EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 30 (2023) Parasite, 30 (2023) 46 Full HTML
Open Access
Issue
Parasite
Volume 30, 2023
Article Number 46
Number of page(s) 10
DOI https://doi.org/10.1051/parasite/2023047
Published online 02 November 2023

© L.-T. Yin et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Toxoplasmosis is a disease caused by the protozoan parasite Toxoplasma gondii, which infects approximately one-third of humans [23]. Usually, toxoplasmosis in immunocompetent people is asymptomatic, whereas it seriously affects immunocompromised individuals, such as AIDS patients, cancer patients, and organ transplant recipients, causing serious medical issues [30]. In particular, this disease may lead to foetal mortality in cases of vertical passage [1]. Unfortunately, current therapeutic options for toxoplasmosis are limited. Antifolate drugs such as pyrimethamine are effective against the tachyzoite stage of T. gondii but do not affect the bradyzoite stage that causes chronic infection in the host. Lifelong maintenance with a combination of pyrimethamine-sulfadiazine for toxoplasmic encephalitis often leads to side effects, including severe allergic reactions and haematoxicity [10]. Vaccine inoculation is a promising method in therapeutic applications of toxoplasmosis since vaccination is the most effective and potent strategy for controlling infectious diseases and has saved millions of lives [4]. Consequently, finding and validating vaccine candidates against toxoplasmosis is especially urgent.

Over the past few years, protein vaccines have received increasing attention since they can provoke strong humoral responses by eliciting antigen-specific antibodies [36]. Furthermore, the non-invasive and acceptable route of intranasal vaccination is becoming more attractive because it requires lower doses of antigens, while it triggers mucosal immune responses at local and distant mucosa sites, as well as systemic and cellular immune response [27]. Therefore, several recombinant T. gondii proteins prepared by other groups such as rhoptry protein 2 (ROP2) [13], ROP18 [31], malate dehydrogenase (MDH) [19], actin depolymerizing factor (ADF) [18], as well as ours such as actin [44], phosphoglycerate mutase 2 (PGAM 2) [41], ROP17 [42], receptor for activated C kinase 1 (RACK1) [39] and protein disulfide isomerase (PDI) [38] have been tested to assess their immunoprotective effects produced by intranasal immunisation. Although the abovementioned recombinant proteins were capable of triggering both cellular and humoral responses, they all conferred partial protective efficacy against toxoplasmosis.

Toxoplasma gondii is a member of the phylum Apicomplexa, which replicates rapidly and requires large amounts of purines for the synthesis of their nucleic acids and other vital components. Nevertheless, it is a purine auxotroph that relies on purine salvage from the host [8]. Pyrimidine salvage in T. gondii probably occurs through the following steps: cytidine and deoxycytidine are deaminated by cytidine deaminase to uridine and deoxyuridine, respectively, uridine and deoxyuridine are cleaved to uracil by uridine phosphorylase (UPase), and uracil is metabolised to uridine 5′-monophosphate by uracil phosphoribosyltransferase. Thus, uridine 5′-monophosphate is the end product of both de novo pyrimidine biosynthesis and pyrimidine salvage in T. gondii [14]. UPase participates in the synthesis of purines and plays an important role in the proliferation of T. gondii.

Our previous study showed that T. gondii UPase is one of the novel candidate antigens identified among soluble tachyzoite antigens using rabbit anti-T. gondii serum by two-dimensional gel electrophoresis and proteomics analyses [20]. The recombinant T. gondii uridine phosphorylase (rTgUPase) protein was produced in Escherichia coli and showed specific antigenicity [45]. In the present study, rTgUPase was used to intranasally immunise BALB/c mice, and the immune protection against T. gondii infection was investigated. The results demonstrated that mice immunised with rTgUPase could protect against T. gondii infection by eliciting humoral and mucosal as well as cellular immune responses. Additionally, our data showed that rTgUPase may be a novel vaccine candidate against toxoplasmosis.

Materials and methods

Mice, ethics statement and parasites

Female BALB/c mice (6-week-old) were purchased from the Laboratory Animal Center, Shanxi Medical University (Shanxi, China). All mice were maintained under specific-pathogen-free (SPF) conditions and provided with rodent feed and water ad libitum. Prior to experiments, the mice were acclimatised for one week. The animal protocols were approved by the Ethics Committee on Animal Research of the Shanxi Medical University (Protocol #: SYDL2021016).

Tachyzoites of the virulent RH strain of T. gondii used as a challenge for immunised mice were provided by Peking University Health Science Center (Beijing, China) in this study. Tachyzoites of the highly virulent T. gondii RH strain (Type I) were maintained using Vero cells in MEM with 5% FBS (Gibco, USA) and 1% penicillin–streptomycin (Gibco, USA). The T. gondii tachyzoites were cultivated every 4 days in Vero cells and collected according to published protocols [25, 26].

Expression and purification of rTgUPase

rTgUPase was expressed in E. coli strain BL21 (DE3) and purified via affinity chromatography using nickel-nitrilotriacetic acid (Ni-NTA) agarose (QIAGEN, Hilden, Germany) as described previously [45]. Briefly, total RNA was extracted from tachyzoites of the RH strain of T. gondii. A pair of specific primers (sense, 5′–CCGGAATTCATGTCGGAACTCAAAGGAA–3′; antisense, 5′–CCGGCTCGAGTT ACGCCGCAGGCTTGATG–3′) were designed according to the open reading frame of the TgUPase gene (GenBank: DQ385446.1), and the RT-PCR product was cloned into the prokaryotic expression pET-30a(+) vector. The recombinant pET-30a(+)-TgUPase plasmid was transferred into E. coli DH5α, and positive clones were selected through colony PCR and confirmed by double restriction enzyme digestion and sequencing. The successful pET-30a(+)-TgUPase construct was transformed into E. coli BL21 (DE3) and induced with 0.1 mM IPTG at 37 °C for 4 h for expression. The expressed proteins were analysed by SDS-PAGE with Coomassie blue R-250 staining, and the antigenicity of rTgUPase was analysed with human antiserum of T. gondii (1:200) using Western blot assays. rTgUPase was purified via Ni2+-NTA agarose (QIAGEN) with 200 mM imidazole elution at 4 °C [38]. Before inoculation into mice or stimulation in vitro, a ToxinEraserTM Endotoxin Removal Kit was used to remove endotoxin, and a Chromogenic End-point Endotoxin Assay Kit (Chinese Horseshoe Crab Reagent Manufactory, Xiamen, China) was employed to assess the level of endotoxin remaining in rTgUPase. When the level of endotoxin was less than 0.1 EU/mL, rTgUPase was dialysed against PBS, filtered through a 0.2 μm-pore membrane and stored at −70 °C. rTgUPase was quantified by the Bradford method.

Herein, cultured pET-30a(+)-TgUPase-BL21 (DE3) with or without IPTG induction served as induced or uninduced group, respectively. The bacteria from 1 mL induced or uninduced group were collected by centrifugation and boiled in 100 μL 1 × SDS loading buffer for 5 min, then 10 μL was loaded on SDS-PAGE. The bacteria from 3 mL induced group were harvested via centrifugation, and the obtained pellets were resuspended in cold PBS and homogenised via sonication on ice. The lysate was then centrifuged to separate the supernatant and cell pellet. The cell pellet was boiled in 100 μL 1 × SDS loading buffer and then 10 μL was loaded on SDS-PAGE. The supernatant was quantified using BCA method and 10 μg protein was loaded on SDS-PAGE.

rTgUPase immunisation and sample collection

Forty female BALB/c mice were randomly divided into five groups (8 per group) and intranasally immunised with 20 μL of PBS containing 10 μg, 20 μg, 30 μg or 40 μg rTgUPase on Days 0, 14 and 21. The control group was treated with 20 μL of PBS instead. Two weeks after the third inoculation, the mice were anaesthetised with sodium pentobarbital (1.5%, 0.1 mL/20 g weight, intraperitoneal injection), and blood samples from mice in each group were collected by retro-orbital plexus puncture. The sera were separated and stored at −70 °C until analysed for the presence of specific antibodies.

The spleens were collected under aseptic conditions to perform lymphocyte proliferation assays, and the culture supernatants were used for cytokine assays. Prior to sample collection, the mice were deprived of food for 8 h to deplete the intestinal contents. Nasal, intestinal, vaginal and vesical washes were collected according to a previously described method [44, 47]. All the samples were stored at −70 °C for secretory IgA (sIgA) assays.

Spleen lymphocyte proliferation assay

According to our previously described method [44], spleens were surgically removed from the mice, and single-cell preparations were pelleted on Day 15 after the last immunisation. In brief, 5 × 105 cells per well were cultured in triplicate in 96-well plates containing RPMI-1640 medium with penicillin–streptomycin (1 mM) and 10% FBS. The culture was stimulated with either 10 μg/mL rTgUPase, 5 μg/mL concanavalin A (Con A) as a positive control or medium alone for proliferation. The plates were incubated in 5% CO2 at 37 °C for 4 days. Next, 10 μL of CCK-8 reagent (Dojindo Laboratories, Japan) was added to each well, and the plate was incubated for 3 h. The optical density was then determined at 450 nm using an ELISA reader. The spleen cell proliferative responses were quantitated using a stimulation index (SI), which was calculated as the ratio of the average OD450 of the stimulated cells to the average OD450 of the unstimulated cells. All assays were performed in triplicate.

Cytokine assays

Cytokines were measured as previously described [40]. Spleen cells were obtained as described above and cultured in triplicate in flat-bottom 24-well microtiter plates. Supernatants from the cultured splenocytes (1.5 × 106) were collected after 24, 72 or 96 h of stimulation with rTgUPase (10 μg/mL) and assayed for interleukin-2 (IL-2) and IL-4 at 24 h, for IL-10 at 72 h, and for interferon-gamma (IFN-γ) at 96 h. IL-2, IL-4, IL-10 and IFN-γ concentrations were determined using a commercial ELISA Kit (PeproTech, USA), according to the manufacturer’s instructions. Cytokine concentrations were determined by reference to standard curves constructed with known amounts of mouse recombinant IL-2, IL-4, IL-10 and IFN-γ. The sensitivity limits of detection of IL-2, IL-4, IL-10 and IFN-γ were 16, 16, 47 and 23 pg/mL, respectively.

Specific IgG and sIgA detection

Enzyme-linked immunosorbent assays (ELISAs) were performed for the detection of rTgUPase-specific IgG, IgG1 and IgG2a antibodies in serum samples and sIgA in nasal, intestinal, vaginal and vesical washes collected two weeks after the last immunisation according to our previously described method [41]. Briefly, 96-well flat-bottom microtiter plates were coated with 7.5 μg/mL rTgUPase (100 μL/well) in PBS overnight at 4 °C. The plates were washed with PBS containing 0.05% Tween 20 (PBST), blocked for 1 h at 37 °C in PBS containing 5% FBS, and then washed with PBS. Thereafter, the serum samples (1:200 for IgG, 1:50 for IgG1 and IgG2a) and mucosal washes were incubated in different wells (100 μL/well) for 1 h at 37 °C. After washing, the wells were incubated with 100 μL of goat anti-mouse HRP-IgG, HRP-IgG1, HRP-IgG2a or HRP-IgA (Proteintech, China; diluted 1:2000 in PBS) for 1 h at 37 °C. The plates were washed extensively and incubated with 100 μL of substrate solution for 30 min at 37 °C. The optical density was measured at 492 nm (OD492) with a microplate reader (Bio-Tek) followed by 50 μL of 2 N H2SO4 to stop the enzyme reaction. All the samples were run in triplicate.

Challenge infection

Two groups of 6-week-old female BALB/c mice (20 mice per group) were vaccinated intranasally with 30 μg of rTgUPase suspended in 20 μL of sterile PBS or 20 μL of PBS and boosted with the same dose three times on Days 0, 14 and 21. The rTgUPase immunisation dose and the immune programme were based on the results of the abovementioned experiment. On Day 15 after the last immunisation, 8 mice in each group were challenged orally with 1 × 104 tachyzoites of the RH strain for the tachyzoite-load assay, while 12 mice were challenged with 4 × 104 tachyzoites for lethal infection.

On the 30th day after being challenged, the infected mice were anaesthetised with sodium pentobarbital, and the numbers of tachyzoites in the livers and brains were measured using real-time PCR assays as previously described [38, 39, 41, 44]. For survival analysis, the acute infected mice were monitored thrice daily until 30 days after the tachyzoite challenge. When painful symptoms were observed, a mouse was moved to an isolated cage for further husbandry; if obvious suffering, such as struggling or whining, was observed, the mouse was sacrificed through carbon dioxide (CO2) inhalation.

Statistical analysis

All statistical analyses were performed using SPSS software for Windows version 19.0. The differences in each variable, including antibody responses, lymphoproliferation assays and cytokine production, among all the groups were compared by one-way ANOVA. The tachyzoite burdens and survival times for vaccinated and control mice were compared using the Kaplan–Meier method. Significant differences in comparisons between groups were defined at p < 0.05.

Results

rTgUPase was expressed and purified successfully

After induction with 0.1 mM IPTG at 37 °C, the rTgUPase proteins were successfully expressed in E. coli, and the molecular weight was approximately 38.0 kDa (Fig. 1A). The isolated protein was water soluble and showed greater than 95% purity based on SDS-PAGE analysis (Fig. 1B). Western blot analysis indicated that the rTgUPase band was able to react with anti-Toxoplasma human serum (Fig. 1C).

thumbnail Figure 1

SDS-PAGE and Western blot analyses of the rTgUPase protein. (A) The full-length ORF of TgUPase was expressed in E. coli, separated on 12% SDS–PAGE gels and stained with Coomassie blue. The molecular weight of rTgUPase was approximately 38.0 kDa. (B) Purified rTgUPase protein (2 μg/lane) was detected via 12% SDS–PAGE and stained with Coomassie blue, and the purity of rTgUPase was greater than 95%. (C) Western blot analysis of rTgUPase using a human anti-T. gondii serum. Left lane: the supernatant (10 μg), Middle lane: cell pellet, right lane: induced whole bacterial protein.

Systemic immune response induced by rTgUPase vaccination

To assess the systemic immune response in the immunised mice, we evaluated the levels of rTgUPase-specific IgG, IgG1 and IgG2a antibodies in the sera and cytokines from the spleen cell supernatants by ELISAs. The results showed that 20, 30 and 40 μg of rTgUPase could elicit the maximum IgG antibody responses compared to those of the PBS and 10 μg groups (p < 0.01), but no significant differences were observed in the IgG responses among the 20, 30 and 40 μg groups and between the PBS and 10 μg groups (p > 0.05) (Fig. 2A). A mixed IgG1/IgG2a response was detected in the sera of the mice immunised with rTgUPase (Fig. 2B). Moreover, the mice immunised with 20, 30 and 40 μg rTgUPase elicited higher levels of IgG1 and IgG2a than the controls (p < 0.01). The 30 μg group had the highest value but was not significantly different from the 20 and 40 μg groups (p > 0.05). The above findings suggested that rTgUPase intranasal immunisation provoked a mixed Th1/Th2 immune response.

thumbnail Figure 2

Nasal immunisation induces rTgUPase-specific IgG responses in sera. Titres of both specific total IgG and IgG isotype antibodies in the sera of BALB/c mice were determined by ELISAs with rTgUPase as the bound target two weeks after the last immunisation. (A) Specific total IgG and (B) IgG1 and IgG2a titres in the sera of the mice vaccinated with rTgUPase. The results are expressed as the means of the OD492 ± SD (n = 8) and are representative of three experiments. **p < 0.01 (vaccinated vs. PBS group).

Cellular immune response elicited by rTgUPase inoculation

Spleen cells from 5 groups of mice were prepared 2 weeks after the last immunisation to assess the proliferative responses to rTgUPase. As shown in Table 1, the splenocyte stimulation indices (SI) from the immunised groups were higher than that of the PBS group (p < 0.05; p < 0.01), and the 30 μg group had the strongest activity vs. all other groups. In addition, splenocytes from each experimental and control group proliferated well in response to ConA (data not shown).

Table 1

Lymphocyte proliferation and cytokine production by splenocytes stimulated with rTgUPase.

The cell-mediated immunity produced in the immunised mice was evaluated by measuring the amount of cytokines (IFN-γ, IL-2, IL-4 and IL-10) in the supernatants of stimulated splenocyte cultures from mice of all groups. As shown in Table 1, significantly higher levels of IFN-γ, IL-2 and IL-4 were detected in the mice from all immunised groups compared with the controls (p < 0.05; p < 0.01). The mice immunised with 30 μg had the highest levels of IFN-γ, IL-2 and IL-4 compared to those of the other dose groups. However, the production of IL-10 did not significantly differ among all groups (p > 0.05).

Mucosal immune responses induced by rTgUPase vaccination

To investigate whether the mice immunised with rTgUPase induced mucosal immune responses, we tested the levels of rTgUPase-specific sIgA in the mucosal washes by ELISAs two weeks after the last immunisation (Fig. 3). The titres of rTgUPase-specific sIgA antibody in the mucosal washes were elevated following nasal immunisation. The sIgA antibody titres in the intestinal washes of the 10, 20, 30 or 40 μg rTgUPase-treated groups were significantly higher than those of the PBS control (p < 0.01), with the highest titre of sIgA antibody detected in the 30 μg rTgUPase group (Fig. 3B). sIgA levels from the nasal, vaginal and vesical washes were higher in the mice that were nasally immunised with 20, 30 or 40 μg rTgUPase compared with those from the PBS control and 10 μg rTgUPase groups, and 30 μg rTgUPase also provoked the highest sIgA levels in nasal washes (p < 0.01), while 40 μg rTgUPase induced the highest sIgA levels in vaginal and vesical washes (p < 0.01) (Figs. 3A, 3C and 3D). No significant differences were found between the mucosal washes of the 30 and 40 μg rTgUPase-treated groups. In conclusion, strong mucosal immune responses were elicited by nasal immunisation with rTgUPase at nasal, intestinal, vaginal and vesical mucosal sites.

thumbnail Figure 3

Nasal immunisation induces rTgUPase-specific sIgA responses in mucosal washes. The sIgA antibody titres in mucosal washes from the mice were tested by ELISAs two weeks after the last immunisation. High-level sIgA in (A) nasal washes, (B) intestinal washes, (C) vaginal washes and (D) vesical washes was induced in the mice nasally immunised with rTgUPase compared to those vaccinated with PBS. The data are expressed as the means of the OD492 ± SD (n = 8) and are representative of three experiments. *p < 0.05, ** p < 0.01 (vaccinated vs. PBS group).

Protection against T. gondii infection

To estimate the protective efficacy of rTgUPase intranasal immunisation against T. gondii infection, we generated a mouse model of tachyzoite infection via the oral route according to published procedures [41]. Thirty days after the challenge, the tachyzoite loads in the brain tissues were 18.18 (± 1.03) × 106/g in the control group and 9.47 (± 0.16) × 106/g in the rTgUPase-vaccinated group. The tachyzoite loads in the liver tissues were 62.52 (± 8.96) × 106/g in the control group and 30.15 (± 6.46) × 106/g in the rTgUPase-vaccinated group. These data indicated that immunisation with 30 μg of rTgUPase markedly reduced the tachyzoite loads compared to those in the control mice, showing approximately 51.78% (p < 0.01) and 49.61% (p < 0.05) fewer tachyzoites in the liver and brain, respectively (Fig. 4A).

thumbnail Figure 4

Assay for protection against oral challenge. Mice were nasally immunised with 30 μg rTgUPase or PBS. Two weeks after the last immunisation, mice were orally challenged with tachyzoites. (A) Mice from two groups (n = 8 PBS and 8 rTgUPase) were orally infected with 1 × 104 tachyzoites of the T. gondii RH strain. Liver and brain tachyzoite burdens were evaluated one month after the challenge. (B) Mouse survival rates of the two groups (n = 12 PBS and 12 rTgUPase) were monitored daily after challenge with 4 × 104 tachyzoites of the T. gondii RH strain until Day 30 post-challenge. Differences in survival were significant (p < 0.01). These results are representative of two independent experiments. Values are the means ± SDs. ** p < 0.01. PBS, phosphate buffered saline.

Additionally, the survival rates of the mice were recorded daily following oral challenge (4 × 104 tachyzoites of the RH strain) until 30 days post-challenge. A significant increase in the survival rate was observed in the 30 μg rTgUPase-immunised group compared to the control group (P < 0.01) (Fig. 4B). The mice immunised with 30 μg of rTgUPase had a significantly increased survival rate (44.29%) on the 30th day after challenge, and all mice in the PBS group died within 12 days post-challenge. These results demonstrated the protective effect of rTgUPase against T. gondii RH strain challenge.

Discussion

Toxoplasma gondii is an obligate intracellular protozoan that infects almost all warm-blooded animals, including humans. There are three asexual stages, including sporozoite, bradyzoite and tachyzoite, that can invade the cells in the T. gondii life cycle [22]. During these asexual stages, sporozoites are produced by sexual reproduction and excreted in the oocysts through felid faeces; bradyzoites are a slow multiplication form coming from the tissue cysts when chronic infection occurs; and tachyzoites, a proliferative form that causes a decrease in cholesterol content in the liver and brain and a decrease in host immune functions, leading to acute infection [37]. Importantly, tachyzoites can be maintained and produced in vitro (cellular cultivation systems) and in vivo (animal models), which makes them the most experimentally manipulable form that has been extensively modelled in many studies, including antigen production, immunological studies, drug trials in vitro and others [3]. Given these aspects of the tachyzoite, in the present study, T. gondii-infected mouse models were employed using tachyzoites. Of course, another consideration is that the antigen rTgUPase, which converts uridine or deoxyuridine to uracil and participates in the pyrimidine salvage pathways of T. gondii, originates from tachyzoites [11, 20].

TgUPase has been identified from soluble tachyzoite antigens and can react with a rabbit anti-T. gondii serum [20]. Moreover, rTgUPase could react with human anti-T. gondii serum [45], indicating that this protein could be used as a novel vaccine candidate. Here, rTgUPase nasal inoculation in BALB/c mice enhanced the output of sIgA in mucosal tracks and the production of total IgG and IgG isotypes (IgG1 and IgG2a) in sera. Additionally, rTgUPase stimulated lymphocyte proliferation and the release of the cytokines IFN-γ, IL-2, and IL-4 but not IL-10 in isolated spleen cells from inoculated mice. Decreased loads of tachyzoites in host tissues, an enhanced host survival rate (44.29%) and prolonged survival time were observed in the rTgUPase-vaccinated mice challenged with T. gondii infection. These data demonstrate that rTgUPase is a promising immunogen for developing a mucosal vaccine against T. gondii infection.

The natural portal of infection of T. gondii is the oral route by which either cyst-contaminated meats or oocyst-polluted fruits and vegetables are ingested [43]. In previous papers, tachyzoites have been proven to infect cats and mice via the oral route [9, 29, 41]. After ingestion, T. gondii targets the small intestine for infection. Given the mucosal exposure to Toxoplasma, mucosal immunity is believed to protect against Toxoplasma infection [46]. IgA is the most abundant antibody isotype in mucosal immunity to many pathogens, including Toxoplasma, which invades the host organism by crossing mucous membranes [12]. sIgA, which is the major effective form of mucosal IgA, annihilates pathogens with immune exclusion via nonspecific immunity [6]. Additionally, sIgA plays an indispensable role in specific immunity provoked by pathogens or mucosal vaccines [16]. At the site of entry, sIgA, which is synthesised from the epithelial cells of the intestine, can partially eliminate T. gondii via nonspecific immune exclusion and/or a specific neutralising role [16]. Our present results revealed that sIgA antibodies in intestinal washes as well as in nasal, vaginal and vesical washes were significantly enhanced in 30 μg rTgUPase-vaccinated mice. These data indicate that local mucosal inoculation with recombinant T. gondii protein can elicit in situ and distal immune responses. Therefore, mucosal inoculation via the intranasal route has extensive potential for sparking a protective immune response in all mucosal compartments.

Apart from sIgA, IgG, another element in humoral immunity, also participates in resistance to T. gondii [35]. The isotypes IgG, IgG1 and IgG2a can play an important role in resistance to T. gondii through complement fixation, opsonisation, or antibody (Ab)-dependent cell cytotoxicity [7]. Here, immunisation of mice with 30 or 40 μg of rTgUPase led to the development of higher levels of total rTgUPase-specific IgG antibodies compared with those of the PBS and 10 and 20 μg groups. Furthermore, a mixed humoral response of both IgG1 and IgG2a was unveiled in the 30 or 40 μg rTgUPase-vaccinated mice, indicating that rTgUPase immunisation predominantly activated a mixed Th1/Th2 immune response.

Cell-mediated immunity plays a major role in anti-T. gondii immunity. Among the cytokines produced by activated immune cells such as natural killer (NK) cells and CD4+ and CD8+ T lymphocytes, IFN-γ plays a pivotal role in the host defence against T. gondii infection [33]. IFN-γ controls tachyzoite replication during both acute and chronic phases of infection and prevents reactivation of T. gondii from dormant cysts at a later phase [2]. IFN-γ also promotes robust production of indoleamine 2,3-dioxygenase (IDO), which suppresses T. gondii growth [24]. In addition, IFN-γ-stimuslated cells express copious IFN-stimulated proteins, including GTPase family members, such as immunity-related GTPases (IRGs), which accumulate on the T. gondii PV membrane (PVM), destroy this structure, and then kill the parasites [32]. IL-2 can drive NK and CD8+ cell expansion, which is responsible for controlling tachyzoite proliferation via the synthesis of IFN-γ [34]. IFN-γ and IL-2 can stimulate the induction of antigen-specific sIgA responses that control the invasion of T. gondii at intestinal mucosal sites [39]. IL-4 plays a major role in controlling the development of cell-mediated immunity (CMI) and is involved in protection against the development of toxoplasmic encephalitis by preventing the formation of T. gondii cysts and the proliferation of tachyzoites in the brain [5]. IL-10 is a major antagonist involved in modulating IFN-γ, avoiding an extreme immune response that causes extensive inflammation and host tissue damage [28]. In our study, the production of IFN-γ, IL-2 and IL-4 rather than IL-10 in the supernatant of cultured spleen cells was significantly increased in the rTgUPase-vaccinated mice, suggesting that Th1- and Th2-type cellular-mediated immune responses were generated. Furthermore, the elevated number of spleen lymphocytes was consistent with the augmentation of cytokines in different groups stimulated with rTgUPase. These cytokines are valid evaluation indicators for the actual response in an in vivo assay to assess the immune responses of novel vaccine candidates against toxoplasmosis [5]. The above findings suggested that rTgUPase intranasal inoculation could elicit cell-mediated immune responses.

Furthermore, we prepared T. gondii RH strain infection mouse models via peroral infection of tachyzoites to assess the protective effect of the rTgUPase protein against T. gondii infection. Obvious reductions in tachyzoites were observed in the liver and brain tissues of the rTgUPase-vaccinated mice compared with those in the control mice. Additionally, the immunised mice exhibited significant protection against lethal tachyzoite infection, showing an approximately 44.29% improved survival rate and prolonged lifespan. In conclusion, TgUPase immunisation is effective in decreasing the loads of tachyzoite infection in host tissues and partially protects the host against T. gondii infection. Apart from type I strains, type II strains have low virulence, and type III strains are avirulent [11]. For further evaluation of the protective effect of rTgUPase, a type II or type III strain of T. gondii should be used to challenge mice in the next study.

Our present and previous results as well as others’ data demonstrated that intranasal inoculation with recombinant T. gondii proteins all elicited antigen-specific IgG and sIgA antibodies, cellular cytokines with a Th1-oriented immune responses. However, the immune protective efficacy was different. rTgUPase showed a 44.29% improved survival rate, greater than rTgPDI (31%) [38], rTg ADF (36.36%) [18], roughly the same as rTgRACK1 (45%) [39], rTgMDH (47%) [19], but less than rTgACT (50%) [44], rTgROP17 (59.17%) [42] and rTg PGAM 2 (70%) [41]. Compared with a cocktail vaccine composed of multicomponent proteins such as TgMIF, TgCDPK3, and Tg14-3-3 which provoked higher serum antibody titers and higher survival rate (90%) [17], a single recombinant protein vaccine in the present study and in our previous studies elicited lower serum antibody titers and lower survival rate. Henceforth, the study of multicomponent cocktail vaccines will be the focus on this issue.

To date, a T. gondii vaccine for clinical application is not yet available, although multiple vaccine candidates have been suggested. The reason is the existence of both multiple antigenically distinct strain types and multifarious antigenically diverse developmental stages. Moreover, Toxoplasma can effectively escape the immune system by developing a chronic encysted stage that is not easily eliminated by immune responses. An effective vaccine can prevent the tachyzoites from gaining access to other host tissues and to the placenta. Additionally, this vaccine can cause an immune response able to stop and kill the parasite when it penetrates the intestinal barrier. Of course, an effective vaccine must induce an immune response able to inhibit the formation of tissue cysts during the chronic phase of toxoplasmosis. For these demands, multicomponent antigens from oocysts, bradyzoites, tachyzoites and cysts should be considered. In addition, appropriate adjuvants such as CpG-containing oligodeoxynucleotide (CpG ODN) [15] and nanocurcumin [21] should be taken into account.

Taken together, our findings indicate that intranasal inoculation with rTgUPase provokes both mucosal and systemic as well as cellular-mediated immune responses, which confer protection against T. gondii RH strain infection in BALB/c mice. Although the protective effect is partial, findings from the present study indicate that rTgUPase is a promising vaccine candidate against Toxoplasma.

Conflict of interest

The authors declare that they have no competing interests.

#

Li-Tian Yin and Ying-Jie Ren contributed equally to this work.

Acknowledgments

This work was supported by the Fund for Shanxi “1331” Project Quality and Efficiency Improvement Plan (1331KFC) and the Natural Science Fund of Shanxi Province (20210302123297).

Author’s contributions

Li-tian Yin and Hai-long Wang conceived and designed the study. Li-tian Yin, Ying-jie Ren, Yu-jie You and Zhi-Xin Wang performed the experiments. Yong Yang and Hai-Long Wang analysed the data and drafted the manuscript. All authors read and approved the final manuscript.

References

  1. Aguirre AA, Longcore T, Barbieri M, Dabritz H, Hill D, Klein PN, Lepczyk C, Lilly EL, McLeod R, Milcarsky J, Murphy CE, Su C, VanWormer E, Yolken R, Sizemore GC. 2019. The One Health approach to toxoplasmosis: Epidemiology, control, and prevention strategies. Ecohealth, 16(2), 378–390. [CrossRef] [PubMed] [Google Scholar]
  2. Aliberti J. 2005. Host persistence: exploitation of anti-inflammatory pathways by Toxoplasma gondii. Nature Reviews Immunology, 5(2), 162–170. [CrossRef] [PubMed] [Google Scholar]
  3. Attias M, Teixeira DE, Benchimol M, Vommaro RC, Crepaldi PH, De Souza W. 2020. The life-cycle of Toxoplasma gondii reviewed using animations. Parasites & Vectors, 13(1), 588. [CrossRef] [PubMed] [Google Scholar]
  4. Azadi Y, Ahmadpour E, Ahmadi A. 2020. Targeting strategies in therapeutic applications of toxoplasmosis: Recent advances in liposomal vaccine delivery systems. Current Drug Targets, 21(6), 541–558. [CrossRef] [PubMed] [Google Scholar]
  5. Ching XT, Fong MY, Lau YL. 2017. Evaluation of the protective effect of deoxyribonucleic acid vaccines encoding granule antigen 2 and 5 against acute toxoplasmosis in BALB/c Mice. American Journal of Tropical Medecine and Hygiene, 96(6), 1441–1447. [CrossRef] [PubMed] [Google Scholar]
  6. Corthesy B. 2013. Multi-faceted functions of secretory IgA at mucosal surfaces. Frontiers in Immunology, 4, 185. [CrossRef] [PubMed] [Google Scholar]
  7. Denkers EY, Gazzinelli RT. 1998. Regulation and function of T-cell-mediated immunity during Toxoplasma gondii infection. Clinical Microbiology Reviews, 11(4), 569–588. [CrossRef] [PubMed] [Google Scholar]
  8. Donaldson TM, Cassera MB, Ho MC, Zhan C, Merino EF, Evans GB, Tyler PC, Almo SC, Schramm VL, Kim K. 2014. Inhibition and structure of Toxoplasma gondii purine nucleoside phosphorylase. Eukaryotic Cell, 13(5), 572–579. [CrossRef] [PubMed] [Google Scholar]
  9. Dubey JP. 2005. Unexpected oocyst shedding by cats fed Toxoplasma gondii tachyzoites: in vivo stage conversion and strain variation. Veterinary Parasitology, 133(4), 289–298. [CrossRef] [PubMed] [Google Scholar]
  10. Feliciano-Alfonso JE, Munoz-Ortiz J, Marin-Noriega MA, Vargas-Villanueva A, Trivino-Blanco L, Carvajal-Saiz N, de-la-Torre A. 2021. Safety and efficacy of different antibiotic regimens in patients with ocular toxoplasmosis: systematic review and meta-analysis. Systematic Reviews, 10(1), 206. [CrossRef] [PubMed] [Google Scholar]
  11. Fox BA, Bzik DJ. 2015. Nonreplicating, cyst-defective type II Toxoplasma gondii vaccine strains stimulate protective immunity against acute and chronic infection. Infection and Immunity, 83(5), 2148–2155. [CrossRef] [PubMed] [Google Scholar]
  12. Gesualdo L, Di Leo V, Coppo R. 2021. The mucosal immune system and IgA nephropathy. Seminars in Immunopathology, 43(5), 657–668. [CrossRef] [PubMed] [Google Scholar]
  13. Igarashi M, Zulpo DL, Cunha IA, Barros LD, Pereira VF, Taroda A, Navarro IT, Vidotto O, Vidotto MC, Jenkins MC, Garcia JL. 2010. Toxoplasma gondii: humoral and cellular immune response of BALB/c mice immunized via intranasal route with rTgROP2. Revista Brasileira de Parasitologia Veterinaria, 19(4), 210–216. [CrossRef] [Google Scholar]
  14. Iltzsch MH. 1993. Pyrimidine salvage pathways in Toxoplasma gondii. Journal of Eukaryotic Microbiology, 40(1), 24–28. [CrossRef] [PubMed] [Google Scholar]
  15. Kang HJ, Chu KB, Kim MJ, Lee SH, Park H, Jin H, Moon EK, Quan FS. 2021. Protective immunity induced by CpG ODN-adjuvanted virus-like particles containing Toxoplasma gondii proteins. Parasite Immunology, 43(1), e12799. [CrossRef] [PubMed] [Google Scholar]
  16. Li Y, Jin L, Chen T. 2020. The effects of secretory IgA in the mucosal immune system. Biomed Research International, 2020, 2032057. [PubMed] [Google Scholar]
  17. Liu F, Wu M, Wang J, Wen H, An R, Cai H, Yu L, Shen J, Chen L, Du J. 2021. Protective effect against toxoplasmosis in BALB/c mice vaccinated with recombinant Toxoplasma gondii MIF, CDPK3, and 14-3-3 protein cocktail vaccine. Frontiers in Immunology, 12, 755792. [CrossRef] [PubMed] [Google Scholar]
  18. Liu Z, Yin L, Li Y, Yuan F, Zhang X, Ma J, Liu H, Wang Y, Zheng K, Cao J. 2016. Intranasal immunization with recombinant Toxoplasma gondii actin depolymerizing factor confers protective efficacy against toxoplasmosis in mice. BMC Immunology, 17(1), 37. [CrossRef] [PubMed] [Google Scholar]
  19. Liu Z, Yuan F, Yang Y, Yin L, Liu Y, Wang Y, Zheng K, Cao J. 2016. Partial protective immunity against toxoplasmosis in mice elicited by recombinant Toxoplasma gondii malate dehydrogenase. Vaccine, 34(7), 989–994. [CrossRef] [PubMed] [Google Scholar]
  20. Ma GY, Zhang JZ, Yin GR, Zhang JH, Meng XL, Zhao F. 2009. Toxoplasma gondii: proteomic analysis of antigenicity of soluble tachyzoite antigen. Experimental Parasitology, 122(1), 41–46. [CrossRef] [PubMed] [Google Scholar]
  21. Mahdi Ghahari SM, Ajami A, Sadeghizadeh M, Esmaeili Rastaghi AR, Mahdavi M. 2022. Nanocurcumin as an adjuvant in killed Toxoplasma gondii vaccine formulation: An experience in BALB/c mice. Experimental Parasitology, 243, 108404. [CrossRef] [PubMed] [Google Scholar]
  22. Martorelli Di Genova B, Knoll LJ. 2020. Comparisons of the sexual cycles for the coccidian parasites Eimeria and Toxoplasma. Frontiers in Cellular and Infection Microbiology, 10, 604897. [CrossRef] [PubMed] [Google Scholar]
  23. Milne G, Webster JP, Walker M. 2020. Toxoplasma gondii: An underestimated threat? Trends in Parasitology, 36(12), 959–969. [CrossRef] [PubMed] [Google Scholar]
  24. Nagineni CN, Pardhasaradhi K, Martins MC, Detrick B, Hooks JJ. 1996. Mechanisms of interferon-induced inhibition of Toxoplasma gondii replication in human retinal pigment epithelial cells. Infection and Immunity, 64(10), 4188–4196. [CrossRef] [PubMed] [Google Scholar]
  25. Nguyen TT, Kamyingkird K, Phimpraphai W, Inpankaew T. 2022. Viability of Toxoplasma gondii tachyzoites in different conditions for parasite transportation. Veterinary World, 15(1), 198–204. [CrossRef] [PubMed] [Google Scholar]
  26. Nguyen TT, Kengradomkij C, Inpankaew T. 2021. Detection of antibodies to Toxoplasma gondii among owned dogs in Cambodia. Food and Waterborne Parasitology, 22, e00103. [CrossRef] [PubMed] [Google Scholar]
  27. O’Hagan DT, Valiante NM. 2003. Recent advances in the discovery and delivery of vaccine adjuvants. Nature Reviews Drug Discovery, 2(9), 727–735. [CrossRef] [PubMed] [Google Scholar]
  28. Ouyang W, Rutz S, Crellin NK, Valdez PA, Hymowitz SG. 2011. Regulation and functions of the IL-10 family of cytokines in inflammation and disease. Annual Review of Immunology, 29, 71–109. [CrossRef] [PubMed] [Google Scholar]
  29. Penarete-Vargas DM, Mevelec MN, Dion S, Seche E, Dimier-Poisson I, Fandeur T. 2010. Protection against lethal Neospora caninum infection in mice induced by heterologous vaccination with a mic1 mic3 knockout Toxoplasma gondii strain. Infection and Immunity, 78(2), 651–660. [CrossRef] [PubMed] [Google Scholar]
  30. Rahimi MT, Mahdavi SA, Javadian B, Rezaei R, Moosazadeh M, Khademlou M, Seyedpour SH, Syadatpanah A. 2015. High seroprevalence of Toxoplasma gondii antibody in HIV/AIDS individuals from North of Iran. Iranian Journal of Parasitology, 10(4), 584–589. [PubMed] [Google Scholar]
  31. Rashid I, Moire N, Heraut B, Dimier-Poisson I, Mevelec MN. 2017. Enhancement of the protective efficacy of a ROP18 vaccine against chronic toxoplasmosis by nasal route. Medical Microbiology and Immunology, 206(1), 53–62. [CrossRef] [PubMed] [Google Scholar]
  32. Saijo-Hamano Y, Sherif AA, Pradipta A, Sasai M, Sakai N, Sakihama Y, Yamamoto M, Standley DM, Nitta R. 2022. Structural basis of membrane recognition of Toxoplasma gondii vacuole by Irgb6. Life Science Alliance, 5(1), e202101149. [CrossRef] [PubMed] [Google Scholar]
  33. Sasai M, Yamamoto M. 2019. Innate, adaptive, and cell-autonomous immunity against Toxoplasma gondii infection. Experimental amd Molecular Medicine, 51(12), 1–10. [CrossRef] [PubMed] [Google Scholar]
  34. Su HC, Orange JS, Fast LD, Chan AT, Simpson SJ, Terhorst C, Biron CA. 1994. IL-2-dependent NK cell responses discovered in virus-infected beta 2-microglobulin-deficient mice. Journal of Immunology, 153(12), 5674–5681. [CrossRef] [PubMed] [Google Scholar]
  35. Suzuki Y. 2002. Host resistance in the brain against Toxoplasma gondii. Journal of Infectious Disease, 185(Suppl 1), S58–S65. [CrossRef] [PubMed] [Google Scholar]
  36. Tian X, Wang M, Xie T, Wan G, Sun H, Mei X, Zhang Z, Li X, Wang S. 2022. A recombinant protein vaccine encoding Toxoplasma gondii Cyst wall 2 (dense granule protein 47) provides partial protection against acute and chronic T. gondii infection in BALB/c mice. Acta Tropica, 232, 106514. [CrossRef] [PubMed] [Google Scholar]
  37. Tong WH, Pavey C, O’Handley R, Vyas A. 2021. Behavioral biology of Toxoplasma gondii infection. Parasites & Vectors, 14(1), 77. [CrossRef] [PubMed] [Google Scholar]
  38. Wang HL, Li YQ, Yin LT, Meng XL, Guo M, Zhang JH, Liu HL, Liu JJ, Yin GR. 2013. Toxoplasma gondii protein disulfide isomerase (TgPDI) is a novel vaccine candidate against toxoplasmosis. PLoS One, 8(8), e70884. [CrossRef] [PubMed] [Google Scholar]
  39. Wang HL, Pang M, Yin LT, Zhang JH, Meng XL, Yu BF, Guo R, Bai JZ, Zheng GP, Yin GR. 2014. Intranasal immunisation of the recombinant Toxoplasma gondii receptor for activated C kinase 1 partly protects mice against T. gondii infection. Acta Tropica, 137, 58–66. [CrossRef] [PubMed] [Google Scholar]
  40. Wang HL, Wang YJ, Pei YJ, Bai JZ, Yin LT, Guo R, Yin GR. 2016. DNA vaccination with a gene encoding Toxoplasma gondii Rhoptry Protein 17 induces partial protective immunity against lethal challenge in mice. Parasite, 23, 4. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  41. Wang HL, Wen LM, Pei YJ, Wang F, Yin LT, Bai JZ, Guo R, Wang CF, Yin GR. 2016. Recombinant Toxoplasma gondii phosphoglycerate mutase 2 confers protective immunity against toxoplasmosis in BALB/c mice. Parasite, 23, 12. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  42. Wang HL, Zhang TE, Yin LT, Pang M, Guan L, Liu HL, Zhang JH, Meng XL, Bai JZ, Zheng GP, Yin GR. 2014. Partial protective effect of intranasal immunization with recombinant Toxoplasma gondii rhoptry protein 17 against toxoplasmosis in mice. PLoS One, 9(9), e108377. [CrossRef] [PubMed] [Google Scholar]
  43. Wilhelm CL, Yarovinsky F. 2014. Apicomplexan infections in the gut. Parasite Immunology, 36(9), 409–420. [CrossRef] [PubMed] [Google Scholar]
  44. Yin LT, Hao HX, Wang HL, Zhang JH, Meng XL, Yin GR. 2013. Intranasal immunisation with recombinant Toxoplasma gondii actin partly protects mice against toxoplasmosis. PLoS One, 8(12), e82765. [CrossRef] [PubMed] [Google Scholar]
  45. Yin LT, Zhu JJ, Li RH, Wang HL, Li YQ, Yin GR. 2014. Gene-cloning, expression and immunoreactivity detection of Toxoplasma gondii uridine phosphorylase. Zhongguo Ji Sheng Chong Xue Yu Ji Sheng Chong Bing Za Zhi, 32(1), 24–28. [PubMed] [Google Scholar]
  46. Yoon KW, Chu KB, Kang HJ, Kim MJ, Eom GD, Lee SH, Moon EK, Quan FS. 2021. mucosal administration of recombinant baculovirus displaying Toxoplasma gondii ROP4 confers protection against T. gondii challenge infection in mice. Frontiers in Cellular and Infection. Microbiology, 11, 735191. [Google Scholar]
  47. Zhang TE, Yin LT, Li RH, Wang HL, Meng XL, Yin GR. 2015. Protective immunity induced by peptides of AMA1, RON2 and RON4 containing T-and B-cell epitopes via an intranasal route against toxoplasmosis in mice. Parasites & Vectors, 8, 15. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Yin L-T, Ren Y-J, You Y-J, Yang Y, Wang Z-X & Wang H-L. 2023. Intranasal immunisation with recombinant Toxoplasma gondii uridine phosphorylase confers resistance against acute toxoplasmosis in mice. Parasite 30, 46.

All Tables

Table 1

Lymphocyte proliferation and cytokine production by splenocytes stimulated with rTgUPase.

In the text

All Figures

thumbnail Figure 1

SDS-PAGE and Western blot analyses of the rTgUPase protein. (A) The full-length ORF of TgUPase was expressed in E. coli, separated on 12% SDS–PAGE gels and stained with Coomassie blue. The molecular weight of rTgUPase was approximately 38.0 kDa. (B) Purified rTgUPase protein (2 μg/lane) was detected via 12% SDS–PAGE and stained with Coomassie blue, and the purity of rTgUPase was greater than 95%. (C) Western blot analysis of rTgUPase using a human anti-T. gondii serum. Left lane: the supernatant (10 μg), Middle lane: cell pellet, right lane: induced whole bacterial protein.
In the text
thumbnail Figure 2

Nasal immunisation induces rTgUPase-specific IgG responses in sera. Titres of both specific total IgG and IgG isotype antibodies in the sera of BALB/c mice were determined by ELISAs with rTgUPase as the bound target two weeks after the last immunisation. (A) Specific total IgG and (B) IgG1 and IgG2a titres in the sera of the mice vaccinated with rTgUPase. The results are expressed as the means of the OD492 ± SD (n = 8) and are representative of three experiments. **p < 0.01 (vaccinated vs. PBS group).
In the text
thumbnail Figure 3

Nasal immunisation induces rTgUPase-specific sIgA responses in mucosal washes. The sIgA antibody titres in mucosal washes from the mice were tested by ELISAs two weeks after the last immunisation. High-level sIgA in (A) nasal washes, (B) intestinal washes, (C) vaginal washes and (D) vesical washes was induced in the mice nasally immunised with rTgUPase compared to those vaccinated with PBS. The data are expressed as the means of the OD492 ± SD (n = 8) and are representative of three experiments. *p < 0.05, ** p < 0.01 (vaccinated vs. PBS group).
In the text
thumbnail Figure 4

Assay for protection against oral challenge. Mice were nasally immunised with 30 μg rTgUPase or PBS. Two weeks after the last immunisation, mice were orally challenged with tachyzoites. (A) Mice from two groups (n = 8 PBS and 8 rTgUPase) were orally infected with 1 × 104 tachyzoites of the T. gondii RH strain. Liver and brain tachyzoite burdens were evaluated one month after the challenge. (B) Mouse survival rates of the two groups (n = 12 PBS and 12 rTgUPase) were monitored daily after challenge with 4 × 104 tachyzoites of the T. gondii RH strain until Day 30 post-challenge. Differences in survival were significant (p < 0.01). These results are representative of two independent experiments. Values are the means ± SDs. ** p < 0.01. PBS, phosphate buffered saline.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.