Open Access
Issue
Parasite
Volume 30, 2023
Article Number 35
Number of page(s) 26
DOI https://doi.org/10.1051/parasite/2023030
Published online 15 September 2023

© C. Bouguerche et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Some reports on digeneans from Scandinavian fishes began as early as 1784, with the description of Fasciola varica Müller, 1784, now known as Derogenes varicus (Müller, 1784), from Atlantic salmon Salmo salar supposedly from Danish waters [58]. This trematode warrants more attention as it is considered the most common digenean species in fish [32]. It is widely distributed in most of the oceans of the world, with a continuous three-dimensional distribution from the Arctic to the Antarctic by way of deeper waters [1, 8, 9, 1315, 19, 24, 29, 33, 3943, 5055, 59, 60, 70, 71, 73, 7578, 86, 87]. It occurs in what may be the widest range of bony fishes for any trematode species (Fig. 1).

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Geographical distribution of Derogenes varicus (Müller, 1784) from fish around the world. References for the records are given between parentheses. Note that this is not an exhaustive list of all reported hosts, excluding those for which evidence is partly lacking and illustrates mainly the numerous reports and the taxonomic range of hosts.

Several authors have questioned the reported broad distribution and the lack of host specificity of D. varicus and have suggested that D. varicus comprises more than one species [20, 34]. As a result, Køie [34] proposed to designate the northeast Atlantic specimens “D. varicus sensu lato” or “Derogenes sp.”. That D. varicus is a species complex was confirmed recently by Krupenko et al. [35] who, based on molecular evidence, suggested the presence of four genetic lineages (designated as “DV1–4”) within the species. The vertebrate hosts of the adult stages were as follows: Derogenes cf. varicus DV1 from the White Sea, Barents Sea (Russia) and North Sea (Sweden and Norway), a euryxenous species, occurring in the Atlantic wolffish Anarhichas lupus, the Pacific herring Clupea pallasii, Navaga Eleginus nawaga, the cod Gadus morhua, the common dab Limanda limanda, the shorthorn sculpin Myoxocephalus scorpius and the Moustache sculpin Triglops murrayii; Derogenes cf. varicus DV2, known only from the American plaice Hippoglossoides platessoides from the North Sea and from gastropod hosts Amauropsis islandica, Euspira pallida and Buccinum scalariforme from the White Sea and Barents Sea (Russia); Derogenes cf. varicus DV3 known only from the Sea of Okhotsk, Pacific, from Fedorov’s lumpsucker Eumicrotremus fedorovi; and Derogenes cf. varicus DV4 known only from Hippoglossoides platessoides from the North Sea [35, 63].

In the course of parasitological examination of trematodes of marine fish from Scandinavian waters (Sweden and Norway) and the Arctic Ocean (Norway), we found specimens resembling D. varicus in the stomach of Merlangius merlangus off the coast of Sweden, and in Gadus morhua from Sweden and Norway, hosts from which D. varicus was previously recorded in the North Sea. We compared these with D. varicus from the Atlantic salmon Salmo salar, to confirm their conspecificity.

Here, we provide a morphological redescription of D. varicus sensu stricto and confirm its lack of host specificity using molecular sequences (28S ribosomal RNA, Internal transcribed spacer ITS2, and Cytochrome c oxidase I cox1 sequences). Additionally, we studied the type-material of D. minor Looss, 1901 from the brown wrasse, Labrus merula. We designate a lectotype and paralectotypes and provide a redescription of this species. We also found in A. Looss’s collections specimens of the type-species of the genus, D. ruber Lühe, 1900 for which we provide an illustrated redescription. The validity of species previously synonymised with D. varicus is considered.

Material and methods

Host and parasite collection

Fish were collected from Sweden, Northeast Atlantic (Skagerrak, Kattegat and Gullmarsfjorden) and from western and Arctic Norway (Table 1).

Table 1

Host fishes examined from Scandinavian waters of the North Sea and the Arctic Ocean during this study.

Table 2

Collection data for 28S sequences analysed in this study. A.O., Arctic Ocean. B.S., Barents Sea. M., Mediterranean. N.S., North Sea. W.S., White Sea.

Table 3

Measurements of Derogenes varicus sensu stricto. NEA, Northwest Atlantic.

Table 4

Measurements of Derogenes ruber Lühe, 1900 and Derogenes minor Looss, 1901. M., Mediterranean. L., length. W., width. R., ratio.

Specimens from Skagerrak and Kattegat were collected during the biannual International Bottom Trawl Survey by the SLU Aqua team as part of the International Bottom Trawl Survey along the Swedish coast within the scope of their research projects and permits. Specimens were euthanized and made available for examination. Specimens from Gullmarsfjorden were collected in the vicinity of Kristineberg Center for Marine Research and Innovation, outside of the borders of the Gullmarns nature reserve, and within the scope of the permit for animal research from the Swedish Board of Agriculture (Enheten för försöksdjur och sällskapsdjur, Jordbruksverket, Dnr. 5.2.18-5483/18) and ethical approval for animal research from the Uppsala animal ethics committee (Uppsala djurförsöksetiska nämnd, Jordbruksverket, Dnr. 5.8.18-17209/2021) issued to the Swedish Museum of Natural History. Specimens from the Arctic Ocean were collected during the HHUMTL22 cruise by the Arctic University Museum of Norway, within the scope of the fieldwork sampling permit issued by the governor of Svalbard (RiS-1D12021Al) and the permission to trawl from the Norwegian Directorate of Fisheries (21/16250).

Digeneans were collected from freshly killed fish. The gastrointestinal tract was removed and examined for trematodes using the gutwash method [12, 28]. Trematodes were heat-killed, fixed without pressure in near-boiling saline, and preserved immediately in 80% ethanol for parallel morphological and molecular characterization. Ten specimens were processed as hologenophores (sensu [66]).

Morphological methods

Whole-mounts for morphological analysis were stained with acetocarmine or paracarmine, dehydrated in a graded ethanol series, cleared in clove oil, and mounted in Canada balsam. The hologenophores were processed according to the same methods. Drawings were made through a Nikon Eclipse i80 microscope with DIC (differential interference contrast) and a drawing tube. Drawings were scanned and redrawn on a computer with Adobe Illustrator 2022.

Measurements of whole-mounts and of hologenophores are in micrometres and indicated as the range followed by the number of measurements in parentheses. The following abbreviation is used: SMNH, Swedish Museum of Natural History, Stockholm, Sweden.

Molecular methods

Genomic DNA was extracted from a total of 10 hologenophores, and genetic sequence data were generated for three markers: a partial region of the cox1 mitochondrial region (cox1 mtDNA), the second internal transcribed spacer region (ITS2 rDNA), and the large (28S) ribosomal subunit RNA coding region. Polymerase chain reactions for all markers were performed in 25 μL of a mixture using an Illustra Hot Start Mix RTG 0.2 mL reaction kit (GE Healthcare Life Sciences, Uppsala, Sweden). The reaction mix consisted of 1 μL (0.4 μM) of each primer, 2 μL template DNA and 21 μL nuclease-free water. A fragment of the cytochrome oxidase I gene (cox1) was amplified using the primers JB3 (5′–TTTTTTGGGCATCCTGAGGTTTAT–3′) and COI R-Trema (5′–CAACAAATCATGATGCAAAAGG–3′) [84]. The reaction conditions were 4 min at 96 °C; 35 cycles of (10 s at 98 °C, 30 s at 45 °C, 1 min at 72 °C) and a final extension for 5 min at 72 °C. The 28S region was amplified using the primers 502 5′–CAAGTACCGTGAGGGAAAGTTGC–3′ [17] and 536 5′–CAGCTATCCTGAGGGAAAC–3′ [65] with the following reaction conditions: 3 min at 94 °C, 35 cycles (60 s at 94 °C, 60 s at 54 °C, 1 min at 72 °C) and a final extension for 7 min at 72 °C. For the ITS2 rDNA region, the primer pair 3S 5′–GGTACCGGTGGATCACGTGGCTAGTG–3′ [57] and ITS2.2 5′–CCTGGTTAGTTTCTTTTCCTCCGC–3′ [11] were used. The PCR conditions were as follows: a single cycle of 3 min at 95 °C, 2 min at 45 °C, and 90 s at 72 °C, followed by 4 cycles of (45 s at 95 °C, 45 s at 50 °C, and 90 s at 72 °C), then 30 cycles of (20  s at 95 °C, 20 s at 52 °C, 90 s at 72 °C). PCR products were enzymatically purified using Exonuclease I and Shrimp Alkaline Phosphatase (New England Biolabs, Ipswich, MA, USA) and then sent out to Macrogen Europe B.V. (Amsterdam, Netherlands) for sequencing. Each amplicon was sequenced in both directions using the amplification primers. We used CodonCode Aligner version 3.7.1 software (Codon Code Corporation, Dedham, MA, USA) to edit sequences, compared them to the GenBank database content with BLAST, and deposited them in GenBank under accession numbers OQ916437OQ916457, OR140779, OR140832, OR140894OR140897, OR140909, OR507183OR507185.

Trees and distances

Phylogenetic analyses were performed using the newly generated sequences of D. varicus and those of closely related species available in GenBank (Table 2), mostly D. varicus complex and Progonus muelleri (Levinsen, 1881) complex provided by Krupenko et al. [35]. Alignments for each gene region were constructed separately in AliView [37]. The alignment was manually refined and trimmed to the shortest sequence. Nucleotide substitution models for phylogenetic analyses using the Maximum Likelihood (ML) method were selected using MEGA11 [80]. The Kimura 2-parameter model with Gamma Distributed (K2+G) model was selected for the 28S, Kimura 2-parameter (K2) model for ITS2, and Tamura-Nei model (TN93) with Gamma Distributed with Invariant sites (HKY+ G+I) for cox1. All trees were constructed in MEGA11, with 500 replications. The Neighbor-Joining (NJ) method [72] was also used for comparison in MEGA11, with 2,000 bootstraps computed for cox1, ITS2 and 28S from the same datasets. P distances [31] were computed from the same datasets with MEGA11.

Results

Molecular characterisation

The NJ and ML methods led to similar tree topologies and thus only the ML trees are shown (Figs. 24).

Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Tree inferred using the ML method based on the 28S rDNA sequence data; only bootstrap values higher than 70 are indicated. The newly generated sequences are indicated in red. Sequence of Derogenes varicus from the type-host is in bold. Lineages DV1, DV2, DV3 and Derogenes lacustris are in different colours.

A total of 800–857 bp of 28S rDNA were successfully sequenced for 11 individuals of D. varicus. The 28S dataset included 48 nucleotide sequences of derogenids. The trimmed matrix included 748 positions. The genetic divergence among the newly generated sequences was 0%. The newly generated sequences of D. varicus from S. salar from Norway and from M. merlangus from Sweden and those from G. morhua from Sweden and Norway were identical to sequences of D. varicus DV1 from G. morhua, M. scorpius, L. limanda, A. lupus, E. nawaga and C. pallasii from the White and Barents seas [35].

All newly generated sequences differed from those of D. cf. varicus DV2 from H. platessoides from the North Sea, Amauropsis islandica and Buccinum scalariforme off the coast of Russia [35] and from D. varicus from Eumicrotremus fedorovi from the North Pacific [22] by 2% (16 substitutions). The highest interspecific variation was between D. varicus DV1 and D. lacustris from Galaxias maculatus off the coast of Argentina [82], reaching 9% (68 substitutions). The divergence between D. varicus DV1 and P. muelleri 1 from M. scorpius, from L. limanda and from Triglops murrayi, and P. muelleri 2 from M. scorpius and from E. fedorovi collected off the coast of Russia [35] was 7%.

The newly generated 28S sequences of D. varicus from G. morhua, M. merlangus and S. salar collected off the coast of Sweden and Norway clustered as a well-supported clade (Fig. 2), with sequences designated as D. varicus DV1 (see [35]). This clade was well separated from the D. cf. varicus DV2 clade (from H. platessoides, Amauropsis islandica and B. scalariforme), the D. cf. varicus DV3 clade (from E. fedorovi) and the D. lacustris clade (from G. maculatus). Sequences of D. varicus sensu stricto from the type-host S. salar from Norway clustered within the D. varicus DV1 clade, without any host-related structuring, and we refer to the DV1 clade of Krupenko et al. [35] as “D. varicus sensu stricto”. Another clade with high support included P. muelleri 1 (from M. scorpius, from L. limanda and from T. murrayi) and P. muelleri 2 (from M. scorpius and from E. fedorovi). The sub-clades relating to P. muelleri 1 and P. muelleri 2 were not well supported.

A total of 434–562 bp of ITS2 were successfully sequenced for the same 10 individuals of D. varicus as for 28S. The ITS2 tree was constructed using 35 sequences of derogenids (Fig. 3). The trimmed matrix included 429 positions. The newly generated ITS2 sequences of D. varicus from M. merlangus and from G. morhua from Scandinavian waters and those of D. varicus DV1 from the previously mentioned hosts were identical. Sequences of D. varicus DV1 differed from D. cf. varicus DV2 from the gastropods Amauropsis islandica, B. scalariforme and Euspira pallida off the coast of Russia [35] by 4%.

Thumbnail: Figure 3 Refer to the following caption and surrounding text. Figure 3

Tree inferred using the ML method based on the ITS2 rDNA sequence data; only bootstrap values higher than 70 are indicated. Derogenes varicus lineages DV1, DV2 are in different colours.

The newly generated ITS2 sequences of D. varicus from M. merlangus and from G. morhua from Scandinavian waters and D. varicus DV1 from the previously mentioned hosts clustered within a well-supported clade, separated from the D. cf. varicus DV2 clade. Within the P. muelleri clade collected off the coast of Russia [35], P. muelleri 1 subclade (from M. scorpius, from L. limanda and from T. murrayi) was well supported relative to the P. muelleri 2 subclade (from M. scorpius).

The cox1 sequences of D. varicus were aligned with 24 other derogenid sequences, all relating to the genera Derogenes and Progonus. The trimmed matrix included 781 positions. The divergence between the newly generated sequences was 0–1% (1 substitution). Sequences of D. varicus from M. merlangus and from G. morhua from Scandinavian waters differ from those of D. varicus DV1 from G. morhua, M. scorpius, L. limanda, A. lupus, E. nawaga and C. pallasii off the coast of Russia [35] also by 0–1% (1 substitution). The divergence between D. varicus DV1 and sequences of D. cf. varicus DV2 (from E. pallida off the coast of Russia [35]) and from D. lacustris (from G. maculatus, P. trucha, S. fontinalis and from O. mykiss, off the coast of Argentina [82]) were 15–16% (131 substitutions) and 19% (145 substitutions), respectively. Divergence between D. varicus DV1 and P. muelleri from M. scorpius from off the coast of Russia [35] ranged between 18% and 21%.

All newly generated cox1 sequences of D. varicus clustered with those of D. varicus DV1 within a well-supported clade (Fig. 4), well separated from that of D. cf. varicus DV2 and from the D. lacustris clade. Another clade with strong support included two sequences of P. muelleri from M. scorpius which nested as sister clade to the Derogenes clade.

Thumbnail: Figure 4 Refer to the following caption and surrounding text. Figure 4

Tree inferred using the ML method based on the cox1 gene sequences; only bootstrap values higher than 70 are indicated. The newly generated sequences are indicated in red. Lineages DV1, DV2 Derogenes lacustris Tsuchida, Flores, Viozzi, Rauque & Urabe, 2021 are in different colours.

Morphology

Family Derogenidae Nicoll 1910

Subfamily Derogeninae Nicoll 1910

Genus Derogenes Lühe 1900

Derogenes varicus (Müller, 1784) sensu stricto (Figs. 58)

Thumbnail: Figure 5 Refer to the following caption and surrounding text. Figure 5

Derogenes varicus (Müller, 1784) sensu stricto ex Gadus morhua (SMNH 218681), Hologenophore. A, Body. B, Egg. C, Terminal genitalia.

Thumbnail: Figure 6 Refer to the following caption and surrounding text. Figure 6

Derogenes varicus (Müller, 1784) sensu stricto ex Salmo salar (SMNH 218683, SMNH 218684). A, Whole body (SMNH 218683). B, Terminal genitalia (SMNH 218683). C, Posterior part showing excretory vesicle (SMNH 218684).

Thumbnail: Figure 7 Refer to the following caption and surrounding text. Figure 7

Derogenes varicus (Müller, 1784) sensu stricto ex Merlangius merlangus. A, Whole body (SMNH 218721). B, Terminal genitalia (SMNH 218721). C, Whole body of a flattened specimen (SMNH 218722). D, Terminal genitalia of a flattened specimen (SMNH 218722). E, Whole body (SMNH 218723).

Thumbnail: Figure 8 Refer to the following caption and surrounding text. Figure 8

Derogenes varicus (Müller, 1784) sensu stricto from different hosts. A, Whole body ex Myoxocephalus scorpius (SMNH-114553). B, Whole body ex Gadus morhua (SMNH-1145522). C, Whole body ex Limanda limanda (SMNH-1145511).

Type-host: Salmo salar (Salmoniformes: Salmonidae), the Atlantic salmon [58].

Type-locality: off the coast of Denmark, Northeast Atlantic [58].

Site in host: Stomach.

Additional hosts (only those confirmed by DNA barcodes): Anarhichas lupus (Anarhichadidae), Atlantic wolffish; Clupea pallasii (Clupeidae), Pacific herring [35]; Myoxocephalus scorpius (Cottidae), shorthorn sculpin [35] (present study); Triglops murrayi (Cottidae), moustache sculpin; Eleginus nawaga (Gadidae), navaga [35]; Gadus morhua (Gadidae), Atlantic cod; Limanda limanda (Pleuronectidae), common dab [35] (present study). For invertebrate hosts see Krupenko et al. [35].

Additional localities: Kristineberg, Sweden, Northeast Atlantic (present paper, specimens found in T. Odhner’s collections in the SMNH). Skagerrak, Kattegat, Sweden, Northeast Atlantic, present paper. Bremanger, Norway, Northeast Atlantic, present paper. Svalbard, Norway, Arctic Ocean, present paper. Keret Archipelago; Velikaya Salma Strait, White Sea and Dalniye Zelentsy, Barents Sea [35].

Specimens deposited: Specimens with molecular information: anterior parts of specimens mounted on slide, posterior part used for molecular analysis: specimens from Merlangius merlangus off the coast of Sweden; SMNH 208354-208359. Specimens from Gadus morhua off the coast of Sweden; SMNH 218680. Specimens from Gadus morhua off the coast of Norway; SMNH 218679, SMNH 218681, SMNH 218682.

Specimens examined for morphological study, whole mounts: D. varicus from Salmo salar from Bremanger, Norway, North Atlantic (SMNH 218683-218700); D. varicus from Gadus morhua from Norway, Arctic Ocean (SMNH 218701-218708) and from Sweden, North Atlantic (SMNH 218709-218720); D. varicus from merlangius merlangus from Norway, from Sweden, North Atlantic (SMNH 218721-218734).

Material examined for comparison: Derogenes varicus: 1 specimen of D. varicus from L. limanda (SMNH-114551), 2 specimens of D. varicus from G. morhua (SMNH-114552), 2 specimens of D. varicus from M. scorpius (SMNH-114553), from Kristineberg, Sweden, Northeast Atlantic; from the collection of T. Odhner deposited in the Invertebrates collection in the SMNH.

Description

Based on 23 specimens. Measurements in Table 3. Body elongate, sausage-shaped, with maximum width occurring at level of ventral sucker. Anterior extremity rounded; posterior extremity slightly pointed. Tegument smooth, uniformly thick.

Pre-oral lobe short, surmounting oral sucker. Oral sucker rounded. Prepharynx absent. Pharynx small, muscular, sub-globular to stocky. Oesophagus short. Intestinal bifurcation in anterior third of forebody. Intestinal caeca terminating blindly posteriorly to vitelline masses. Ventral sucker round, voluminous, generally as long as wide, located at level of mid-body.

Testes globular, symmetrical to slightly oblique, immediately posterior to ventral sucker. Seminal vesicle oval, muscular and thin-walled, located usually anterior to ventral sucker with position affected by state of contraction of specimens. Pars prostatica relatively long, difficult to trace in unflattened specimens, lined by numerous gland cells, leading to seminal vesicle. Sinus-sac small, oval. Ejaculatory duct and metraterm visible passing into sinus-sac then into sinus-organ forming hermaphroditic duct. Hermaphroditic duct tubular thin-walled. Sinus-sac present. Cone-shaped permanent muscular sinus-organ projecting into genital atrium. Genital pore transversely oval, ventral, posterior to pharynx.

Ovary oval, posterior to ventral sucker, generally overlapping right testis or/and right vitelline mass. Laurer’s canal not observed. Vitelline masses oval, paired, posterior to ventral sucker, situated on each side of body, symmetrical to oblique. Vitelline ducts joined medially posteriorly to ovary, forming thick common duct. Seminal receptacle oval, small. Uterus convoluted, with coils extending posteriorly between vitelline masses, passing dorsally to ventral sucker, barely visible as straight thin-walled tube, entering sinus-sac forming metraterm. Eggs elongate, oval. Excretory vesicle Y-shaped, bifurcating just behind vitelline masses; branches reuniting dorsally to pharynx.

Remarks: We found specimens in T. Odhner’s collections from G. morhua, L. limanda and M. scorpius that we re-examined. We attempted to detect any host-induced variations. Morphometric data are presented in Table 3. T. Odhner’s specimens from these three hosts share with our specimens of D. varicus the sausage-shaped body appearance and the organisation of the terminal genitalia. They differed by body length, forebody and hindbody length, ventral sucker size and size of the seminal vesicle. However, the number of measured specimens is low (one from L. limanda, 2 from M. scorpius, and 2 from G. morhua). In addition, from our examination, it is clear that T. Odhner flattened his specimens, which impairs morphometric comparison [12, 25]. However, we think it is likely that specimens collected by T. Odhner from L. limanda, M. scorpius, and G. morhua from Kristineberg are conspecific with our newly collected material from the Swedish coast of Skagerrak and off the coast of Norway, given the general morphological similarities and collection localities.

Derogenes ruber Lühe, 1900 (Figs. 912)

Thumbnail: Figure 9 Refer to the following caption and surrounding text. Figure 9

Derogenes ruber Lühe, 1900 ex Chelidonichthys lastoviza. Unpublished line drawing by A. Looss.

Thumbnail: Figure 10 Refer to the following caption and surrounding text. Figure 10

Derogenes ruber Lühe, 1900 ex Chelidonichthys lastoviza (SMNH-138743). A, Whole body. B, Terminal genitalia.

Thumbnail: Figure 11 Refer to the following caption and surrounding text. Figure 11

Derogenes ruber Lühe, 1900 ex Scorpaena scrofa. Unpublished line drawings by A. Looss.

Thumbnail: Figure 12 Refer to the following caption and surrounding text. Figure 12

Derogenes ruber Lühe, 1900 ex Scorpaena scrofa based on A. Looss’s unpublished line drawings. A, Whole body, ventral view. B, Whole body, lateral view. C, Whole body, ventral view. D, Whole body, lateral view.

Type-host: Chelidonichthys lastoviza (Bonnaterre) (Perciformes: Triglidae) (as Trigla lineata Gmelin), the Streaked gurnard [47].

Type-locality: Rovinj, Croatia, Adriatic Sea, Central Mediterranean [47].

Site in type-host: Gall-bladder [47].

Other records:

Hosts: Trigla lyra (Perciformes: Triglidae), Piper gurnard [74].

Localities: Split, Croatia, Adriatic Sea, Central Mediterranean [74]. Azores, Canary and Cape Verde Isles [30] and Spain [10], Northeast Atlantic. Trieste, Italy, Western Mediterranean (present paper).

Site in host: Intestine (present paper).

Material examined: one slide (SMNH-138743) containing two adult specimens (originally numbered by A. Looss as 1818) of which one matches an unpublished line drawing of D. ruber (Fig. 9) found in A. Looss’s archive, collected from C. lastoviza on 12. 1900 in Trieste, Italy, Western Mediterranean (corresponding measurements of this specimen presented in Table 4) and four unpublished line drawings of D. ruber from Scorpaena scrofa Linnaeus (Fig. 11).

Measurements in Table 4. Body fusiform, voluminous. Posterior end blunt (Fig. 10A). Pre-oral lobe distinct. Oral sucker subterminal, subglobular. Prepharynx absent. Pharynx subglobular. Oesophagus short (Fig. 9). Intestinal bifurcation in anterior third of forebody. Caeca sinuous, difficult to trace in some body parts; blind termination of caeca clearly visible at posterior end. Ventral sucker voluminous, subglobular.

Testes small, symmetrical, in anterior hindbody. Seminal vesicle saccular, thin-walled. Pars prostatica tubular, lined by scattered prostatic glands. Sinus-organ muscular, conical, projecting into genital atrium (Fig. 10B). Sinus-sac muscular. Metraterm protruding along with ejaculatory duct into sinus-sac forming hermaphroditic duct. Genital pore posterior to pharynx (Figs. 11 and 12).

Ovary post-testicular, in anterior half of hindbody, situated at considerable distance behind ventral sucker, obscured by eggs. Uterine coils tightly packed with eggs, reaching posterior body end, distributed along entire hindbody; in forebody, uterine coils starting from anterior level of ventral sucker to short distance behind terminal genitalia. Metraterm muscular, joining male ejaculatory duct. Vitelline masses postovarian, paired, lobed. Eggs numerous, mostly collapsed in hindbody. Excretory vesicle not observed due to coiling of body posteriorly. Excretory arms visible in forebody; position of bifurcation of excretory arms not observed.

Remark: Derogenes ruber Lühe, 1900, the type-species of the genus, was first described from the tub gurnard Ch. lastoviza off the coast of Split, Croatia [47]. Being known only by the original description that lacked illustrations, we here provide a figure and additional information especially regarding the organisation of the terminal genitalia, based on two specimens found in Looss’s collection from the same host from off Trieste, Italy. Looss’s archive also included four drawings of D. ruber from Scorpaena scrofa Linnaeus (Fig. 11) that we present in Figure 12. The corresponding slides could not be found in Looss’s collection.

Derogenes minor Looss, 1901 (Figs. 1314)

Thumbnail: Figure 13 Refer to the following caption and surrounding text. Figure 13

Derogenes minor Looss, 1901 ex Labrus merula. Original line drawing of D. minor published as Figure 5 in Looss (1901), and an unpublished line drawing of the terminal genitalia.

Thumbnail: Figure 14 Refer to the following caption and surrounding text. Figure 14

Derogenes minor Looss, 1901 ex Labrus merula and Derogenes cf. minor ex Lophius budegassa. A, Derogenes minor Looss, 1901 ex L. merula, Whole body, Lectotype (SMNH-138741). B, Derogenes minor Looss, 1901 ex L. merula, Terminal genitalia, Lectotype (SMNH-138741). C, Derogenes minor Looss, 1901 ex L. merula based on an unpublished line drawing by A. Looss. D, Derogenes cf. minor ex Lophius budegassa, Whole body (SMNH-138742).

Type-host: Labrus merula (Perciformes: Labridae), brown wrasse [45].

Type-locality: off Trieste, Italy, Western Mediterranean [45].

Site in type-host: Stomach [45].

Material examined: one slide containing two adult specimens designated as Lectotype (SMNH-138741). Additional material, specimens from Labrus merula preserved in ethanol, SMNH 892 currently in the wet collections of the SMNH, designated as Paralectotypes.

Material examined for comparison: Two specimens of D. cf. minor from the intestine of Lophius piscatorius Linnaeus, from Trieste, Italy, Central Mediterranean (SMNH-138742, SMNH-208362).

Archival documents: The archives include the original line drawing published as Figure 5 by Looss (1901), and an unpublished ink drawing of the eggs and of the terminal genitalia (see Fig. 13 here).

Measurements in Table 4. Body small, fusiform. Anterior end rounded, posterior end narrow and blunt (Fig. 14A). Pre-oral lobe short. Oral sucker subterminal, rounded. Prepharynx not observed. Pharynx muscular. Oesophagus short (Fig. 13). Intestinal bifurcation in anterior third of forebody, anterior to terminal genitalia. Intestinal caeca broad, convoluted, extending to posterior end, ending blindly close to posterior end of body. Ventral sucker muscular, rounded, voluminous.

Testes oval, near left and right margins of body posterior to ventral sucker. Seminal vesicle tubular, placed at short distance anteriorly to ventral sucker. Seminal vesicle followed by long pars prostatica, lined by small unicellular prostatic glands. Ejaculatory duct and metraterm visible passing into sinus-sac and forming hermaphroditic duct. Hermaphroditic duct thin, enclosed in sinus-organ, projecting into genital atrium (Figs. 14B and 14C). Genital pore opening medially, posteriorly to pharynx.

Ovary in hindbody, sinistral, close to body margin, slightly larger than testes. Seminal receptacle long, tubular, thin-walled, immediately anterior to vitelline masses. Laurer’s canal not observed. Vitelline masses postovarian, paired, compact, separated from one another. Excretory bladder Y-shaped: arms of excretory bladder reaching midlevel of pharynx. Eggs oval, thin shelled.

Remark: Derogenes minor is currently considered a valid species (WoRMS, 2022). The redescription here was based upon one slide (SMNH-138741) containing two adult specimens of which one matches the original description and illustration given by Looss (1901) (see his Fig. 5). Additionally, the sketching of D. minor found in A. Looss’s archive (see Fig. 13 here) matches the figure given in the original description as collected on 27.09.1900 off the coast of Trieste, Italy. This slide is thus designated as the Lectotype. Additional material, specimens from Labrus merula preserved in ethanol (SMNH 892) currently in the wet collections of the SMNH, are designated as Paralectotypes. Additional specimens include one specimen labelled as D. minor by A. Looss, from the Intestine of Lophius piscatorius Linnaeus, collected on 12.1900 off Trieste, Italy (SMNH-138742); one specimen labelled as Derogenes sp. by A. Looss, from the Intestine of Lophius piscatorius Linnaeus, collected on 10.1904 off Trieste, Italy (SMNH-208362) is designated here as D. cf. minor (Fig. 14D).

Discussion

Delimitation of D. varicus sensu stricto

Derogenes varicus has been considered the most common digenean species in fish [32]. It is widely reported in most of the oceans of the world as well as in freshwater systems. In the Northeast Atlantic, it has been recorded from more than 40 species of marine fish [49]. There are also some freshwater records, mainly in migratory diadromous fishes, such as salmonids [20]. The life cycle was described in detail by Køie [32]; naticid snails are the first intermediate hosts, releasing cystophorous cercariae that can infect calanoid copepod, among which only Calanus spp. may act as second intermediate hosts. In definitive hosts, the adults are usually found in the oesophagus or stomach.

Several authors have suggested that D. varicus comprises two or more species and Køie [34] suggested that D. varicus from the northeast Atlantic should be referred to as D. varicus sensu lato or as Derogenes sp. A recent comprehensive study by Krupenko et al. [35] provided evidence that D. varicus can be genetically split. Four genetic groups were recognised, independent of locality or host to a certain extent: D. varicus DV1 occurring in G. morhua, M. scorpius, L. limanda, A. lupus, E. nawaga and the Pacific herring C. pallasii, D. cf. varicus DV2 from H. platessoides, D. cf. varicus DV3 from E. fedorovi Mandrytsa, 1991, and D. cf. varicus DV4 from H. platessoides (based on 18S sequences). Herein, all the newly generated 28S sequences of D. varicus from fishes collected off the coast of Sweden and Norway, including that from a specimen from the type-host S. salar were identical, and clustered within the D. varicus DV1 clade. Although the type-locality of D. varicus is Danish marine waters, our collections off the coast of Sweden essentially encompass this area. Additionally, Müller [58] did not specify a locality from which he collected the salmon infected by “Fasciola varica”. He mostly worked in Øresund in Denmark and in Drøbak in the Oslofjord, Norway. It seems most likely that the studied salmon originated from the Øresund salmon fishery. Thus, we consider the clade identified as D. varicus DV1 by Krupenko et al. [35] to represent the true D. varicus, herein designating it as “D. varicus sensu stricto”.

Our D. varicus sensu stricto specimens from M. merlangus were morphologically similar to that of D. varicus sensu lato from L. limanda, G. morhua and M. scorpius from T. Odhner’s collection, which supports the presence of a single species in the D. varicus DV1 lineage. More importantly, the intraspecific genetic variations between members of the D. varicus DV1 (i.e., from different host species) were of an order of magnitude lower than the interspecific divergence between members of D. varicus DV1 and the well established species D. lacustris: 0% vs. 8–9% (68 substitutions) in 28S, 0–1% vs. 19% in cox1. The divergence of cox1 reported herein for D. varicus sensu stricto agrees with intraspecific variations, which are typically below 6.0% in Digenea [82] and the genotypes were independent of host species or localities. Among Derogenidae, previously reported interspecific divergences in cox1 ranged between 10.5–15.1% [83] and 16.9–20.4% [83], while in other lineages divergence reached 8.9–26.5% [6]; 9.6–12.8% [4]; 9.9–15.1 [44]; and 20% [26]. Hence, divergences reported within the DV1 clade appear consistent with intraspecific divergences. Consequently, we consider the lineages DV2, DV3 and DV4 to represent different species. In light of the available data, D. varicus sensu stricto (DV1) is euryxenous. Hence, this work is a step towards untangling this species complex and delimiting the cryptic complex hidden under the single name “D. varicus”.

We compared our D. varicus sensu stricto from S. salar, M. merlangus and from G. morhua from Sweden and Norway, with specimens from T. Odhner’s collection (Table 3). However, T. Odhner’s specimens were excessively flattened and thus to consider any differences as intraspecific variations is unreliable. Additionally, they had similar morphology and anatomy (Figs. 7 and 8). Derogenes varicus from M. merlangus and from G. morhua from Scandinavian waters are genetically identical to D. varicus sensu stricto from various hosts (see [35]). They were also morphologically similar as measurements overlapped (Table 3). Additionally, they showed no divergence in 28S or ITS2 sequences and differed only by 0–1% in the cox1 gene region.

Problems arise with species identification within the D. varicus complex because several species of Derogenes, including the type-species, were described only superficially [47], and data on taxonomically important characters of the “true” D. varicus were incomplete. The original description of D. varicus does not allow consideration of several important morphological characteristics such as the extent of the intestinal caeca, position of the genital pore, relative position of the ovary and testes, and several other features, some of which are now used to distinguish Derogenes species. Consequently, the redescriptions and delimitation of D. varicus sensu stricto given herein are crucial for untangling the species complex in the future to describe and discriminate the cryptic species detected in D. varicus sensu lato.

Other species within Derogenes

The type-species of the genus, D. ruber Lühe, 1900, was first described from the gall bladder of the streaked gurnard Ch. lastoviza (as the syn. Trigla lineata) from off the coast of Roving, Croatia, Adriatic Sea [47]. It was redescribed from the piper gurnard Trigla lyra from off the coast of Split, also Croatia [74]. We noted some minor morphometrical differences between the two Adriatic records: Derogenes ruber from T. lyra differed from D. ruber from the type-host Ch. lastoviza by having a smaller body (4200–4500 × 1300–1800 vs. 5000–6000), smaller ventral sucker (950–1290 vs. 750), smaller pharynx (168 vs. 200) and ovary (252 vs. 450). However, the number of measured specimens is low (2 specimen were measured in both studies) [47, 74]. Similarly, specimens of D. ruber from Ch. Lastoviza from Italy examined herein differed slightly from those from the same host, from the type locality Croatia, by having a larger body (7869 × 1847 vs. 5000–6000 × 2000), larger oral sucker (655 × 708 vs. 505) and larger pharynx (200 vs. 168). We also note that despite sharing the same host, Ch. lastoviza, D. ruber of Lühe [47] were collected from the gall-bladder while the two specimens examined here were collected from the intestine. We do not know if this is a post-mortem migration of D. ruber as the gall-bladder and the intestine (and also pyloric caeca) were regarded as unusual sites for derogenids, which are normally stomach parasites [2]. Additionally, D. ruber from T. lyra reported by Sey [74] and from the present specimens by having strikingly smaller eggs (23 × 23). However, Bartoli and Gibson [2] pointed that this egg-size value is presumably an error.

A species very similar to D. ruber is D. latus Janiszewska, 1953, first described based on a single specimen from the intestine of the red mullet Mullus barbatus from the same Adriatic locality as that of D. ruber, off Split, Croatia [27].

Derogenes latus was redescribed from the intestine of M. barbatus and Trisopterus capelanus (Lacépède, 1800) in the North Adriatic Sea [64] and from the gall-bladder of M. surmuletus off Corsica (France), Western Mediterranean [2]. The redescription provided by Bartoli and Gibson [2] based on accessible voucher material and serial sections provided several morphological and anatomical details along with morphometrical data. Derogenes latus was frequently reported from its type host from the Western Mediterranean, off Spain [16] and off France [38], and from a closely related host, M. surmuletus from the Western Mediterranean (off France and Algeria [7, 23, 38, 81]).

It was also reported on hosts other than Mullidae, mainly from S. scrofa (Scorpaenidae) from the Western Mediterranean, off Spain [46] and off France [81]; from L. mormyrus (Sparidae) off Montenegro, Adriatic Sea [68] and off Algeria, Western Mediterranean [5]. It was furthermore recounted from Sardinella aurita Valenciennes. (Dorosomatidae) off Algeria, Western Mediterranean [69] and from Phycis phycis (Linnaeus) (Phycidae) from the Western Mediterranean (off France) [81]. Derogenes latus was also reported in a Triglidae, Chelidonichthys cuculus (Linnaeus, 1758) [61]. However, triglids are commonly considered hosts of D. ruber [2].

Curiously, we found in Looss’s archive unpublished lined drawings of derogenids identified as D. ruber, from S. scrofa, mentioned also as a host for D. latus [46] and off France [81]. We could not find the slides used to make these illustrations. Despite having different hosts, C. lastoviza for D. ruber [47] and M. barbatus for D. latus [27], the distinction between D. ruber and D. latus has been questioned [2]. Derogenes ruber and D. latus share a stout body, post-testicular vitellarium composed of two multilobed masses and a uterus occupying almost the entire body [2, 64, 68]. We have confirmed these features in specimens from A. Looss’s collections, and illustrations of Derogenes ruber and D. latus clearly share the previously mentioned anatomical features.

Although recent studies have used molecular sequence data to test the putative broad host specificity of some species of Derogenes and both D. lacustris [82] and D. varicus sensu stricto have been shown to occur across a wide variety of hosts (see Figs. 24), as mentioned above, even if D. ruber is known only from its type host, a Triglidae (Perciformes), the closely related species D. latus was reported from 6 species, belonging to 5 families (Mullidae, Scorpaenidae, Sparidae, Dorosomatidae, and Phycidae) across 5 orders (Mulliformes, Scorpaeniformes, Spariformes, Clupeiformes, and Gadiformes) and consequently, synonymising the two species without supporting molecular data will make D. ruber a euryxenous species occurring in hosts across 7 families and across 6 orders. Such a nomenclature act without supporting molecular data might lead to making D. latus the Mediterranean version of “D. varicus”. Although Bartoli and Gibson [2] highlighted marked morphological similarity between D. latus and D. ruber and convincedly argued about possible synonymy between the two species, they refrained from synonymising the two species formally until further studies of material from the type-hosts and localities are available. Molecular data of D. ruber have recently been made available [18], but we refrain from synonymising the two species until molecular data are available for D. latus.

Hence, in light of available data, we can only affirm that D. ruber and D. latus Janiszewska, 1953 are very similar, apparently differing only in the degree of lobation in the vitelline masses. They do differ in principal host and site and taking into consideration the potential synonymy between the two species suggested (Bartoli and Gibson [2]), molecular studies on new material are needed to clarify this issue. Additionally, we could unfortunately not examine any D. latus and thus the validity of this species cannot presently be further considered.

Derogenes minor, currently a valid species [21], was first described from the brown wrasse Labrus merula (Labridae) from off the coast of Trieste, Italy [45]. Although some ambiguity surrounded the collections of A. Looss after leaving Egypt at the beginning of World War I, part of his collections was sold to Dr. Theodor Odhner, a former Professor at the Department of Invertebrate Zoology at the Museum of Natural History (Naturhistoriska riksmuseet) in Stockholm by his widow [36, 62]. The archive of the SMNH includes a list of material of A. Looss, including hosts, locality, date, publication-ready ink drawings and unpublished line drawings. The specimens of D. minor we found in A. Looss’s collection agree with the original description and one of the two specimens examined matches the line drawing found in the archive of A. Looss and the drawing published as Figure 5 by Looss (1901). Hence, this is clearly the type-material of D. minor. We here supplement the original description [45] by providing additional morphometrical data and with a description of the organisation of the terminal genitalia based on re-examination of type specimen.

In A. Looss’s collection, we also found two putative specimens of D. minor from the intestine of the angler, Lophius piscatorius, caught off the coast of Trieste, Italy. One of them lacking the posterior part is labeled as D. minor and the second one is entire and labelled by A. Looss as Derogenes sp. (Fig. 14D). Measurements of D. minor from L. piscatorius and those we examined from L. merula overlapped. The specimen labelled as Derogenes sp. from L. piscatorius differed slightly from D. minor from the type-host L. merula by having a larger body and larger vitelline masses. They shared, however, the lobed vitelline masses, specifically the mulberry-like shape, a characteristic of D. minor [45]. This situation is puzzling as L. piscatorius was reported as a host of D. latus Janiszewska, 1953 [2, 3]. However, D. latus and D. minor are supposed to be distinguished partially by the shape of the vitelline masses, being mulberry-like in D. minor [45] vs. deeply lobed or lobed in D. latus [27]. The vitelline masses of the specimen we examined from L. piscatorius (Fig. 14D) appear intermediate between the previously mentioned shapes; it appears mulberry-like with deep lobes but resembles D. minor in its narrow hindbody. Hence, as we examined only one specimen, on which unfortunately the terminal genitalia could not be observed, we identify the derogenids examined from L. piscatorius as D. cf. minor pending further study.

A diagram comparing four species of Derogenes (Fig. 15) suggests that the organisation and shape of vitelline masses is the most straightforward character to distinguish Derogenes species. In D. varicus sensu stricto, the vitelline masses are unlobed (Fig. 15A). In D. ruber, the vitelline masses are lobed and rosette shaped (Fig. 15B). In D. minor, the vitelline masses are mulberry-like shaped (Fig. 15C). In D. latus, the vitelline masses are deeply lobed, and rosette shaped (Fig. 15D). We also attempted to test the utility of the terminal genitalia, and in D. varicus sensu stricto, the sinus-sac is rounded (Fig. 15A) and the genital atrium is almost half the length of the sinus-sac, and the basal musculature of the sinus-sac does not reach the level of the genital atrium. In D. ruber, the sinus-sac is ovoid and elongated transversally (Fig. 15B), and the genital atrium is two-thirds of the length of the sinus-sac, and the musculature is weakly developed and extends only to the base of the genital atrium. In D. minor, the sinus-sac is rounded (Fig. 15C), and the genital atrium is small, only about one third the length of the sinus-sac and the musculature covers the genital atrium. However, the three species share a conical sinus-organ and most importantly, the previously mentioned differences are high, likely affected by the wall musculature contraction, and should be taken with caution when distinguishing species. Unfortunately, we could not examine specimens of D. latus to comment further on the form of the terminal genitalia. Hence, it would be valuable to investigate these features, especially the form and size of the sinus-organ, to test their utility in species delimitation. Although the striking morphological similarities between D. latus, D. ruber and D. minor suggests possible synonymy between the three [2], especially with respect to the large host spectrum for D. varicus supported here with molecular data, we refrain from making any taxonomic proposals regarding the Mediterranean specimens as molecular data are lacking and we consider them valid species pending further studies. The following species have previously been synonymised with D. varicus: Anisocoelium hippoglossi MacCallum, 1921, D. fuhrmanni Mola, 1912 and D. parvus Szidat, 1950 [85]. Anisocoelium hippoglossi MacCallum, 1921, described from the Atlantic halibut Hippoglossus hippoglossus (Linnaeus, 1758) collected off the coast of Massachusetts, USA exhibits unique characters relative to D. varicus sensu stricto, with the ovary a considerable distance in front of the ventral sucker [48]. If these features were correctly characterised, then A. hippoglossi MacCallum, 1921 is not a synonym of D. varicus sensu lato nor even a species of Derogenes. Since the species appears to never have been recollected, it could be that the seminal vesicle of a derogenid was taken for the ovary, or that the specimen was teratological. Derogenes fuhrmanni Mola, 1912, was first described from the European bullhead Cottus gobio Linnaeus from River Aniene, in Lazio, Italy and additional specimens brought from Rome as Mola stated “In etwa 30 Exemplaren von Cottus gobio, wovon einige aus dem Flusse Aniene stammten und andere von mir in Rom” [56]. It was subsequently synonymised with D. varicus [67]. In addition to the hosts being different (Cottus gobio, Cottidae for D. fuhrmanni vs. Salmo salar, Salmonidae for D. varicus) and especially the localities being widely separated (River Aniene, Italy for D. fuhrmanni vs. Denmark for D. varicus), Derogenes fuhrmanni also differs from D. varicus by having a larger body (4000 × 1000 vs. 2276 × 528), larger ventral sucker (600 vs. 353 × 374), and strikingly larger eggs (72 × 27 vs. 40–53 × 28–35). We consider thus D. fuhrmanni as a valid species. We also examined the original description of D. parvus first described from the Patagonian blennie Eleginops maclovinus (Cuvier, 1830) off the coast of Tierra del Fuego, southeastern Atlantic [79]. It can be distinguished from D. varicus sensu stricto by the testes, the ovary, and the globular parts of the vitelline masses being all the same size, and by having a much larger ventral sucker (697 vs. 300 × 299). The most distinctive feature distinguishing D. parvus and D. varicus sensu stricto is the vitelline masses being divided into numerous small lobes in D. parvus [79]. The possession of lobed vitelline masses might suggest possible synonymy with D. minor or with D. latus and D. ruber. However, Szidat (1950) stated that the vitelline masses are far smaller in D. parvus than those described by Looss in D. minor [79]. We therefore consider D. parvus a distinct and valid species.

Thumbnail: Figure 15 Refer to the following caption and surrounding text. Figure 15

Diagram showing the similarities and differences between some Derogenes species. A, Derogenes varicus (Müller, 1784) sensu stricto (SMNH-9563). B, Derogenes ruber Lühe, 1900 (SMNH-138743). C, Derogenes minor Looss, 1901 (SMNH-138741). D, Derogenes latus Janiszewska, 1953.

Conflict of interest

Authors have no potential conflict of interest.

Acknowledgments

We are grateful to all the participants of the HHUMTL22 cruise, the crew of the R/V “Helmer Hanssen” and all the participants of the International Bottom Trawl Survey cruises, and to the crew of the R/V “Svea” for their assistance with sampling. We are grateful to all the staff of the Kristineberg Center for Marine Research and Innovation for their assistance. We also thank Gerardo Perez-Ponce de Leon from Escuela Nacional de Estudios Superiores unidad Mérida, Mexico and Samuel Abalde from the Swedish Museum of Natural History, Sweden for discussing the earlier drafts of the molecular analysis.‬‬‬‬‬‬‬‬‬ Philipp Schiffer from the University of Cologne, Germany and Lyliane Schiffer are gratefully acknowledged for their assistance with logistics.‬‬‬‬‬‬‬‬ We thank David Gibson from the Natural History Museum, Life Sciences, United Kingdom, Karin Tsuchida from The University of Shiga Prefecture, Japan, Verónica Flores from Laboratorio de Parasitología, INIBIOMA (CONICET–Univ. Nac.del Comahue), Argentina and Darya Krupenko from Saint Petersburg University, Russia for kindly helping with the literature.‬‬‬‬‬‬‬‬‬‬ This research was funded by the Swedish Taxonomy Initiative, Artdatabanken, Swedish University of Agricultural Sciences within the scope of the project “Taxonomy and systematics of digenetic trematodes parasitising fishes of Sweden” (dha 2019.4.3-48). Specimens from the Arctic Ocean were collected during the HHUMTL22 cruise organised and partly funded by the Arctic University Museum of Norway.‬‬‬‬‬‬‬‬‬‬‬‬‬‬‬‬

References

  1. Amel TBN. 2009. Investigation sur les parasites du rouget de roche Mullus surmuletus (Linné, 1758) dans le littoral Algérien. Université d’Oran1-Ahmed Ben Bella. [Google Scholar]
  2. Bartoli P, Gibson DI. 1991. On Podocotyle scorpaenae, Poracanthium furcatum and Derogenes latus, three poorly known digenean parasites of western Mediterranean teleosts. Systematic Parasitology, 20(1), 29–46. [CrossRef] [Google Scholar]
  3. Bartoli P, Gibson DI, Bray RA. 2005. Digenean species diversity in teleost fish from a nature reserve off Corsica, France (Western Mediterranean), and a comparison with other Mediterranean regions. Journal of Natural History, 39, 47–70. [Google Scholar]
  4. Bell A, Sommerville C, Valtonen ET. 2001. A molecular phylogeny of the genus Ichthyocotylurus (Digenea, Strigeidae). International Journal for Parasitology, 31(8), 833–842. [CrossRef] [PubMed] [Google Scholar]
  5. Bellal A, Amel N, Tazi B, Charane M, Hadjou Z. 2018. Gastrointestinal helminth parasites of Lithognathus mormyrus (Linnaeus,1758) (Perciformes Sparidae) in the Western Mediterranean Sea. Biodiversity Journal, 9(1), 9–18. [Google Scholar]
  6. Blair D, Agatsuma T, Watanobe T, Okamoto M, Ito A. 1997. Geographical genetic structure within the human lung fluke, Paragonimus westermani, detected from DNA sequences. Parasitology, 115(4), 411–417. [CrossRef] [PubMed] [Google Scholar]
  7. Brahim Tazi NA, Meddour A, Bayssade-Dufour C, Boutiba Z. 2009. Investigation sur les parasites digena de Mullus surmuletus Linné, 1758 dans le littoral Algérien. European Journal of Scientific Research, 25, 448–462. [Google Scholar]
  8. Bray RA. 1979. Digenea in marine fishes from the eastern seaboard of Canada. Journal of Natural History, 13, 399–431. [CrossRef] [Google Scholar]
  9. Cooper AR. 1915. Trematodes from marine and fresh-water fishes, including one species of ectoparasitic turbellarian.. Transactions of the Royal Society of Canada. Section IV, Series III, 9, 181–205. [Google Scholar]
  10. Cordero del Campillo M, Ordonez LC, Feo AR. 1994. Indice-Catalogo de Zooparasitos Ibericos’. Spain, Leon, Spain.: 5–650 Universidad de Leon (in Spanish). [Google Scholar]
  11. Cribb TH, Adlard RD, Bray RA. 1998. A DNA-based demonstration of a three-host life-cycle for the Bivesiculidae (Platyhelminthes: Digenea). International Journal for Parasitology, 28(11), 1791–1795. [CrossRef] [PubMed] [Google Scholar]
  12. Cribb TH, Bray RA. 2010. Gut wash, body soak, blender, and heat-fixation: approaches to the effective collection, fixation and preservation of trematodes of fishes. Systematic Parasitology, 76, 1–7. [CrossRef] [PubMed] [Google Scholar]
  13. Dawes B. 1947. The Trematoda of British Fishes. London.: Ray Society [Google Scholar]
  14. Dollfus RP. 1954. Métacercaire progénétique de Derogenes (Trematoda Hemiuroidea) chez un copépode parasite de poisson. Vie Milieu, 5, 565–568. [Google Scholar]
  15. Duniec H. 1980. Parasitic fauna of the grey gurnard Trigla gurnardus (L.) from Shetland Islands fishing grounds. Acta Ichthyologica et Piscatoria, 10(1), 65–77. [CrossRef] [Google Scholar]
  16. Ferrer-Maza D, Munoz M, Lloret J, Faliex E, Vila S, Sasal P. 2015. Health and reproduction of red mullet, Mullus barbatus, in the western Mediterranean Sea. Hydrobiologia, 753, 189–204. [CrossRef] [Google Scholar]
  17. García-Varela M, Nadler SA. 2005. Phylogenetic relationships of Palaeacanthocephala (Acanthocephala) inferred from SSU and LSU rDNA gene sequences. Journal of Parasitology, 91(6), 1401–1409. [CrossRef] [PubMed] [Google Scholar]
  18. Gharbi K, Bouguerche C, Ahmed M, León GP, Tazerouti F. 2023. Redescription and molecular characterisation of Derogenes ruber Lühe, 1900 (Hemiuroidea: Derogenidae, Acta Parasitologica. In press. [Google Scholar]
  19. Gibson DI. 1976. Monogenea and Digenea from fishes. Discovery Reports, 36, 179–266. [Google Scholar]
  20. Gibson DI. 1996. Guide to the parasites of Canadian fishes. Part IV. Trematoda. Ottawa.: NRC Research Press [Google Scholar]
  21. Gibson DI. Family Derogenidae Nicoll, 1910, in Keys to the Trematoda. (Vol. 1) Gibson DI, Jones A, Bray RA, Editors. CAB International and the Natural History Museum: Wallingford. p. 351–368. [Google Scholar]
  22. Gordeev II, Sokolov SG. 2020. Helminths of Fedorov’s lumpsucker Eumicrotremus fedorovi Mandrytsa, 1991 (Actinopterygii: Cyclopteridae) in the Simushir Island area (Pacific Ocean). Parasitology International, 76, 102075. [CrossRef] [PubMed] [Google Scholar]
  23. Hassani MM, Kerfouf A, Boutiba Z. 2015. Checklist of helminth parasites of striped red mullet, Mullus surmuletus (Linnaeus, 1758) (Perciformes: Mullidae), caught in the Bay of Kristel, Algeria (western Mediterranean). Check list, 11(1), 1504–1504. [Google Scholar]
  24. Heller AF. 1949. Parasites of cod and other marine fish from the Baie de Chaleur region. Canadian Journal of Research, 27, 243–264. [CrossRef] [Google Scholar]
  25. Huston DC, Cutmore SC, Cribb TH. 2019. An identity crisis in the Indo-Pacific: molecular exploration of the genus Koseiria (Digenea: Enenteridae). International journal for parasitology, 49(12), 945–961. [CrossRef] [PubMed] [Google Scholar]
  26. Huston DC, Cutmore SC, Cribb TH. 2022. Enenterum kyphosi Yamaguti, 1970 and Enenterum petrae n. sp. (Digenea: Enenteridae) from kyphosid fishes (Centrarchiformes: Kyphosidae) collected in marine waters off eastern Australia. Zootaxa, 5154(3), 271–288. [CrossRef] [PubMed] [Google Scholar]
  27. Janiszewska J. 1953. Some Adriatic Sea fish trematodes. Zoologica Poloniae, 6, 20–48. [Google Scholar]
  28. Justine J-L, Briand MJ, Bray RA. 2012. A quick and simple method, usable in the field, for collecting parasites in suitable condition for both morphological and molecular studies. Parasitology Research, 111(1), 341–351. [CrossRef] [PubMed] [Google Scholar]
  29. Kardousha MM. 2003. Redescription of ten species of digenetic trematodes from marine fishes of the Emirati Coasts of the Arabian Gulf Arab Gulf. Journal of Scientific Research, 21(4), 217–226. [Google Scholar]
  30. Kim M, Gijon-Botella H, Lopez-Roman R. 1990. The Bunocotylidae, Derogenidae, Hemiuridae and Azygiidae of marine fishes, in Proceedings of the Seventh International Congress of Parasitology, Paris August 20–24 (Vol. 8). Doby JM, Editor. Bulletin de la Sociesste Francaise de Parasitologie. p. 733. (Abstract). [Google Scholar]
  31. Kimura M. 1980. A simple method for estimating evolutionary rates of base substitutions through comparative studies of nucleotide sequences. Journal of Molecular Evolution, 16(2), 111–20. [CrossRef] [PubMed] [Google Scholar]
  32. Køie M. 1979. On the morphology and life-history of Derogenes varicus (Müller, 1784) Looss, 1901 (Trematoda, Hemiuridae). Zeitschrift für Parasitenkunde, 59, 67–78. [CrossRef] [Google Scholar]
  33. Køie M. 1984. Digenetic trematodes from Gadus morhua L. (Osteichthyes, Gadidae) from Danish and adjacent waters, with special reference to their life-histories. Ophelia, 23(2), 195–222. [CrossRef] [Google Scholar]
  34. Køie M. 2000. Metazoan parasites of teleost fishes from atlantic waters off the Faroe Islands. Ophelia, 52(1), 25–44. [CrossRef] [Google Scholar]
  35. Krupenko D, Kremnev G, Gonchar A, Uryadova A, Miroliubov A, Krapivin V, Skobkina O, Gubler A, Knyazeva O. 2022. Species complexes and life cycles of digenetic trematodes, Parasitology, 149, 1590–1606. [CrossRef] [PubMed] [Google Scholar]
  36. Kuzmina T, Holovachov O. 2023. Equine Strongylidae and other parasitic nematodes described by Arthur Looss during 1895–1911 in the collections of the Swedish Museum of Natural History. Zootaxa, 5227(2), 151–193. [CrossRef] [PubMed] [Google Scholar]
  37. Larsson A. 2014. AliView: a fast and lightweight alignment viewer and editor for large data sets. Bioinformatics, 30, 3276–3278. [CrossRef] [PubMed] [Google Scholar]
  38. Le Pommelet E, Bartoli P, Silan P. 1997. Biodiversité des digènes et autres helminthes intestinaux des Rougets: synthèse pour Mullus surmuletus (Linné, 1758) et M. barbatus (L., 1758) dans le bassin méditerranéen. Annales des Sciences Naturelles Zoologie et Biologie Animale, 18, 117–133. [Google Scholar]
  39. Lebour MV. 1908. Reports of the Scientis. Newcastle-uposn-Tyne: Cail & Sons. [Google Scholar]
  40. Lebour MV. 1917. Some parasites of Sagitta bipunctata. Journal of the Marine Biological Association of the United Kingdom, 11(2), 201–206. [CrossRef] [Google Scholar]
  41. Linton E. 1940. Trematodes from fishes mainly from the Woods Hole region, Massachusetts. Proceedings of the United States National Museum, 88(1), 69–102. [CrossRef] [Google Scholar]
  42. Little PA. 1929. The trematode parasites of Irish marine fishes. Parasitology, 21, 22–30. [CrossRef] [Google Scholar]
  43. Lloyd LC. 1938. Some digenetic trematodes from Puget Sound fish. Journal of Parasitology, 24(2), 103–133. [CrossRef] [Google Scholar]
  44. Locke SA, McLaughlin JD, Dayanandan S, Marcogliese DJ. 2010. Diversity and specificity in Diplostomum spp. metacercariae in freshwater fishes revealed by cytochrome c oxidase I and internal transcribed spacer sequences. International Journal for Parasitology, 40(3), 333–343. [CrossRef] [PubMed] [Google Scholar]
  45. Looss A. 1901. Über einige Distomen der Labriden des Triester Hafens. Centralblatt für Bakteriologie, Parasitenkunde und Infektionskrankheiten, 29, 398–405. 437–442. [Google Scholar]
  46. Lozano C, Úbeda Ontiveros JM, Rojas Álvarez Md, Ariza Astolfi C, Guevara Benítez DC. 2001. Estudio de digenidos de pèces marinos del sur de la Peninsula Iberica. Revista iberica de parasitologia, 61(3–4), 103–116. [Google Scholar]
  47. Lühe M. 1900. Über Distomen aus der Gallenblase von Mittelmeerfischen. Zoologischer Anzeiger, 23(624), 504–509. [Google Scholar]
  48. MacCallum GA. 1921. Studies in helminthology. Zoopathologica, New York, 1, 135–284. [Google Scholar]
  49. MacKenzie K. 1968. Some parasites of O-group plaice, Pleuronectes platessa Linnaeus under different environmental conditions. Marine Research, 3, 1–23. [Google Scholar]
  50. Manter HW. 1926. Some North American fish Trematodes. Illinois Biological Monographss. Urbana.: University of Illinois [Google Scholar]
  51. Manter HW. 1934. Some digenetic trematodes from deep-water fish of Tortugas, Florida. Papers from Tortugas Laboratory, 28, 257–345. [Google Scholar]
  52. Manter HW. 1940. Digenetic trematodes of fishes from the Galapagos Islands and the neighboring Pacific. Faculty Publications from the Harold W. Manter Laboratory of Parasitology. p. 657. [Google Scholar]
  53. Manter HW. 1954. Some digenetic trematodes from fishes of New Zealand. Transactions of the Royal Society of New Zealand, 82, 475–568. [Google Scholar]
  54. Meskal FH. 1967. Seasonal fluctuation in the population of two common trematode species from the stomach of the cod. Sarsia, 26(1), 13–20. [CrossRef] [Google Scholar]
  55. Miller MJ. 1941. A critical study of Stafford’s report on “Trematodes of Canadian fishes” based on his trematode collection. Canadian Journal of Research, 19, 28–52. [CrossRef] [Google Scholar]
  56. Mola P. 1912. Die parasiten des Cottus gobio Linn. beitrag zu der helminthologischen fauna der Teleostei. Centralblatt für Bakteriologie, Parasitenkunde und Infektionskrankheiten, 65, 491–504. [Google Scholar]
  57. Morgan J, Blair D. 1995. Nuclear rDNA ITS sequence variation in the trematode genus Echinostoma: an aid to establishing relationships within the 37-collar-spine group. Parasitology, 111(5), 609–615. [CrossRef] [PubMed] [Google Scholar]
  58. Müller OF. Zoologia danica seu animalium Daniae et Norvegiae rariorum ac minus notorum historia descriptiones et historia. 1784. Weygand (Vol. [two volumes] 1: 1-103 / 2: 1-124) [Google Scholar]
  59. Nicoll W. 1907. A contribution towards a knowledge of the Entozoa of British marine fishes. Part 1. Annals and Magazine of Natural History, 7 series, 19, 66–94. [CrossRef] [Google Scholar]
  60. Nicoll W. 1910. Studies on the structure and classification of the digenetic trematodes. Journal of Cell Science, 2(211), 391–488. [Google Scholar]
  61. Nikolaeva VM. 1966. Trematodes of the suborder Hemiurata infecting fish in the Mediterranean Basin. 1966. Kiev: Biologiya Morya. p. 52–66 Helminth fauna of animals of the Southern Seas (In Russian). [Google Scholar]
  62. Odhner T. 1925. Avdelningen för lägre evertebrater. Vetenskapsakademiens Årsbook, 953, 201–204. [Google Scholar]
  63. Olson PD, Cribb TH, Tkach VV, Bray RA, Littlewood DTJ. 2003. Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). International Journal for Parasitology, 33, 733–755. [CrossRef] [PubMed] [Google Scholar]
  64. Paradižnik V, Radujković B. 2007. Digenea trematodes in fish of the North Adriatic Sea. Acta Adriatica, 48(2), 115–129. [Google Scholar]
  65. Pérez-Ponce de León G, Pinacho-Pinacho CD, Mendoza-Garfias B, Choudhury A, García-Varela M. 2016. Phylogenetic analysis using the 28S rRNA gene reveals that the genus Paracreptotrema (Digenea: Allocreadiidae) is not monophyletic; description of two new genera and one new species. The Journal of Parasitology, 102(1), 131–142. [CrossRef] [PubMed] [Google Scholar]
  66. Pleijel F, Jondelius U, Norlinder E, Nygren A, Oxelman B, Schander C, Sundberg P, Thollesson M. 2008. Phylogenies without roots? A plea for the use of vouchers in molecular phylogenetic studies Molecular Phylogenetics and Evolution, 48(1), 369–371. [CrossRef] [PubMed] [Google Scholar]
  67. Pugachev ON. 2003. Checklist of the freshwater fish parasites of Northern Asia. Trematoda. Proceedings of the Zoological Institute, Russian Academy of Sciences, 298, 218 (In Russian). [Google Scholar]
  68. Radujković BM, Orecchia P, PaggiI L. 1989. Parasites des poissons marins du Monténégro: Digènes. Acta Adriatica, 30(1/2), 137–187. [Google Scholar]
  69. Ramdani S, Trilles J, Ramdane Z. 2020. Parasitic fauna of Sardinella aurita Valenciennes, 1847 from Algerian coast. Zoology and Ecology, 30(1), 101–108. [Google Scholar]
  70. Rees G. 1953. Some parasitic worms from fishes off the coast of Iceland. II. Trematoda (Digenea). Parasitology, 43, 15–26. [CrossRef] [PubMed] [Google Scholar]
  71. Ronald K. 1960. The metazoan parasites of the Heterosomata of the Gulf of St. Lawrence. VI. Digrenea. Canadian Journal of Zoology, 38, 923–937. [CrossRef] [Google Scholar]
  72. Saitou N, Nei M. 1987. The neighbor-joining method: a new method for reconstructing phylogenetic trees. Molecular Biology and Evolution, 4, 406–425. [PubMed] [Google Scholar]
  73. Sandeman IM, Pippy JHC. 1967. Parasites of freshwater fishes (Salmonidae and Coregonidae) of insular Newfoundland. Journal of the Fisheries Research Board of Canada, 24(9), 1911–1943. [CrossRef] [Google Scholar]
  74. Sey O. 1968. Parasitic helminths occurring in Adriatic fishes. Part I (flukes). Acta Adriatica, 13(4), 3–15. [Google Scholar]
  75. Shotter RA. 1972. Notes on helminth parasites of the whiting Odontogadus m. merlangus (L.) from the northern Irish Sea. Journal of Fish Biology, 4, 117–130. [CrossRef] [Google Scholar]
  76. Srivastava LP. 1966. The helminth parasites of the five-bearded rockling, Onos mustelus (L.) from the shore at Mumbles Head, Swansea. Annals and Magazine of. Natural History, Series 13. 9m, 469–480. [CrossRef] [Google Scholar]
  77. Stafford J. 1904. Trematodes from Canadian fishes. Zoologischer Anzeiger, 24, 481–495. [Google Scholar]
  78. Suriano DM, Sutton CA. 1981. Contribución al conocimiento de la fauna parasitológica argentina VII digeneos de peces de la plataforma del Mar Argentino. Revista del Museo de la Plata, 12(124), 261–271. [Google Scholar]
  79. Szidat L. 1950. Los parásitos del róbalo (Eleginops maclovinus Cuv. and Val.) Primer Congreso Nacional de Pesquerías Marítimas e Industria Derivadas, Mar del Plata, 24–29th October 1949. Buenos Aires, 2, 235–270. [Google Scholar]
  80. Tamura K, Stecher G, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Molecular Biology and Evolution, 38, 3022–3027. [CrossRef] [PubMed] [Google Scholar]
  81. Ternengo S, Levron C, Mouillot D, Marchand B. 2009. Site influence in parasite distribution from fishes of the Bonifacio Strait marine reserve (Corsica island, Mediterranean Sea). Parasitology Research, 104(6), 1279–1287. [CrossRef] [PubMed] [Google Scholar]
  82. Tsuchida K, Flores V, Viozzi G, Rauque C, Urabe M. 2021. Hemiuroidean trematodes from freshwater Patagonian fishes: description of a new species, distribution and molecular phylogeny. Parasitology Research, 120(4), 1219–1232. [CrossRef] [PubMed] [Google Scholar]
  83. Urabe M, Nishimura T, Shimazu T. 2012. Taxonomic revision of three species of the genus Genarchopsis (Digenea: Hemiuroidea: Derogenidae) in Japan by molecular phylogenetic analyses. Parasitology International, 61(4), 554–560. [CrossRef] [PubMed] [Google Scholar]
  84. Urabe M, Nishimura T, Shimazu T. 2012. Taxonomic revision of three species of the genus Genarchopsis (Digenea: Hemiuroidea: Derogenidae) in Japan by molecular phylogenetic analyses. Parasitology International, 61, 554–560. [CrossRef] [PubMed] [Google Scholar]
  85. WoRMS. 2022. Derogenes varicus. https://www.marinespecies.org/aphia.php?p=taxdetails&id=109264. [Google Scholar]
  86. Yamaguti S. 1934. Studies on the helminth fauna of Japan. Part 2. Trematodes of fishes, Is. Japanese Journal of Zoology, 5, 249–541. [Google Scholar]
  87. Yamaguti S. 1938. Studies on the helminth fauna of Japan. Part 24. Trematodes of fishes, V. Japanese Journal of Zoology, 8, 15–74. [Google Scholar]

Cite this article as: Bouguerche C, Huston DC, Cribb TH, Karlsbakk E, Ahmed M & Holovachov O. 2023. Hidden in the fog: morphological and molecular characterisation of Derogenes varicus sensu stricto (Trematoda, Derogenidae) from Sweden and Norway, and redescription of two poorly known Derogenes species. Parasite 30, 35.

All Tables

Table 1

Host fishes examined from Scandinavian waters of the North Sea and the Arctic Ocean during this study.

Table 2

Collection data for 28S sequences analysed in this study. A.O., Arctic Ocean. B.S., Barents Sea. M., Mediterranean. N.S., North Sea. W.S., White Sea.

Table 3

Measurements of Derogenes varicus sensu stricto. NEA, Northwest Atlantic.

Table 4

Measurements of Derogenes ruber Lühe, 1900 and Derogenes minor Looss, 1901. M., Mediterranean. L., length. W., width. R., ratio.

All Figures

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Geographical distribution of Derogenes varicus (Müller, 1784) from fish around the world. References for the records are given between parentheses. Note that this is not an exhaustive list of all reported hosts, excluding those for which evidence is partly lacking and illustrates mainly the numerous reports and the taxonomic range of hosts.

In the text
Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Tree inferred using the ML method based on the 28S rDNA sequence data; only bootstrap values higher than 70 are indicated. The newly generated sequences are indicated in red. Sequence of Derogenes varicus from the type-host is in bold. Lineages DV1, DV2, DV3 and Derogenes lacustris are in different colours.

In the text
Thumbnail: Figure 3 Refer to the following caption and surrounding text. Figure 3

Tree inferred using the ML method based on the ITS2 rDNA sequence data; only bootstrap values higher than 70 are indicated. Derogenes varicus lineages DV1, DV2 are in different colours.

In the text
Thumbnail: Figure 4 Refer to the following caption and surrounding text. Figure 4

Tree inferred using the ML method based on the cox1 gene sequences; only bootstrap values higher than 70 are indicated. The newly generated sequences are indicated in red. Lineages DV1, DV2 Derogenes lacustris Tsuchida, Flores, Viozzi, Rauque & Urabe, 2021 are in different colours.

In the text
Thumbnail: Figure 5 Refer to the following caption and surrounding text. Figure 5

Derogenes varicus (Müller, 1784) sensu stricto ex Gadus morhua (SMNH 218681), Hologenophore. A, Body. B, Egg. C, Terminal genitalia.

In the text
Thumbnail: Figure 6 Refer to the following caption and surrounding text. Figure 6

Derogenes varicus (Müller, 1784) sensu stricto ex Salmo salar (SMNH 218683, SMNH 218684). A, Whole body (SMNH 218683). B, Terminal genitalia (SMNH 218683). C, Posterior part showing excretory vesicle (SMNH 218684).

In the text
Thumbnail: Figure 7 Refer to the following caption and surrounding text. Figure 7

Derogenes varicus (Müller, 1784) sensu stricto ex Merlangius merlangus. A, Whole body (SMNH 218721). B, Terminal genitalia (SMNH 218721). C, Whole body of a flattened specimen (SMNH 218722). D, Terminal genitalia of a flattened specimen (SMNH 218722). E, Whole body (SMNH 218723).

In the text
Thumbnail: Figure 8 Refer to the following caption and surrounding text. Figure 8

Derogenes varicus (Müller, 1784) sensu stricto from different hosts. A, Whole body ex Myoxocephalus scorpius (SMNH-114553). B, Whole body ex Gadus morhua (SMNH-1145522). C, Whole body ex Limanda limanda (SMNH-1145511).

In the text
Thumbnail: Figure 9 Refer to the following caption and surrounding text. Figure 9

Derogenes ruber Lühe, 1900 ex Chelidonichthys lastoviza. Unpublished line drawing by A. Looss.

In the text
Thumbnail: Figure 10 Refer to the following caption and surrounding text. Figure 10

Derogenes ruber Lühe, 1900 ex Chelidonichthys lastoviza (SMNH-138743). A, Whole body. B, Terminal genitalia.

In the text
Thumbnail: Figure 11 Refer to the following caption and surrounding text. Figure 11

Derogenes ruber Lühe, 1900 ex Scorpaena scrofa. Unpublished line drawings by A. Looss.

In the text
Thumbnail: Figure 12 Refer to the following caption and surrounding text. Figure 12

Derogenes ruber Lühe, 1900 ex Scorpaena scrofa based on A. Looss’s unpublished line drawings. A, Whole body, ventral view. B, Whole body, lateral view. C, Whole body, ventral view. D, Whole body, lateral view.

In the text
Thumbnail: Figure 13 Refer to the following caption and surrounding text. Figure 13

Derogenes minor Looss, 1901 ex Labrus merula. Original line drawing of D. minor published as Figure 5 in Looss (1901), and an unpublished line drawing of the terminal genitalia.

In the text
Thumbnail: Figure 14 Refer to the following caption and surrounding text. Figure 14

Derogenes minor Looss, 1901 ex Labrus merula and Derogenes cf. minor ex Lophius budegassa. A, Derogenes minor Looss, 1901 ex L. merula, Whole body, Lectotype (SMNH-138741). B, Derogenes minor Looss, 1901 ex L. merula, Terminal genitalia, Lectotype (SMNH-138741). C, Derogenes minor Looss, 1901 ex L. merula based on an unpublished line drawing by A. Looss. D, Derogenes cf. minor ex Lophius budegassa, Whole body (SMNH-138742).

In the text
Thumbnail: Figure 15 Refer to the following caption and surrounding text. Figure 15

Diagram showing the similarities and differences between some Derogenes species. A, Derogenes varicus (Müller, 1784) sensu stricto (SMNH-9563). B, Derogenes ruber Lühe, 1900 (SMNH-138743). C, Derogenes minor Looss, 1901 (SMNH-138741). D, Derogenes latus Janiszewska, 1953.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.