suggested that the sustained increase in IDO expression is associated with the elevated expression of IFN-γ. These results confirmed the interactions among the ES antigen, DCs, and IDO, highlighting the potential immunomodulatory role of the IDO protein. The study further indicated that IDO, as a molecule associated with immune tolerance, plays a role in the establishment of chronic T. spiralis infection in the host. These findings provide deeper insights into the molecular pathways regulating IDO activation, which may contribute to the development of novel therapeutic strategies against T. spiralis infection.

Acknowledgments

We thank the Northeast Agricultural University. We thank the two anonymous reviewers for the thorough review and useful insight that improved our manuscript.

Funding

This work was supported by Heilongjiang Natural Science Foundation (No. LH2022C036).

Conflicts of interest

The authors declare that they have no conflicts of interest.

References

  1. Abou Rayia DM, Izzularab BM, Harras S, Ghafar MTA, Azzam AR, Harras H, Younis RL, Soliman S, Saad AE. 2023. Stem cell biotherapy: a new remedy for Trichinella spiralis-induced inflammatory myopathy. Parasitology International 96, 102773. [CrossRef] [PubMed] [Google Scholar]
  2. Alameddine J, Godefroy E, Papargyris L, Sarrabayrouse G, Tabiasco J, Bridonneau C, Yazdanbakhsh K, Sokol H, Altare F, Jotereau F. 2019. Faecalibacterium prausnitzii skews Human DC to prime IL10-producing T cells through TLR2/6/JNK signaling and IL-10, IL-27, CD39, and IDO-1 induction. Frontiers in Immunology. 10, 143. [CrossRef] [Google Scholar]
  3. Ashour DS. 2013. Trichinella spiralis immunomodulation: an interactive multifactorial process. Expert Review of Clinical Immunology 9(7), 669–675. [CrossRef] [PubMed] [Google Scholar]
  4. Bai X, Wu X, Wang X, Guan Z, Gao F, Yu J, Yu L, Tang B, Liu X, Song Y, Wang X, Radu B, Boireau P, Wang F, Liu M. 2011. Regulation of cytokine expression in murine macrophages stimulated by excretory/secretory products from Trichinella spiralis in vitro. Molecular and Cellular Biochemistry 360(1–2), 79–88. [Google Scholar]
  5. von Bubnoff D, Scheler M, Wilms H, Wenzel J, von Bubnoff N, Häcker G, Schultze J, Popov A, Racz P, Bieber T, Wickenhauser C. 2011. Indoleamine 2, 3-dioxygenase-expressing myeloid dendritic cells and macrophages in infectious and noninfectious cutaneous granulomas. Journal of the American Academy of Dermatology, 65(4), 819–832. [CrossRef] [PubMed] [Google Scholar]
  6. Catani L, Sollazzo D, Trabanelli S, Curti A, Evangelisti C, Polverelli N, Palandri F, Baccarani M, Vianelli N, Lemoli RM. 2012. Decreased expression of indoleamine 2, 3-dioxygenase 1 in dendritic cells contributes to impaired regulatory T cell development in immune thrombocytopenia. Annals of Hematology 92(1), 67–78. [Google Scholar]
  7. Chen D, Koropatnick J, Jiang N, Zheng X, Zhang X, Wang H, Yuan K, Siu KS, Shunnar A, Way C, Min WP. 2014. Targeted siRNA silencing of indoleamine 2, 3-dioxygenase in antigen-presenting cells using mannose-conjugated liposomes: a novel strategy for treatment of melanoma. Journal of Immunotherapy, 37(2), 123–134. [CrossRef] [PubMed] [Google Scholar]
  8. Chen J, Li J, Qiao H, Hu R, Li C. 2023. Disruption of IDO signaling pathway alleviates chronic unpredictable mild stress-induced depression-like behaviors and tumor progression in mice with breast cancer. Cytokine, 162, 156115. [CrossRef] [PubMed] [Google Scholar]
  9. Ebrahimi A, Kardar GA, Teimoori-Toolabi L, Ghanbari H, Sadroddiny E. 2016. Inducible expression of indoleamine 2, 3-dioxygenase attenuates acute rejection of tissue-engineered lung allografts in rats. Gene, 576(1), 412–420. [CrossRef] [PubMed] [Google Scholar]
  10. Flatekval GF, Sioud M. 2009. Modulation of dendritic cell maturation and function with mono- and bifunctional small interfering RNAs targeting indoleamine 2,3-dioxygenase, Immunology, 128, e837–e848. [CrossRef] [PubMed] [Google Scholar]
  11. Grohmann U. 2003. Tolerance, DCs and tryptophan: much ado about IDO. Trends in Immunology, 24(5), 242–248. [CrossRef] [PubMed] [Google Scholar]
  12. Gruden-Movsesijan A, Ilic N, Colic M, Majstorovic I, Vasilev S, Radovic I, Sofronic-Milosavljevic LJ. 2011. The impact of Trichinella spiralis excretory–secretory products on dendritic cells. Comparative Immunology, Microbiology and Infectious Diseases, 34(5), 429–439. [CrossRef] [PubMed] [Google Scholar]
  13. Huang Y-S, Ogbechi J, Clanchy FI, Williams RO, Stone TW. 2020. IDO and kynurenine metabolites in peripheral and CNS disorders. Frontiers in Immunology, 11, 388. [CrossRef] [PubMed] [Google Scholar]
  14. Ilic N, Gruden-Movsesijan A, Sofronic-Milosavljevic L. 2012. Trichinella spiralis: shaping the immune response. Immunology Research, 52(1–2), 111–119. [CrossRef] [PubMed] [Google Scholar]
  15. Ilić N, Kosanović M, Gruden-Movsesijan A, Glamočlija S, Sofronić-Milosavljević L, Čolić M, Tomić S. 2021. Harnessing immunomodulatory mechanisms of Trichinella spiralis to design novel nanomedical approaches for restoring self-tolerance in autoimmunity. Immunology Letters, 238, 57–67. [CrossRef] [PubMed] [Google Scholar]
  16. Iwahashi N, Yamamoto M, Nanjo S, Toujima S, Minami S, Ino K. 2017. Downregulation of indoleamine 2,3-dioxygenase expression in the villous stromal endothelial cells of placentas with preeclampsia, Journal of Reproductive Immunology 119, 54–60. [CrossRef] [PubMed] [Google Scholar]
  17. Jin X, Bai X, Yang Y, Ding J, Shi H, Fu B, Boireau P, Liu M, Liu X. 2020. NLRP3 played a role in Trichinella spiralis-triggered Th2 and regulatory T cells response. Veterinary Research, 51(1), 107. [CrossRef] [PubMed] [Google Scholar]
  18. Kobpornchai P, Flynn RJ, Reamtong O, Rittisoonthorn N, Kosoltanapiwat N, Boonnak K, Boonyuen U, Ampawong S, Jiratanh M, Tattiyapong M, Adisakwattana P. 2020. A novel cystatin derived from Trichinella spiralis suppresses macrophage-mediated inflammatory responses. PLoS Neglected Tropical Diseases, 14(4), e0008192. [CrossRef] [PubMed] [Google Scholar]
  19. Li C, Liu T, Zhao N, Zhu L, Wang P, Dai X. 2016. Dendritic cells transfected with indoleamine 2,3-dioxygenase gene suppressed acute rejection of cardiac allograft. International Immunopharmacology 36, 31–38. [CrossRef] [PubMed] [Google Scholar]
  20. Lippens C, Duraes FV, Dubrot J, Brighouse D, Lacroix M, Irla M, Aubry-Lachainaye JP, Reith W, Mandl JN, Hugues S. 2016. IDO-orchestrated crosstalk between pDCs and Tregs inhibits autoimmunity. Journal of Autoimmunity, 75, 39–49. [CrossRef] [PubMed] [Google Scholar]
  21. Luo B, Que Z-J, Zhou Z-Y, Wang Q, Dong C-S, Jiang Y, Hu B, Shi H, Jin Y, Liu J-W, Li H-G, Wang L, Tian J-H. 2018. Feiji recipe inhibits the growth of lung cancer by modulating T-cell immunity through indoleamine-2, 3-dioxygenase pathway in an orthotopic implantation model. Journal of Integrative Medicine, 16(4), 283–289. [CrossRef] [PubMed] [Google Scholar]
  22. MacDonald AS, Maizels RM. 2008. Alarming dendritic cells for Th2 induction. Journal of Experimental Medicine, 205(1), 13–17. [CrossRef] [PubMed] [Google Scholar]
  23. Mancuso R, Hernis A, Agostini S, Rovaris M, Caputo D, Fuchs D, Clerici M. 2015. Indoleamine 2,3 Dioxygenase (IDO) expression and activity in relapsing-remitting multiple sclerosis. PLoS One, 10(6), e0130715. [CrossRef] [PubMed] [Google Scholar]
  24. Marian I, Ionică AM, Deak G, Ursache T, Lefkaditis M, Gherman CM, Mihalca AD. 2020. The effect of Trichinella spiralis on muscular activity of experimentally infected mice. Parasitology International, 76, 102032. [CrossRef] [PubMed] [Google Scholar]
  25. Meibers HE, Warrick KA, VonHandorf A, Vallez CN, Kawarizadeh K, Saha I, Donmez O, Jain VG, Kottyan LC, Weirauch MT, Pasare C. 2023. Effector memory T cells induce innate inflammation by triggering DNA damage and a non-canonical STING pathway in dendritic cells. Cell Reports, 42(10), 113180. [CrossRef] [PubMed] [Google Scholar]
  26. Moravej A, Kouhpayeh A, Geramizadeh B, Azarpira N, Yaghobi R, Mansoori Y, Karimi M-H. 2019. The effect of mesenchymal stem cells on the expression of IDOand Qa2 molecules in dendritic cells. Advanced Pharmaceutical Bulletin 9(1), 56–63. [CrossRef] [PubMed] [Google Scholar]
  27. Munn David H, Mellor Andrew L. 2016. IDO in the tumor microenvironment: Inflammation, counter-regulation, and tolerance. Trends in Immunology, 37(3), 193–207. [CrossRef] [PubMed] [Google Scholar]
  28. Munn DH, Shafizadeh E, Attwood JT, Bondarev I, Pashine A, Mellor AL. 1999. Inhibition of T cell proliferation by macrophage tryptophan catabolism. Journal of Experimental Medicine, 189(9), 1363–1372. [CrossRef] [PubMed] [Google Scholar]
  29. Rajan D, Chinnadurai R, O’Keefe EL, Boyoglu-Barnum S, Todd SO, Hartert TV, Galipeau J, Anderson LJ. 2017. Protective role of Indoleamine 2,3 dioxygenase in Respiratory Syncytial Virus associated immune response in airway epithelial cells. Virology, 512, 144–150. [CrossRef] [Google Scholar]
  30. Reis e Sousa C. 2006. Dendritic cells in a mature age. Nature Reviews Immunology, 6(6), 476–483. [CrossRef] [PubMed] [Google Scholar]
  31. Schöniger S, Gräfe H, Richter F, Schoon HA. 2018. Expression of indoleamine 2,3-dioxygenase 1 as transcript and protein in the healthy and diseased equine endometrium. Research in Veterinary Science, 118, 278–287. [CrossRef] [PubMed] [Google Scholar]
  32. Sioud M, Nyakas M, Sæbøe-Larssen S, Mobergslien A, Aamdal S, Kvalheim G. 2016. Diversification of antitumour immunity in a patient with metastatic melanoma treated with ipilimumab and an IDO-silenced dendritic cell vaccine. Case Reports in Medicine, 2016, 9639585. [CrossRef] [Google Scholar]
  33. Sofronic-Milosavljevic L, Ilic N, Pinelli E, Gruden-Movsesijan A. 2015. Secretory Products of Trichinella spiralis muscle larvae and immunomodulation: Implication for autoimmune diseases, allergies, and malignancies. Journal of Immunology Research, 2015, 1–14. [CrossRef] [Google Scholar]
  34. Soliman H, Rawal B, Fulp J, Lee J-H, Lopez A, Bui MM, Khalil F, Antonia S, Yfantis HG, Lee DH, Dorsey TH, Ambs S. 2013. Analysis of indoleamine 2–3 dioxygenase (IDO1) expression in breast cancer tissue by immunohistochemistry. Cancer Immunology, Immunotherapy, 62(5), 829–837. [CrossRef] [PubMed] [Google Scholar]
  35. Song YY, Zhang Y, Yang D, Ren HN, Sun GG, Jiang P, Liu RD, Zhang X, Cui J, Wang ZQ. 2018. The immune protection induced by a serine protease inhibitor from the foodborne parasite Trichinella spiralis. Frontiers in Microbiology, 9, 1544. [CrossRef] [PubMed] [Google Scholar]
  36. Takamatsu M, Hirata A, Ohtaki H, Hoshi M, Ando T, Ito H, Hatano Y, Tomita H, Kuno T, Saito K, Seishima M, Hara A. 2015. Inhibition of indoleamine 2,3‐dioxygenase 1 expression alters immune response in colon tumor microenvironment in mice. Cancer Science, 106(8), 1008–1015. [CrossRef] [PubMed] [Google Scholar]
  37. Terness P, Chuang JJ, Opelz G. 2006. The immunoregulatory role of IDO-producing human dendritic cells revisited. Trends in Immunology, 27(2), 68–73. [CrossRef] [PubMed] [Google Scholar]
  38. Wang XF, Wang HS, Wang H, Zhang F, Wang KF, Guo Q, Zhang G, Cai SH, Du J. 2014. The role of indoleamine 2, 3-dioxygenase (IDO) in immune tolerance: focus on macrophage polarization of THP-1 cells. Cellular Immunology, 289, 42–48. [CrossRef] [PubMed] [Google Scholar]
  39. Wobser M, Voigt H, Houben R, Eggert AO, Freiwald M, Kaemmerer U, Kaempgen E, Schrama D, Becker JC. 2007. Dendritic cell based antitumor vaccination: impact of functional indoleamine 2,3-dioxygenase expression. Cancer Immunology, Immunotherapy, 56(7), 1017–1024. [CrossRef] [PubMed] [Google Scholar]
  40. Wu Z, Sofronic-Milosavljevic L, Nagano I, Takahashi Y. 2008. Trichinella spiralis: nurse cell formation with emphasis on analogy to muscle cell repair. Parasites & Vectors, 1(1), 27. [CrossRef] [PubMed] [Google Scholar]
  41. Xie FT, Cao JS, Zhao J, Yu Y, Qi F, Dai XC. 2015. IDO expressing dendritic cells suppress allograft rejection of small bowel transplantation in mice by expansion of Foxp3 + regulatory T cells. Transplant Immunology, 33(2), 69–77. [CrossRef] [PubMed] [Google Scholar]
  42. Xu D, Tang B, Wang Y, Zhang L, Qu Z, Shi W, Wang X, Sun Q, Sun S, Liu M. 2020. The immune protection induced by a serine protease from the Trichinella spiralis adult administered as DNA and protein vaccine. Acta Tropica, 211, 105622. [CrossRef] [PubMed] [Google Scholar]
  43. Xu SQ, Wang CY, Zhu XJ, Dong XY, Shi Y, Peng J, Qin P, Sun JZ, Guo C, Ni H, Hou M. 2012. Decreased indoleamine 2, 3-dioxygenase expression in dendritic cells and role of indoleamine 2,3-dioxygenase-expressing dendritic cells in immune thrombocytopenia. Annals of Hematology, 91(10), 1623–1631. [CrossRef] [PubMed] [Google Scholar]
  44. Yang Y, Cai YN, Tong MW, Sun N, Xuan YH, Kang YJ, Vallée I, Boireau P, Cheng SP, Liu MY. 2016. Serological tools for detection of Trichinella infection in animals and humans. One Health, 2, 25–30. [CrossRef] [PubMed] [Google Scholar]
  45. Yu YR, Deng MJ, Lu WW, Jia MZ, Wu W, Qi YF. 2013. Systemic cytokine profiles and splenic toll-like receptor expression during Trichinella spiralis infection. Experimental Parasitology, 134(1), 92–101. [CrossRef] [PubMed] [Google Scholar]
  46. Zhai L, Bell A, Ladomersky E, Lauing KL, Bollu L, Sosman JA, Zhang B, Wu JD, Miller SD, Meeks JJ, Lukas RV, Wyatt E, Doglio L, Schiltz GE, McCusker RH, Wainwright DA. 2020. Immunosuppressive IDO in cancer: mechanisms of action, animal models, and targeting strategies. Frontiers in Immunology, 11, 1185. [CrossRef] [PubMed] [Google Scholar]
  47. Zhang Y, Fu J, Shi Y, Peng S, Cai Y, Zhan X, Song N, Liu Y, Wang Z, Yu Y, Wang Y, Shi Q, Fu Y, Yuan K, Zhou N, Joshi R, Ichim TE, Min W. 2018. A new cancer immunotherapy via simultaneous DC-mobilization and DC-targeted IDO gene silencing using an immune-stimulatory nanosystem. International Journal of Cancer, 143(8), 2039–2052. [CrossRef] [PubMed] [Google Scholar]
  48. Zhang Y, Wang Y, Wu G, Zhang W, Wang X, Cai W, Zhang J, Han S, Li Y, Bai X, Shi J, Su L, Hu D. 2018. Prolonged skin grafts survival time by IFN-γ in allogeneic skin transplantation model during acute rejection through IFN-γ/STAT3/IDO pathway in epidermal layer. Biochemical and Biophysical Research Communications, 496(2), 436–442. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Yu W, Yuan X, Zhai P, Li X & Han C. 2025. Effects of Trichinella spiralis excretory-secretory antigens on expression of indoleamine 2, 3-dioxygenase on dendritic cells in vitro. Parasite 32, 26. https://doi.org/10.1051/parasite/2025018.

All Figures

thumbnail Figure 1

Effect of ES antigen on DC activity. DCs were treated with 0, 5, 10, 15, 25, 30, or 40 μg/mL ES antigen for 24 h. CCK-8 assay was performed to assess cell proliferation activity, and optical density (OD) was measured at 450 nm. ***p < 0.001.
In the text
thumbnail Figure 2

Relative IDO mRNA expression in DCs stimulated with different doses of ES antigen. DCs were treated with 0, 5, 10, 15, 20, 30, or 40 μg/mL ES antigen for 24 h. IFN-γ was used as a positive control. Real-time RT-PCR was conducted to quantify the relative expression of IDO mRNA in DCs. **p < 0.01, ***p < 0.001.
In the text
thumbnail Figure 3

Time-dependent effect of ES antigen on IDO mRNA expression in DCs. DCs were treated with ES antigen at the optimal concentration for 0, 4, 8, 12, 16, 20, 24, or 32 h. Real-time RT-PCR was performed to determine the relative expression of IDO mRNA in DCs. **p < 0.01, ***p < 0.001.
In the text
thumbnail Figure 4

Effects of T. spiralis ES products on the expression of IDO and cytokine mRNAs in DC2.4 cells. DCs were treated with 15 μg/mL ES products from T. spiralis for 0, 2, 6, 12, 24, 36, 48, or 72 h. IFN-γ was used as a positive control in these experiments. (A–D) Real-time RT-PCR was performed to identify the relative expression of IDO, IFN-γ, IL-10, and TNF-α mRNAs in DCs. *p < 0.05, **p < 0.01, and ***p < 0.001.
In the text
thumbnail Figure 5

Detection of IDO expression by Western blotting after different DC treatments. (A) Representative bands of the IDO protein in each group were analyzed by WB. (B) The gray value of the IDO protein in different treatment groups was analyzed. *p < 0.05, **p < 0.01, and ***p < 0.001.
In the text
thumbnail Figure 6

Expression of DC surface marker molecules induced by ES antigen, detected by flow cytometry. DCs were cultured in standard RPMI 1640 medium or stimulated with ES antigen or LPS (positive control) for 24 h. (A–D) Expression levels of CD40, MHC-II, CD80, and CD86 were analyzed by flow cytometry. (E) Ratios of CD40, MHC-II, CD80, and CD86 in different groups. *p < 0.05, **p < 0.01, ***p < 0.001.
In the text
thumbnail Figure 7

Effects of IDO knockdown on DCs. DCs were cultured in medium alone (control) or transfected with control siRNA (Ctrl siRNA), siRNA 339, siRNA 620, or siRNA 890 for 6 h, followed by stimulation with ES antigen for 24 h. (A) Relative IDO mRNA expression (normalized to GAPDH) was quantified by real-time qRT-PCR. ***p < 0.001. (B) IDO protein levels were analyzed by Western blotting.
In the text
thumbnail Figure 8

Relative expression of cytokines after siRNA-mediated IDO knockdown. (A) and (B) Relative mRNA expression levels of IFN-γ and TNF-α were quantified by qRT-PCR. The mRNA levels of IFN-γ and TNF-α were significantly higher in the siRNA620 group than in the control and control siRNA groups (***p < 0.001). (C) qRT-PCR analysis of IL-10 mRNA expression. The IL-10 mRNA level was significantly lower in the siRNA620 group than in the control and control siRNA groups (***p < 0.001).
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.