Open Access
Issue
Parasite
Volume 27, 2020
Article Number 21
Number of page(s) 6
DOI https://doi.org/10.1051/parasite/2020019
Published online 06 April 2020

© J. Wang et al., published by EDP Sciences, 2020

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Enterocytozoon bieneusi, a unicellular and obligate intracellular pathogen, has an extensive host range and has been identified in humans, livestock, companion animals, and wildlife, as well as in wastewater [17, 23]. Enterocytozoon bieneusi infection can cause self-limiting diarrhea, malabsorption, and wasting in immunocompetent hosts and life-threatening diarrhea in immunocompromized individuals [10]. Humans and animals can acquire infection via fecal–oral transmission of spores from infected individuals through direct contact or by consumption of contaminated food or water [17].

Genotyping based on the internal transcribed spacer (ITS) region of the rRNA gene has identified 11 major phylogenetic groups and more than 470 genotypes of E. bieneusi from various hosts [17]. To date, more than 60 E. bieneusi genotypes have been identified in rodents worldwide [6, 8, 12, 17, 24, 26, 30, 34]. For rats (Rattus spp.), only three surveys have focused on the molecular characterization of E. bieneusi in wild rats in Iran and China, and six genotypes (D, M, Peru6, CD6, BEB6, and CHG2) have been identified [24, 30, 34]. Only one published article has reported genotype peru16 from household guinea pigs in Peru [3].

Fancy rats, Rattus norvegicus forma domestica, are rodents belonging to the order Rodentia and family Muridae. Fancy rats have been bred as pets at least since the late 19th century; they are considered to be intelligent, playful, and trainable animals (http://www.afrma.org/). In recent years, fancy rats have become a very popular pet in China. Pet rodents can be hosts to several zoonotic pathogens, including viruses, bacteria, and parasites [20]; zoonotic transmission of E. bieneusi to a child from household guinea pigs has been reported [3]. However, no literature is available about the prevalence and genetic characteristics of E. bieneusi in pet rats and pet guinea pigs. Therefore, the aim of the present study was to determine the prevalence and genotypes of E. bieneusi in these animals and to assess its zoonotic potential.

Materials and methods

Ethics statement

The research protocol was reviewed and approved by the Research Ethics Committee of Henan University of Science and Technology.

Sample collection

Between September 2018 and October 2019, 152 pet fancy rats and 173 pet guinea pigs were purchased from six pet shops in Luoyang, Henan and Weifang, Shandong, China (Tables 1 and 2). Upon arrival in the laboratory, each animal was immediately placed into a single clean plastic box for collection of fresh feces. A single sample was collected from each animal. All the specimens were refrigerated at 4 °C and DNA was extracted within one week. Only young pet fancy rats (4–10 week-old) and 1–8-month-old pet guinea pigs were available in these pet shops. All pet fancy rats and guinea pigs examined in this study were asymptomatic at the time of sample collection, and information on region, age, and sex of these animals was recorded.

Table 1

Prevalence and genotypes of Enterocytozoon bieneusi in pet fancy rats (Rattus norvegicus) in Henan and Shandong provinces, China.

Table 2

Prevalence and genotypes of Enterocytozoon bieneusi in pet guinea pigs (Cavia porcellus) in Henan and Shandong provinces, China.

DNA extraction

Each specimen was washed with distilled water by centrifugation for 10 min at 3000 ×g at room temperature. Before DNA extraction, 200 mg of each fecal sample was added to a 2 mL microcentrifuge tube containing 200 mg of glass beads, and were vortexed at maximum speed until the fecal samples were completely homogenized. Genomic DNA was extracted using an E.Z.N.A. Stool DNA Kit (Omega Bio-tek Inc., Norcross, GA, USA), according to the manufacturer’s instructions. The extracted DNA was kept at −20 °C before being used in PCR analysis.

PCR amplification

Enterocytozoon bieneusi was examined by nested PCR targeting a ~390-bp fragment of the ITS region, as previously described [2]. The primers were EBITS3 (5′–GGTCATAGGGATGAAGAG–3′) and EBITS4 (5′–TTCGAGTTCTTTCGCGCTC–3′) as external primers and EBITS1 (5′–GCTCTGAATATCTATGGCT–3′) and EBITS2.4 (5′–ATCGCCGACGGATCCAAGTG–3′) as internal primers. TransStart® Taq DNA Polymerase (TransGen Biotech, Beijing, China) was used for PCR amplifications. The cycling conditions for PCRs were: 94 °C for 5 min; followed by 35 cycles of 94 °C for 30 s, 57 °C (primary PCR) or 55 °C (secondary PCR) for 30 s, and 72 °C for 40 s; followed by 72 °C for 7 min. Positive and negative controls were included in each PCR analysis.

Sequencing and phylogenetic analysis

Two-directional sequencing of positive PCR products was done by Sangon Biotech Co. Ltd., (Shanghai, China). The obtained nucleotide sequences were aligned with available sequences in GenBank, using ClustalX 2.1 (http://www.clustal.org/) [15]. Genotypes of E. bieneusi were determined based on ~243 bp of the ITS region, according to the established nomenclature system [22]. A neighbor-joining tree was generated using MEGA7 software (http://www.megasoftware.net/) [14]. The evolutionary distances were computed using the maximum composite likelihood method, and the reliability of branches in the tree was assessed by bootstrap analysis using 1000 replicates.

Statistical analysis

Chi-square analysis was performed to assess the correlation between the prevalence of E. bieneusi and the age, sex, and region of pet fancy rats and guinea pigs using SPSS, version 17.0 (Statistical Package for the Social Sciences).

Nucleotide sequence accession numbers

Unique ITS nucleotide sequences of E. bieneusi obtained from pet fancy rats and guinea pigs in this study were deposited in the GenBank database under accession numbers MN550998MN551001 and MN998614MN998615, respectively.

Results and discussion

In the present study, E. bieneusi was detected by PCR in 17 (11.2%) of 152 pet fancy rats and 35 (20.2%) of 173 pet guinea pigs. To our knowledge, this is the first report of E. bieneusi infection in pet rats and pet guinea pigs worldwide. To date, there have been three studies focusing on E. bieneusi infection in wild rats in Iran and China [24, 30, 34] (Table 3). In this study, the prevalence of E. bieneusi in pet fancy rats was slightly higher than that (4.0%–8.9%) in wild rats in the above-mentioned reports. The prevalence of E. bieneusi in pet guinea pigs in this study was higher than that (14.9%, 10/67) in household guinea pigs in Peru [3], and also higher than other pet rodents, such as pet chinchillas (3.6%), pet squirrels (16.7%) and chipmunks (17.6%) [7, 8, 21].

Table 3

Prevalence and genotypes of Enterocytozoon bieneusi in rats (Rattus spp.) and guinea pigs worldwide.

In both pet fancy rats and guinea pigs, although the prevalences of E. bieneusi in younger animals and those from Weifang, Shandong were higher than those in older animals and animals from Luoyang, Henan (Tables 1 and 2), the differences in prevalence in both species between different regions, ages and sex groups were not significant (p > 0.05). This finding was consistent with the observations reported in a previous study on pet red-bellied tree squirrels in China [7].

In the 17 E. bieneusi ITS-positive samples from pet fancy rats in this study, four known genotypes were identified; genotype D (n = 12) was the dominant genotype, followed by Peru11 (n = 3), S7 (n = 1), and SCC-2 (n = 1) (Table 1). For pet guinea pigs, two genotypes were identified, including the predominant genotype S7 (n = 30, 85.7%) and a novel genotype (named PGP, n = 5) (Table 2). Until now, molecular studies of E. bieneusi in rats have been limited to three reports in wild rats (R. norvegicus and R. rattus) in Iran and China, and a total of six genotypes were identified, including genotypes D, CD6 (synonyms: CHG14), Peru6, M, BEB6, and CHG2 [24, 30, 34] (Table 3). For guinea pigs, only one survey conducted in Peru identified genotype peru16 from household guinea pigs (Table 3) [3], and this genotype was not detected in the present study.

In this study, genotype D was the most prevalent genotype in pet fancy rats, which is consistent with two previous reports (85.7% and 89.5%) from wild rats [24, 34], as well as other rodents such as pet red-bellied tree squirrels (Callosciurus erythraeus) (75.0%), pet red squirrels (Sciurus vulgaris) (44.3%), and domestic bamboo rats (Rhizomys sinensis) (77.3%) [6, 7, 26]. Genotype D is considered an important zoonotic genotype worldwide [17]. In China, genotype D has been identified in immunocompromized patients and in children with diarrhea [18, 2729, 32]. Genotype D has also been identified in a wide range of animal hosts in China, including non-human primates, rodents (mice, rats, squirrels, chipmunks, chinchillas, and bamboo rats), other mammals (pigs, cattle, sheep, goats, alpacas, horses, donkeys, rabbits, dogs, cats, foxes, deer, takins, minks, raccoon dogs, raccoons, lions, and hippos), and birds, as well as in water samples [6, 8, 9, 11, 17, 24, 26, 30, 31, 33, 34].

In the present study, genotype Peru11, a zoonotic genotype, was identified in pet fancy rats for the first time. This genotype has been found previously in humans in Peru, China and Thailand, non-human primates in Kenya and China, raccoons, voles and cottontails in the United States, chickens in Brazil, cats in Spain, and minks and water in China [4, 5, 17, 33]. Genotype SCC-2 was reported previously in pet chipmunks and squirrels in China [6, 8], and was found in pet fancy rats for the first time. Genotype S7 (synonyms: CHY1) was originally reported in a patient in the Netherlands [25], and recently identified in a yak and pet chipmunks in China [8, 16]. This genotype was identified in a fancy rat; moreover, it was predominant in pet guinea pigs in this study, suggesting that guinea pig might be an important reservoir host of genotype S7. More studies are needed to understand the host range and public health importance of genotypes S7 and SCC-2.

In the phylogenetic tree of the E. bieneusi ITS region (Fig. 1), genotypes D and Peru11 were clustered into group 1 with strong zoonotic potential [17], and genotype S7 was clustered into group 10. Genotype SCC-2 belonged to a group which includes several chipmunk and squirrel-derived genotypes such as SCC-1–3 and RS01. Sequence and phylogenetic analysis showed that the novel genotype PGP was distinctly different. Genotype PGP exhibited less than 50% sequence similarity to the reference sequences from the known E. bieneusi genotype groups and outliers, i.e., 45.5% similarity to genotype CM18 in group 7, and less than 30% as compared with those in group 11 and outliers. The novel genotype PGP identified in pet guinea pigs did not cluster with any of the known E. bieneusi genotype groups, and formed a unique branch which was located at an intermediate position between groups 6 and 7 (Fig. 1). These data suggest that the genetic variability of E. bieneusi is broad, and indicate the presence of a new E. bieneusi genotype group; similar observations have been reported in previous studies [1, 13, 19]. Further studies on more samples collected from different regions should be conducted to understand the genetic diversity of E. bieneusi from rodents in China.

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Phylogenetic relationships among the genotypes of E. bieneusi identified in this study and other known genotypes, as inferred by a neighbor-joining analysis of the ITS region. Bootstrap values greater than 50% from 1000 pseudoreplicates are shown. The genotypes identified in this study are indicated by closed circles.

Conclusions

This is the first report of E. bieneusi infection in pet fancy rats and pet guinea pigs. Five genotypes (D, Peru11, S7, SCC-2, and a novel genotype PGP) were identified in this study, and genotypes D and S7 were the dominant genotypes in pet fancy rats and guinea pigs, respectively. Rats (Rattus norvegicus) are a new host of E. bieneusi genotypes Peru11, S7, and SCC-2, and guinea pigs might be an important reservoir host of genotype S7. The identification of three zoonotic genotypes (D, Peru11, and S7) suggests that pet fancy rats and guinea pigs may be the sources of E. bieneusi infection in humans. Therefore, pet owners, especially children, should be educated to take precautions to reduce the transmission risk.

Competing interests

The authors declare that they have no competing interests.

Acknowledgments

This study was supported by the National Natural Science Foundation of China (Grant No. 31502053), Student Research Training Program (SRTP) in Henan University of Science and Technology (2019392) and Henan Province (S201910464052), and Key Scientific Research Projects of Higher Education Institutions in Henan Province (Grant No. 20A230001).

References

  1. Breton J, Bart-Delabesse E, Biligui S, Carbone A, Seiller X, Okome-Nkoumou M, Nzamba C, Kombila M, Accoceberry I, Thellier M. 2007. New highly divergent rRNA sequence among biodiverse genotypes of Enterocytozoon bieneusi strains isolated from humans in Gabon and Cameroon. Journal of Clinical Microbiology, 45, 2580–2589. [CrossRef] [PubMed] [Google Scholar]
  2. Buckholt MA, Lee JH, Tzipori S. 2002. Prevalence of Enterocytozoon bieneusi in swine: an 18-month survey at a slaughterhouse in Massachusetts. Applied and Environmental Microbiology, 68, 2595–2599. [CrossRef] [PubMed] [Google Scholar]
  3. Cama VA, Pearson J, Cabrera L, Pacheco L, Gilman R, Meyer S, Ortega Y, Xiao L. 2007. Transmission of Enterocytozoon bieneusi between a child and guinea pigs. Journal of Clinical Microbiology, 45, 2708–2710. [CrossRef] [PubMed] [Google Scholar]
  4. Cong W, Qin SY, Meng QF. 2018. Molecular characterization and new genotypes of Enterocytozoon bieneusi in minks (Neovison vison) in China. Parasite, 25, 34. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  5. Dashti A, Santin M, Cano L, de Lucio A, Bailo B, de Mingo MH, Koster PC, Fernandez-Basterra JA, Aramburu-Aguirre J, Lopez-Molina N, Fernandez-Crespo JC, Calero-Bernal R, Carmena D. 2019. Occurrence and genetic diversity of Enterocytozoon bieneusi (Microsporidia) in owned and sheltered dogs and cats in Northern Spain. Parasitology Research, 118, 2979–2987. [CrossRef] [PubMed] [Google Scholar]
  6. Deng L, Chai Y, Luo R, Yang L, Yao J, Zhong Z, Wang W, Xiang L, Fu H, Liu H, Zhou Z, Yue C, Chen W, Peng G. 2020. Occurrence and genetic characteristics of Cryptosporidium spp. and Enterocytozoon bieneusi in pet red squirrels (Sciurus vulgaris) in China. Scientific Reports, 10, 1026. [CrossRef] [PubMed] [Google Scholar]
  7. Deng L, Li W, Yu X, Gong C, Liu X, Zhong Z, Xie N, Lei S, Yu J, Fu H, Chen H, Xu H, Hu Y, Peng G. 2016. First report of the human-pathogenic Enterocytozoon bieneusi from red-bellied tree squirrels (Callosciurus erythraeus) in Sichuan, China. PLoS One, 11, e0163605. [CrossRef] [PubMed] [Google Scholar]
  8. Deng L, Li W, Zhong Z, Chai Y, Yang L, Zheng H, Wang W, Fu H, He M, Huang X, Zuo Z, Wang Y, Cao S, Liu H, Ma X, Wu K, Peng G. 2018. Molecular characterization and new genotypes of Enterocytozoon bieneusi in pet chipmunks (Eutamias asiaticus) in Sichuan province, China. BMC Microbiology, 18, 37. [CrossRef] [PubMed] [Google Scholar]
  9. Deng L, Yue C, Chai Y, Wang W, Su X, Zhou Z, Wang L, Li L, Liu H, Zhong Z, Cao S, Hu Y, Fu H, Peng G. 2019. New genotypes and molecular characterization of Enterocytozoon bieneusi in pet birds in Southwestern China. International Journal for Parasitology: Parasites and Wildlife, 10, 164–169. [CrossRef] [Google Scholar]
  10. Didier ES, Weiss LM. 2006. Microsporidiosis: current status. Current Opinion in Infectious Diseases, 19, 485–492. [CrossRef] [PubMed] [Google Scholar]
  11. Feng SY, Chang H, Luo J, Huang JJ, He HX. 2019. First report of Enterocytozoon bieneusi and Cryptosporidium spp. in peafowl (Pavo cristatus) in China. International Journal for Parasitology: Parasites and Wildlife, 9, 1–6. [CrossRef] [Google Scholar]
  12. Gui BZ, Zou Y, Chen YW, Li F, Jin YC, Liu MT, Yi JN, Zheng WB, Liu GH. 2020. Novel genotypes and multilocus genotypes of Enterocytozoon bieneusi in two wild rat species in China: potential for zoonotic transmission. Parasitology Research, 119, 283–290. [CrossRef] [PubMed] [Google Scholar]
  13. Karim MR, Wang R, Dong H, Zhang L, Li J, Zhang S, Rume FI, Qi M, Jian F, Sun M, Yang G, Zou F, Ning C, Xiao L. 2014. Genetic polymorphism and zoonotic potential of Enterocytozoon bieneusi from nonhuman primates in China. Applied and Environmental Microbiology, 80, 1893–1898. [CrossRef] [PubMed] [Google Scholar]
  14. Kumar S, Stecher G, Tamura K. 2016. MEGA7: Molecular Evolutionary Genetics Analysis Version 7.0 for Bigger Datasets. Molecular Biology and Evolution, 33, 1870–1874. [CrossRef] [PubMed] [Google Scholar]
  15. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, Valentin F, Wallace IM, Wilm A, Lopez R, Thompson JD, Gibson TJ, Higgins DG. 2007. Clustal W and Clustal X version 2.0. Bioinformatics, 23, 2947–2948. [CrossRef] [PubMed] [Google Scholar]
  16. Li J, Qi M, Chang Y, Wang R, Li T, Dong H, Zhang L. 2015. Molecular characterization of Cryptosporidium spp., Giardia duodenalis, and Enterocytozoon bieneusi in captive wildlife at Zhengzhou zoo, China. Journal of Eukaryotic Microbiology, 62, 833–839. [CrossRef] [Google Scholar]
  17. Li W, Feng Y, Santin M. 2019. Host specificity of Enterocytozoon bieneusi and public health implications. Trends in Parasitology, 35, 436–451. [CrossRef] [PubMed] [Google Scholar]
  18. Liu H, Jiang Z, Yuan Z, Yin J, Wang Z, Yu B, Zhou D, Shen Y, Cao J. 2017. Infection by and genotype characteristics of Enterocytozoon bieneusi in HIV/AIDS patients from Guangxi Zhuang autonomous region, China. BMC Infectious Diseases, 17, 684. [CrossRef] [PubMed] [Google Scholar]
  19. Mathis A, Breitenmoser AC, Deplazes P. 1999. Detection of new Enterocytozoon genotypes in faecal samples of farm dogs and a cat. Parasite, 6, 189–193. [EDP Sciences] [PubMed] [Google Scholar]
  20. Meerburg BG, Singleton GR, Kijlstra A. 2009. Rodent-borne diseases and their risks for public health. Critical Reviews in Microbiology, 35, 221–270. [CrossRef] [PubMed] [Google Scholar]
  21. Qi M, Luo N, Wang H, Yu F, Wang R, Huang J, Zhang L. 2015. Zoonotic Cryptosporidium spp. and Enterocytozoon bieneusi in pet chinchillas (Chinchilla lanigera) in China. Parasitology International, 64, 339–341. [CrossRef] [PubMed] [Google Scholar]
  22. Santin M, Fayer R. 2009. Enterocytozoon bieneusi genotype nomenclature based on the internal transcribed spacer sequence: a consensus. Journal of Eukaryotic Microbiology, 56, 34–38. [CrossRef] [Google Scholar]
  23. Santin M, Fayer R. 2011. Microsporidiosis: Enterocytozoon bieneusi in domesticated and wild animals. Research in Veterinary Science, 90, 363–371. [CrossRef] [PubMed] [Google Scholar]
  24. Tavalla M, Kazemi F, Mardani-Kateki M, Abdizadeh R. 2018. Molecular diagnosis of Enterocytozoon bieneusi and Encephalitozoon spp. in wild rats of southwest of Iran. Jundishapur Journal of Microbiology, 11, e55961. [Google Scholar]
  25. ten Hove RJ, Van Lieshout L, Beadsworth MB, Perez MA, Spee K, Claas EC, Verweij JJ. 2009. Characterization of genotypes of Enterocytozoon bieneusi in immunosuppressed and immunocompetent patient groups. Journal of Eukaryotic Microbiology, 56, 388–393. [CrossRef] [Google Scholar]
  26. Wang H, Liu Q, Jiang X, Zhang Y, Zhao A, Cui Z, Li D, Qi M, Zhang L. 2019. Dominance of zoonotic genotype D of Enterocytozoon bieneusi in bamboo rats (Rhizomys sinensis). Infection, Genetics and Evolution, 73, 113–118. [CrossRef] [Google Scholar]
  27. Wang L, Xiao L, Duan L, Ye J, Guo Y, Guo M, Liu L, Feng Y. 2013. Concurrent infections of Giardia duodenalis, Enterocytozoon bieneusi, and Clostridium difficile in children during a cryptosporidiosis outbreak in a pediatric hospital in China. PLoS Neglected Tropical Diseases, 7, e2437. [Google Scholar]
  28. Wang L, Zhang H, Zhao X, Zhang L, Zhang G, Guo M, Liu L, Feng Y, Xiao L. 2013. Zoonotic Cryptosporidium species and Enterocytozoon bieneusi genotypes in HIV-positive patients on antiretroviral therapy. Journal of Clinical Microbiology, 51, 557–563. [CrossRef] [PubMed] [Google Scholar]
  29. Wang T, Fan Y, Koehler AV, Ma G, Li T, Hu M, Gasser RB. 2017. First survey of Cryptosporidium, Giardia and Enterocytozoon in diarrhoeic children from Wuhan, China. Infection, Genetics and Evolution, 51, 127–131. [CrossRef] [Google Scholar]
  30. Yu F, Qi M, Zhao Z, Lv C, Wang Y, Wang R, Zhang L. 2019. The potential role of synanthropic rodents and flies in the transmission of Enterocytozoon bieneusi on a dairy cattle farm in China. Journal of Eukaryotic Microbiology, 66, 435–441. [CrossRef] [Google Scholar]
  31. Zhang Q, Wang H, Zhao A, Zhao W, Wei Z, Li Z, Qi M. 2019. Molecular detection of Enterocytozoon bieneusi in alpacas (Vicugna pacos) in Xinjiang, China. Parasite, 26, 31. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  32. Zhang W, Ren G, Zhao W, Yang Z, Shen Y, Sun Y, Liu A, Cao J. 2017. Genotyping of Enterocytozoon bieneusi and subtyping of Blastocystis in cancer patients: relationship to diarrhea and assessment of zoonotic transmission. Frontiers in Microbiology, 8, 1835. [CrossRef] [PubMed] [Google Scholar]
  33. Zhang XX, Jiang RL, Ma JG, Xu C, Zhao Q, Hou G, Liu GH. 2018. Enterocytozoon bieneusi in minks (Neovison vison) in Northern China: A Public Health Concern. Frontiers in Microbiology, 9, 1221. [CrossRef] [PubMed] [Google Scholar]
  34. Zhao W, Wang J, Ren G, Yang Z, Yang F, Zhang W, Xu Y, Liu A, Ling H. 2018. Molecular characterizations of Cryptosporidium spp. and Enterocytozoon bieneusi in brown rats (Rattus norvegicus) from Heilongjiang Province, China. Parasites & Vectors, 11, 313. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Wang J, Lv C, Zhao D, Zhu R, Li C & Qian W. 2020. First detection and genotyping of Enterocytozoon bieneusi in pet fancy rats (Rattus norvegicus) and guinea pigs (Cavia porcellus) in China. Parasite 27, 21.

All Tables

Table 1

Prevalence and genotypes of Enterocytozoon bieneusi in pet fancy rats (Rattus norvegicus) in Henan and Shandong provinces, China.

Table 2

Prevalence and genotypes of Enterocytozoon bieneusi in pet guinea pigs (Cavia porcellus) in Henan and Shandong provinces, China.

Table 3

Prevalence and genotypes of Enterocytozoon bieneusi in rats (Rattus spp.) and guinea pigs worldwide.

All Figures

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Phylogenetic relationships among the genotypes of E. bieneusi identified in this study and other known genotypes, as inferred by a neighbor-joining analysis of the ITS region. Bootstrap values greater than 50% from 1000 pseudoreplicates are shown. The genotypes identified in this study are indicated by closed circles.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.