Open Access
Issue
Parasite
Volume 32, 2025
Article Number 77
Number of page(s) 10
DOI https://doi.org/10.1051/parasite/2025070
Published online 05 December 2025

© Y. Zhang et al., published by EDP Sciences, 2025

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Blastocystis, a widespread intestinal protozoan, colonizing both human and non-human hosts, is primarily transmitted through the fecal-oral route [60]. Recognized as a waterborne pathogen and prevalent eukaryotic organism, it is included in the World Health Organization (WHO) guidelines for drinking-water quality [70]. Although Blastocystis is frequently detected in asymptomatic individuals, its pathogenicity remains uncertain [7]. However, studies suggest that Blastocystis incubation can modulate the host immune response, which has been linked to irritable bowel syndrome [32]. Immunocompromised patients are particularly vulnerable to infection and associated symptoms [8].

Because it is impossible to distinguish different subtypes (STs) of Blastocystis by morphology, PCR-based molecular diagnostic methods have been used to analyze the sequence of the small subunit ribosomal RNA (SSU rRNA), thereby revealing its genetic diversity and potential transmission routes [72]. Currently, more than 40 subtypes have been identified in humans and animals [53, 61]. Seventeen subtypes of Blastocystis (ST1–ST10, ST12–ST14, ST16, ST23, ST35, and ST41) have been reported in humans [47, 53]. Among these, ST1–ST4 are the most common colonizers of the human intestinal tract, accounting for nearly 95% of Blastocystis isolates worldwide [47, 60]. These subtypes have also been detected in other mammals and birds [27], suggesting that domestic animals may serve as natural hosts for Blastocystis [63]. ST5, ST10, and ST14 are most frequently found in hoofed animals, including pigs, cattle, and sheep [12, 40, 47]. Meanwhile, ST1, ST3, ST5, and ST7 have been identified in both humans and domestic animals (pigs and cattle) in household settings [5, 16]. The overlap of subtypes suggests potential zoonotic transmission, highlighting the role of infected animals as a possible risk factor for human infections [5, 57, 58].

Blastocystis has been reported in domestic pigs and cattle worldwide, with overall prevalence rates ranging from 43.3% to 66.6% (Table S1) and 4.3% to 45.5% (Table S2), respectively. Available data indicate that pigs harbor nine distinct subtypes (ST1–ST5, ST7, ST10, ST14, and ST15), with ST5 being the predominant subtype (Table S1). In cattle, 23 subtypes (ST1–ST7, ST10, ST12–ST15, ST17, ST21, ST23–ST26, ST30, ST32, and ST42–ST44) have been detected, among which ST10 is the most prevalent globally (Table S2). In China, Blastocystis has been identified in livestock across multiple provinces, including Heilongjiang [16, 20, 64, 68], Hebei [61], Henan [23], Shaanxi [59], Shanxi [69, 71], Qinghai [50], Anhui [24], Jiangxi [55, 65], Hunan [65], Fujian [38, 65], Zhejiang, Guangdong, and Yunnan provinces [26, 76], as well as in the Xinjiang Uygur [66] and Guangxi Zhuang Autonomous Region [74]. The overall prevalence of Blastocystis in domestic pigs and cattle in China is 38.8% and 14.8%, respectively (Tables S1 and S2). Hainan is the only tropical island province in China, with a unique tropical climate and environment that are distinct from those of the provinces studied previously. Given that these unique conditions may influence the prevalence, genetic diversity, and transmission dynamics of Blastocystis, while data on the parasite in local livestock remain limited, this study was conducted. We collected 456 pig and 302 cattle samples from Hainan and amplified the SSU rRNA genes to investigate the prevalence of Blastocystis and assess its potential public health risk.

Materials and methods

Ethics statement

The sampling strategy in this study was implemented after obtaining written informed consent from farm owners for animal use. The study did not involve hunting, euthanasia procedures, or experiments on live vertebrates. All methods were conducted in accordance with relevant guidelines and regulations of the Ethics Committee of Hainan Medical University (approval no. HYLL-2022-405) and were reported following the ARRIVE guidelines (https://arriveguidelines.org).

Specimen collection

A total of 758 fresh fecal samples were collected from domestic pigs (Sus scrofa f. domestica) (n = 456) and cattle (Bos taurus) (n = 302) on farms across ten regions of Hainan Province, China, between March 2021 to October 2022 (Fig. 1). All sampled farms were large-scale breeding facilities complying with sanitary and production standards, housing 100–500 animals each. On each farm, specimens were collected from 20–30% of the total animals, all of which were healthy and showed no digestive symptoms. Fecal samples were preserved in individual sterile 50 mL centrifuge tubes with records of species, region and collection time. All the samples were transported under low-temperature and stored at −80 °C until analysis.

thumbnail Figure 1

Map of sampling regions of domestic pigs and cattle in Hainan, China.

DNA extraction and PCR amplification

The stored fecal samples were washed three times with distilled water, with each wash followed by centrifugation at 3000× g for 10 min. Genomic DNA was extracted from 200 mg of each processed fecal specimen using a QIAamp DNA stool mini kit (QIAGEN, Hilden, Germany), following the manufacturer’s protocol with modification of an increased lysis temperature (95 °C) to ensure optimal DNA yield. The extracted DNA was stored at −20 °C until PCR analysis.

The specimens were examined for Blastocystis by nested PCR amplification of the small subunit (SSU) rRNA gene using specific primers: forward primer RD1 (5′–GGAGGTAGTGAC AATAAATC–3′) and reverse primer RD2 (5′–TGCTTTCGCACTTGTTCATC–3′) [13], which yield a ~500 bp amplicon. PCR reactions were performed in a 25 μL volume using TaKaRa Taq DNA Polymerase (TaKaRa Bio Inc., Tokyo, Japan). The thermal cycling protocol consisted of: initial denaturation at 95 °C for 4 min; 35 cycles of denaturation at 95 °C for 30 s, annealing at 54 °C for 30 s, and extension at 72 °C for 30 s; followed by a final extension at 72 °C for 5 min. Each PCR run included two positive controls (Blastocystis-positive samples previously sequenced in our studies) and a negative control (reagent-grade water without template DNA). PCR products were electrophoresed on 1.5% agarose gels and visualized using GoldenView nucleic acid stain.

Sequencing and phylogenetic analysis

All the Blastocystis-positive specimens were subjected to bidirectional sequencing. PCR products yielding novel sequences were additionally sequenced. Sequence data were processed and aligned using Clustal X v2.1 tools (http://www.clustal.org/). Blastocystis subtypes were determined through comparison with reference sequences in GenBank using the Basic Local Alignment Search Tool (BLAST) (http://www.ncbi.nlm.nih.gov/BLAST/). Phylogenetic analysis was conducted using MEGA 11 (Molecular Evolutionary Genetics Analysis Version 11.0) [62], employing both Neighbor-Joining (NJ) and Maximum Likelihood (ML) methods. Evolutionary distances were calculated using the Kimura 2-parameter model with 1,000 bootstrap replicates. The phylogenetic tree was rooted using Proteromonas lacertae (U37108) as the outgroup. Representative nucleotide sequences were submitted to GenBank under accession numbers: OQ727477OQ727487, OQ727489OQ727501, OQ048307, and OQ048308.

Statistical analysis

Statistical analyses were performed using Statistical Package for the Social Sciences (SPSS) version 22.0 (SPSS Inc., Chicago, IL, USA). Fisher’s exact test was employed to compare Blastocystis prevalence across different regions groups, with statistical significance set at p < 0.05. Multilevel logistic mixed regression models were constructed to calculate odds ratios (OR) and 95% confidence intervals (CI), using Blastocystis prevalence and subtypes (STs) as primary outcome variables.

Results

Prevalence of Blastocystis

In this study, we collected 456 domestic pig and 302 cattle samples from Hainan Province. The overall prevalence of Blastocystis in pigs was 30.26% (138/456; 95% CI: 26.05–34.48), with regional prevalence rates ranging from 0% to 83.33% across eight sampling locations. Among cattle, the overall infection rate was 13.25% (40/302; 95% CI: 9.38–17.02), with regional prevalence ranging from 4.88% to 25.81% (Table 1).

Table 1

Risk factors associated with prevalence and subtype distribution of Blastocystis in domestic pigs and cattle in Hainan, China.

Subtype distribution of Blastocystis

Of the 138 domestic pig samples from different regions that tested positive by nested PCR and sequence analysis, all were identified as ST5 in this study (Table 1). Among the 40 Blastocystis isolates from cattle, six known subtypes (ST5, ST10, ST21, ST23, ST25, and ST26) were identified, with no mixed subtype infections detected in this study. ST21, ST26, and ST10 were the predominant subtypes in cattle in Hainan, accounting for 45.0% (18/40), 25.0% (10/40), and 17.5% (7/40), respectively. The other three subtypes occurred only occasionally: ST23 (5.0%, 2/40), ST25 (5.0%, 2/40), and ST5 (2.5%, 1/40). However, among the 8 Blastocystis isolates from cattle in Wanning, ST10 was the most abundant subtype at 37.5% (3/8), while ST21 was the most common in other sampling regions. Moreover, ST21 was the most prevalent subtype in cattle throughout the year (Table 1).

Phylogenetic and sequence analysis of Blastocystis subtypes

The results of the phylogenetic tree analysis by the Neighbor-Joining (NJ) and Maximum Likelihood (ML) methods showed consistent clustering patterns for Blastocystis subtypes, and the representative sequences of this study clustered with the reference sequences in their corresponding subtype branches (Figs. 2A and 2B). A nucleotide sequence with at least one nucleotide substitution, deletion, or insertion compared to known subtype sequences was considered a novel sequence. A novel sequence differing by at least 3% from others in a known clade may be defined as a new subtype [17]. The 176 sequences from Blastocystis isolates in this study have previously been described, except for a novel ST5 sequence (OQ048307) and a novel ST10 sequence (OQ048308). The 138 ST5 sequences from pigs (OQ727477OQ727487 and OQ048307) and an ST5 sequence from cattle (OQ727489) clustered within the ST5 branch. A sequence alignment analysis of the ST5 sequences in this study showed that there were 25 polymorphic sites among them. The novel ST5 sequence (OQ048307) had 99.78% identity with MN472768 isolated from an ostrich in Brazil and a nucleotide substitution at position 202 (A → G) (Fig. 3A). The 7 ST10 sequences were isolated from cattle, OQ727490OQ727492 and OQ727494 clustered as sister branches with MN472833 (Ostrich, Brazil), while OQ048308 and OQ727493 clustered as another sister branch with MW662498 (Horse, Colombia). The novel ST10 sequence (OQ048308) showed 99.79% identity to MZ664504 (Cattle, Spain) and contained an A → G substitution at position 188 (Fig. 3B). A total of 18 nucleotide sequences from cattle in the present study were identified as ST21 (OQ727495), displaying 100% identity with Blastocystis subtypes isolated from cattle in Spain (MZ664507). The 10 ST26 displayed 100% genetic identity with previously reported subtypes: OQ727498 (n = 3), OQ727499 (n = 2), OQ727500 (n = 4), and OQ727501 (n = 1) from cattle. ST23 (OQ727496, n = 2) and ST25 (OQ727497, n = 2) displayed an identity of 100% with a Blastocystis subtype isolated in a dairy heifer calve from the USA (MH634464) and a cow from Spain (MZ664506), respectively.

thumbnail Figure 2

Phylogenetic analysis by Neighbor-Joining (A) and Maximum Likelihood (B) methods of Blastocystis isolates based on SSU rDNA gene sequences in this study. The known and novel sequences identified in this study are indicated by black squares and red circles, respectively. The sequence of Proteromonas lacertae (U37108) was as an outgroup.

thumbnail Figure 3

SSU rDNA gene sequence polymorphism among novel and known sequences of ST5 (A) and ST10 (B) with the reference sequence.

Discussion

In the present study, Blastocystis was detected in 138 of 456 (30.3%) domestic pigs and 40 of 302 (13.2%) cattle through SSU rRNA gene PCR amplification. The overall prevalence in pigs was comparable to rates reported in Hunan, Jiangxi, and Fujian (31.4%, 394/1254) [65], but significantly higher than findings from Heilongjiang (8.8%, 6/68) [64], Shanxi (14.09%, 51/362) [69], and Xinjiang (21.7%, 174/801) [66] in China, Slovakia (12.0%, 12/100) [18], and the UK (16.7%, 2/12) [6]. However, it was lower than the pooled frequencies of 38.8% (China), 43.3% (Asia), and 46.8% (worldwide) reported in a meta-analysis encompassing more than 12,000 fecal samples globally (Table S1). The overall prevalence in Hainan cattle aligned with previous reports from Hebei (12.6%, 346/2746) [61], Shanxi (13.0%, 103/795) [71], Spain (13.3%, 118/890) [1, 48], and Egypt (13.9%, 78/563) [2, 41], but exceeded rates in America (4.3%, 112/2616) [21, 36, 54] and Korea (6.7%, 101/1512) [34]. These figures were nevertheless lower than the meta-analysis estimates for China (14.8%), Asia (16.9%), and the worldwide (15.4%) data from more than 18,000 samples (Table S2). Evidently, the prevalence of Blastocystis in pigs in regions south of the Changjiang River in China (e.g., Hainan, Hunan, Jiangxi, and Fujian) is higher than in regions north of the river. Beyond geographic and climatic influences, prevalence variations may reflect differences in environmental sanitation, production systems, detection methodologies, and livestock breed susceptibility [9, 51, 52, 65]. Further research is warranted to elucidate the factors driving this epidemiological variability.

The phylogenetic analysis demonstrated that all six known subtypes (ST5, ST10, ST21, ST23, ST25, and ST26) clustered within their respective subtype branches (Fig. 2). ST5, naturally hosted by hoofed animals including pigs, cattle, sheep, and camels, was the sole subtype detected in Hainan’s domestic pigs and was also found in one cattle specimen (Table 1). This finding aligns with global data from 54 surveys across 26 countries involving more than 5,600 Blastocystis-positive samples, where ST5 emerged as the predominant subtype in domestic pigs worldwide, particularly across Southeast Asian countries, including Cambodia [67], Indonesia [73], the Philippines [3], Thailand [46, 63], and Vietnam [6] (Table S1). A large number of studies have documented ST5 in cattle from various regions, including the United States [36, 54], Iran [39, 58], Malaysia [29, 49], and Türkiye [44] (Table S2). Although ST5 infections are considered rare in humans, cases have been reported in China [22, 75], Argentina [5], Cambodia [67], Türkiye [11], Malaysia [33], Syria [19] and Thailand [46]. These infections occur predominantly among individuals who cohabit with domestic animals [5] or work on commercial intensive pig farms [46, 67], suggesting zoonotic transmission through close animal contact or exposure to waste products from infected animals [15, 45, 46]. In our study, ST10 and ST23 were identified in 7 and 2 cattle specimens, respectively. ST10 represents the most prevalent subtype in cattle globally, as evidenced by meta-analysis of more than 18,000 samples from 25 countries (Table S2). While ST10 was initially considered primarily herbivore-associated with minimal reported human infections [56], it has since been documented in human populations in Egypt [41], Senegal [31], Vietnam [42], and Thailand [28]. Similarly, ST23 was identified as the dominant subtype in 12 human cases in Thailand [28], indicating its zoonotic potential and public health significance. Therefore, in subsequent studies, we will focus on investigating the colonization of zoonotic Blastocystis subtypes (particularly ST5, ST10, and ST23) among farm workers and in environmental samples (soil and waste water) in Hainan, while analyzing their transmission routes and assessing potential public health risks.

ST21, though uncommon in cattle worldwide (Table S2), showed unexpectedly high prevalence in Hainan cattle, consistent with findings from northern Spain [1]. ST26, another predominant subtype in Hainan cattle, has been frequently reported in Bangladesh [30], China [16, 68, 71] Colombia [4], and Spain [1]. ST25, detected in two Hainan cattle, appears sporadically in Malaysia [49], Portugal [25], Spain [1], Türkiye [14], and northeastern China [20]. Notably, ST21, ST25, and ST26 are considered non-zoonotic subtypes [14] and have not been identified in human infections.

Furthermore, this study identified and characterized two novel sequences: an ST5 variant (OQ048307) from pigs showing 99.78% identity with MN472768 (isolated from an ostrich in Brazil) [37] and an ST10 variant (OQ048308) from cattle demonstrating 99.79% identity with MZ664504 (from Spanish cattle) [1] (Fig. 2A and 2B). These discoveries expand our understanding of Blastocystis genetic diversity. Significantly, all six identified subtypes (ST5, ST10, ST21, ST23, ST25, and ST26) have been detected in water sources globally [10, 35], suggesting their potential for waterborne transmission [43]. To better understand Blastocystis epidemiology and transmission dynamics, and to effectively address this public health concern, future studies should incorporate larger sample sizes, diverse sample types, and human epidemiological data.

Conclusions

This study represents the first investigation of Blastocystis colonization and subtype distribution in domestic pigs and cattle in Hainan, China. The overall prevalence rates were 30.3% (138/456) in pigs and 13.2% (40/302) in cattle. Six known subtypes (ST5, ST10, ST21, ST23, ST25, and ST26) were identified, along with two novel sequences: an ST5 variant (GenBank accession OQ048307) from pigs and an ST10 variant (OQ048308) from cattle. These findings provide valuable baseline data for future studies on Blastocystis epidemiology in domestic animals and inform infection control strategies in tropical regions.

Acknowledgments

We would like to extend our gratitude to all the institutions and individuals who participated and provided their kind assistance, especially generous permission and collaboration in the sample collection process from the Institute of Animal Science and Veterinary Medicine, Hainan Academy of Agricultural Sciences and Hainan Tropical Infectious Diseases Biobank.

Funding

This work was supported by the National Natural Science Foundation of China (No. 82060375), High-level talents project of Hainan Natural Science Foundation (Nos. 822RC695 and 824RC516), Academic Enhancement Support Program Project of Hainan Medical University (No. XSTS2025198), Hainan Medical University Talent Development Project (No. XRC2021002), Hainan Province Science and Technology Special Fund (No. ZDYF2023SHFZ146), and College Student Innovation and Entrepreneurship Training Program Project (No. S202411810053).

Conflicts of interest

The authors declare that they have no conflicts of interest.

Data availability statement

The datasets supporting the results of this article have been submitted to GenBank and accession numbers are shown in the article. All relevant data are within the article. The sequence data were submitted to the GenBank database under the accession numbers: OQ727477OQ727487, OQ727489OQ727501, OQ048307, and OQ048308.

Author contribution statement

YZ, WZ, and GL conceived and designed the study. YZ, JQL, XYL, and YW performed the experiments and analyzed the data. XHL, GXR, XYY, QY, YFZ, SL, and YXW participated in the collection of fecal samples and implementation of the study. YL, RL, and TTL participated in data analysis and project administration. YZ wrote the manuscript. WZ and GL critically edited the manuscript. All authors reviewed and agreed to the published version of the manuscript.

Supplementary materials

Table S1: The prevalence and subtypes distribution of Blastocystis in domestic pigs worldwide. Access here

Table S2: The prevalence and subtypes distribution of Blastocystis in cattle worldwide. Access here

References

  1. Abarca N, Santín M, Ortega S, Maloney JG, George NS, Molokin A, Cardona GA, Dashti A, Köster PC, Bailo B, Hernández-de-Mingo M, Muadica AS, Calero-Bernal R, Carmena D, González-Barrio D. 2021. Molecular detection and characterization of Blastocystis sp. and Enterocytozoon bieneusi in cattle in northern Spain. Veterinary Sciences, 8, 9191. [CrossRef] [PubMed] [Google Scholar]
  2. Abdo SM, El-Adawy H, Farag HF, El-Taweel HA, Elhadad H, El-Badry AA-M. 2021. Detection and molecular identification of Blastocystis isolates from humans and cattle in northern Egypt. Journal of Parasitic Diseases, 45(3), 738–745. [Google Scholar]
  3. Adao DEV, Rivera WL. 2024. Subtype–host patterns and genetic differentiation of Blastocystis sp. in the Philippines. Heliyon, 10(7), e29019. [Google Scholar]
  4. Adriana H, Giovanny H, Paula J, Diego G-C, Martin P-M, Diana M B-C, Juan Carlos P, Darwin A M-P, Jenny GM, Mónica S, Juan David R. 2021. Identification of multiple Blastocystis subtypes in domestic animals from Colombia using amplicon-based next generation sequencing. Frontiers in Veterinary Science, 8, 732129. [CrossRef] [PubMed] [Google Scholar]
  5. Alegre RE, Vaschalde PJ, Milano F, Monje LD. 2025. Blastocystis in humans and domestic animals: risk factors assessment and potential zoonotic transmission in a periurban and rural region of Northeastern Argentina. Parasitology International, 106, 103035. [Google Scholar]
  6. Alfellani MA, Taner-Mulla D, Jacob AS, Imeede CA, Yoshikawa H, Stensvold CR, Clark CG. 2013. Genetic diversity of Blastocystis in livestock and zoo animals. Protist, 164(4), 497–509. [CrossRef] [PubMed] [Google Scholar]
  7. Asghari A, Hassanipour S, Hatam G. 2021. Comparative molecular prevalence and subtypes distribution of Blastocystis sp. a potentially zoonotic infection isolated from symptomatic and asymptomatic patients in Iran: a systematic review and meta-analysis. Acta Parasitologica, 66(3), 745–759. [Google Scholar]
  8. Asghari A, Sadeghipour Z, Hassanipour S, Abbasali Z, Ebrahimzadeh-Parikhani H, Hashemzaei M, Alimardani V, Hatam G. 2021. Association between Blastocystis sp. infection and immunocompromised patients: a systematic review and meta-analysis. Environmental Science and Pollution Research International, 28(43), 60308–60328. [CrossRef] [PubMed] [Google Scholar]
  9. Asghari A, Sadrebazzaz A, Shamsi L, Shams M. 2021. Global prevalence, subtypes distribution, zoonotic potential, and associated risk factors of Blastocystis sp. in domestic pigs (Sus domesticus) and wild boars (Sus scrofa): A systematic review and meta-analysis. Microbial Pathogenesis, 160, 105183. [Google Scholar]
  10. Attah AO, Sanggari A, Li LI, Nik Him NAII, Ismail AH, Meor Termizi FH. 2022. Blastocystis occurrence in water sources worldwide from 2005 to 2022: a review. Parasitology Research, 122(1), 1–10. [Google Scholar]
  11. Aydemir S, Barlik F, Yurekturk S, Saygin M, Unlu AH, Ekici A, Yilmaz H. 2024. Prevalence of Blastocystis infection in humans in Türkiye: a systematic review and meta-analysis. Microbial Pathogenesis, 195, 106876. [Google Scholar]
  12. Baek S, Maloney JG, Molokin A, George NS, Vecino JAC, Santin M. 2022. Diversity of Blastocystis subtypes in horses in Colombia and identification of two new subtypes. Microorganisms, 10(9), 1693. [Google Scholar]
  13. Böhm-Gloning B, Knobloch J, Walderich B. 1997. Five subgroups of Blastocystis hominis from symptomatic and asymptomatic patients revealed by restriction site analysis of PCR-amplified 16S-like rDNA. Tropical Medicine & International Health, 2(8), 771–778. [CrossRef] [PubMed] [Google Scholar]
  14. Çelik BA. 2023. First report of Blastocystis subtype ST25 in calves in Turkey. Polish Journal of Veterinary Sciences, 26(2), 195–201. [Google Scholar]
  15. ChaoQun N, ZhuHua H, JunHu C, Lin A, LiGuang T. 2020. Epidemiology of Blastocystis infection from 1990 to 2019 in China. Infectious Diseases of Poverty, 9(1), 168. [CrossRef] [PubMed] [Google Scholar]
  16. Chen H, Hao Y, Liu Y, Xu M, Zhang W, Li H, Yang F. 2023. The frequency and subtype distribution of Blastocystis sp. in humans and domestic animals in households in Heilongjiang Province, China. Acta Tropica, 240, 106844. [Google Scholar]
  17. Clark CG, van der Giezen M, Alfellani MA, Stensvold CR. 2013. Recent developments in Blastocystis research. Advances in Parasitology, 82, 1–32. [CrossRef] [PubMed] [Google Scholar]
  18. Danišová O, Valenčáková A. 2021. First detection of Blastocystis sp. in pigs in Slovakia and in Europe. Parasitology International, 81, 102235. [Google Scholar]
  19. Darwish B, Aboualchamat G, Nahhas SA. 2023. Molecular characterization of Blastocystis subtypes in symptomatic patients from the southern region of Syria. PLoS One, 18(3), e0283291. [CrossRef] [PubMed] [Google Scholar]
  20. Duan J, Qin H, Sun M, Fu Y, Lang J, Zhang A, Qin Z, Guo Z, Xu H, Li X, Wang C, Zhang L. 2024. Occurrence and genotypic identification of Blastocystis sp., Enterocytozoon bieneusi, and Giardia duodenalis in dairy cattle in Heilongjiang Province, China. Parasitology International, 100, 102871. [CrossRef] [PubMed] [Google Scholar]
  21. Fayer R, Santin M, Macarisin D. 2012. Detection of concurrent infection of dairy cattle with Blastocystis, Cryptosporidium, Giardia, and Enterocytozoon by molecular and microscopic methods. Parasitology Research, 111(3), 1349–1355. [CrossRef] [PubMed] [Google Scholar]
  22. Fu X, Lyu J, Shi Y, Cao B, Liu D, Yang X, Huang L, Liang Q, Liao D, He S. 2024. Epidemiological survey on prevalence and subtypes distribution of Blastocystis sp. in Southern Guizhou, China. Biomolecules and Biomedicine, 24, 11303. [Google Scholar]
  23. Fu Y, Zhang K, Yang M, Li X, Chen Y, Li J, Xu H, Dhakal P, Zhang L. 2023. Metagenomic analysis reveals the relationship between intestinal protozoan parasites and the intestinal microecological balance in calves. Parasites & Vectors, 16(1), 257. [Google Scholar]
  24. Gao S, Wang J, Wu X, Luo X, Li Q, Chen D, Liu X, Li W. 2023. Molecular detection and subtyping of Blastocystis sp. in pigs in Anhui Province. Zhongguo Xue Xi Chong Bing Fang Zhi Za Zhi, 35(05), 508–512. [Google Scholar]
  25. Gomes-Gonçalves S, Silva A, Moreira G, Gantois N, Dominguez RG, Viscogliosi E, Chabé M, Mesquita JR. 2025. First report on the frequency and subtype distribution of Blastocystis sp. in extensively reared holstein-friesian cattle from Terceira Island, Azores Archipelago, Portugal. Animals, 15(2), 186. [Google Scholar]
  26. Han JQ, Li Z, Zou Y, Pu LH, Zhu XQ, Zou FC, Huang CQ. 2020. Prevalence, molecular characterization and risk factors of Blastocystis sp. from farmed pigs in Yunnan Province, Southwestern China. Acta Parasitologica, 65(4), 1005–1010. [CrossRef] [PubMed] [Google Scholar]
  27. Hublin JSY, Maloney JG, Santin M. 2021. Blastocystis in domesticated and wild mammals and birds. Research in Veterinary Science, 135, 260–282. [CrossRef] [PubMed] [Google Scholar]
  28. Jinatham V, Maxamhud S, Popluechai S, Tsaousis AD, Gentekaki E. 2021. Blastocystis one health approach in a rural community of northern Thailand: Prevalence, subtypes and novel transmission routes. Frontiers in Microbiology, 12, 746340. [Google Scholar]
  29. Kamaruddin SK, Yusof AM, Mohammad M. 2020. Prevalence and subtype distribution of Blastocystis sp. in cattle from Pahang, Malaysia. Asian Pacific Journal of Tropical Biomedicine, 37(1), 127–141. [Google Scholar]
  30. Karim MR, Harun AB, Bayazid AA, Siddiki SHMF, Li J, Zhang L. 2024. Molecular investigation of Blastocystis in children and calves in Bangladesh. BMC Microbiology, 24(1), 316. [Google Scholar]
  31. Khaled S, Gantois N, Ly AT, Senghor S, Even G, Dautel E, Dejager R, Sawant M, Baydoun M, Benamrouz-Vanneste S, Chabe M, Ndiaye S, Schacht A-M, Certad G, Riveau G, Viscogliosi E. 2020. Prevalence and subtype distribution of Blastocystis sp. in Senegalese school children. Microorganisms, 8(9), 1408. [CrossRef] [Google Scholar]
  32. Kumarasamy V, Anbazhagan D, Subramaniyan V, Vellasamy S. 2018. Blastocystis sp., parasite associated with gastrointestinal disorders: An overview of its pathogenesis, immune modulation and therapeutic strategies. Current Pharmaceutical Design, 24(27), 3172–3175. [Google Scholar]
  33. Kumarasamy V, Rajamanikam A, Anbazhagan D, Atroosh WM, Azzani M, Subramaniyan V, Abdullah SR. 2023. Systematic review and meta-analysis: Epidemiology of human Blastocystis spp. infection in Malaysia. Tropical Medicine and Infectious Disease, 8(8), 415. [Google Scholar]
  34. Lee H, Lee SH, Seo MG, Kim HY, Kim JW, Lee YR, Kim JH, Kwon OD, Kwak D. 2018. Occurrence and genetic diversity of Blastocystis in Korean cattle. Veterinary Parasitology, 258, 70–73. [Google Scholar]
  35. Mahdavi F, Maleki F, Mohammadi MR, Mehboodi M, Hanifeh F, Asghari A, Mohammadi-Ghalehbin B. 2024. A worldwide systematic review and meta-analysis of the prevalence and subtype distribution of Blastocystis sp. in water sources: a public health concern. Foodborne Pathogens and Disease, 10, 1089. [Google Scholar]
  36. Maloney JG, Lombard JE, Urie NJ, Shivley CB, Santin M. 2018. Zoonotic and genetically diverse subtypes of Blastocystis in US pre-weaned dairy heifer calves. Parasitology Research, 118(2), 575–582. [Google Scholar]
  37. Maloney JG, Molokin A, MJRd Cunha, Cury MC, Santin M. 2020. Blastocystis subtype distribution in domestic and captive wild bird species from Brazil using next generation amplicon sequencing. Parasite Epidemiology and Control, 9C, e00138. [Google Scholar]
  38. Miao W, Zhang N, Wu R, Cui L, Cao H, Qi B, Zhou D. 2021. Molecular epidemiological investigation and subtype analysis of Blastocystis in swine farms in Fujian. Chinese Journal of Preventive Veterinary Medicine, 43(6), 658–661. [Google Scholar]
  39. Mohammad Rahimi H, Mirjalali H, Zali MR. 2021. Molecular epidemiology and genotype/subtype distribution of Blastocystis sp., Enterocytozoon bieneusi, and Encephalitozoon spp. in livestock: concern for emerging zoonotic infections. Scientific Reports, 11(1), 17467. [CrossRef] [PubMed] [Google Scholar]
  40. Naguib D, Gantois N, Desramaut J, Arafat N, Even G, Certad G, Chabé M, Viscogliosi E. 2022. Prevalence, subtype distribution and zoonotic significance of Blastocystis sp. isolates from poultry, cattle and pets in northern Egypt. Microorganisms, 10(11), 2259. [Google Scholar]
  41. Naguib D, Gantois N, Desramaut J, Arafat N, Mandour M, Abdelmaogood AKK, Mosa AF, Denoyelle C, Even G, Certad G, Chabé M, Viscogliosi E. 2023. Molecular epidemiology and genetic diversity of the enteric protozoan parasite Blastocystis sp. in the northern Egypt population. Pathogens, 12(11), 1359. [CrossRef] [PubMed] [Google Scholar]
  42. Nguyen LDN, Gantois N, Hoang TT, Do BT, Desramaut J, Naguib D, Tran TN, Truong AD, Even G, Certad G, Chabé M, Viscogliosi E. 2023. First epidemiological survey on the prevalence and subtypes distribution of the enteric parasite Blastocystis sp. in Vietnam. Microorganisms, 11(3), 731. [CrossRef] [PubMed] [Google Scholar]
  43. Noradilah SA, Lee IL, Anuar TS, Salleh FM, Manap SNAA, Mohtar NSHM, Azrul SM, Wan Omar Abdullah NM. 2016. Occurrence of Blastocystis sp. in water catchments at Malay villages and aboriginal settlement during wet and dry seasons in Peninsular Malaysia. PeerJ, 4, e2541. [Google Scholar]
  44. Öner TÖ, Karakavuk M, Döşkaya AD, Güvendi M, Gül A, Köseoğlu AE, Alak SE, Gürüz AY, Ün C, Döşkaya M, Can H. 2022. Molecular prevalence of Blastocystis sp. and subtype diversity in fecal samples collected from cattle in dairy farms in Turkey. Comparative Immunology Microbiology and Infectious Diseases, 87, 101850. [Google Scholar]
  45. Parkar U, Traub RJ, Vitali S, Elliot A, Levecke B, Robertson I, Geurden T, Steele J, Drake B, Thompson RCA. 2010. Molecular characterization of Blastocystis isolates from zoo animals and their animal-keepers. Veterinary Parasitology, 169(1–2), 8–17. [CrossRef] [PubMed] [Google Scholar]
  46. Pintong A-R, Sunyanusin S, Prasertbun R, Mahittikorn A, Mori H, Changbunjong T, Komalamisra C, Sukthana Y, Popruk S. 2018. Blastocystis subtype 5: Predominant subtype on pig farms, Thailand. Parasitology International, 67(6), 824–828. [CrossRef] [PubMed] [Google Scholar]
  47. Popruk S, Adao DEV, Rivera WL. 2021. Epidemiology and subtype distribution of Blastocystis in humans: A review. Infection Genetics and Evolution, 95, 105085. [CrossRef] [Google Scholar]
  48. Quílez J, Sánchez-Acedo C, Clavel A, Causapé AC. 1995. Occurrence of Blastocystis sp. in cattle in Aragon, northeastern Spain. Parasitology Research, 81, 703–705. [Google Scholar]
  49. Rauff-Adedotun AA, Lee IL, Talib NA, Shaari N, Yahaya ZS, Termizi FHM. 2023. Prevalence, potential risk factors and genetic diversity of Blastocystis in ruminant livestock animals from Penang, Malaysia. Parasitology Research, 122(9), 2193–2205. [Google Scholar]
  50. Ren M, Song J, Yang F, Zou M, Wang P, Wang D, Zhang H, Zhao G, Lin Q. 2019. First genotyping of Blastocystis in yaks from Qinghai Province, northwestern China. Parasites & Vectors, 12(1), 171. [CrossRef] [PubMed] [Google Scholar]
  51. Rivero-Juárez A, Dashti A, Santín M, Köster PC, López-López P, Risalde MA, García-Bocanegra I, Gómez-Villamandos JC, Caballero-Gómez J, Frías M, Bailo B, Ortega S, Muadica AS, Calero-Bernal R, González-Barrio D, Rivero A, Briz V, Carmena D. 2021. Diarrhoea-causing enteric protist species in intensively and extensively raised pigs (Sus scrofa domesticus) in Southern Spain. Part II: Association with Hepatitis E virus susceptibility. Transboundary and Emerging Diseases 69(4), e1172–e1178. [Google Scholar]
  52. Rozani NS, Aazmi MS, Attah AO, Meor Termizi FH, Shahrizal S, Idorus MY, Muslim A. 2025. Blastocystis colonization among inland and forest periphery Negritos in Malaysia: the crucial role of sanitation and hygiene practices. Parasitology International, 108, 103075. [Google Scholar]
  53. Santin M, Figueiredo A, Molokin A, George NS, Koester PC, Dashti A, Gonzalez-Barrio D, Carmena D, Maloney JG. 2024. Division of Blastocystis ST10 into three new subtypes: ST42-ST44. Journal of Eukaryotic Microbiology, 71(1), e12998. [CrossRef] [PubMed] [Google Scholar]
  54. Santin M, Molokin A, Maloney JG. 2023. A longitudinal study of Blastocystis in dairy calves from birth through 24 months demonstrates dynamic shifts in infection rates and subtype prevalence and diversity by age. Parasites & Vectors, 16(1), 177. [Google Scholar]
  55. Sen L, Ping W, Xing Quan Z, Yang Z, Xiao Qing C. 2022 Prevalence and genotypes/subtypes of Enterocytozoon bieneusi and Blastocystis sp. in different breeds of cattle in Jiangxi Province, southeastern China. Infection Genetics and Evolution, 98, 105216. [Google Scholar]
  56. Shams M, Asghari A, Baniasad M, Shamsi L, Sadrebazzaz A. 2022. Blastocystis sp. in small ruminants: a universal systematic review and meta-analysis. Acta Parasitologica, 67(3), 1073–1085. [CrossRef] [PubMed] [Google Scholar]
  57. Shams M, Shamsi L, Sadrebazzaz A, Asghari A, Badali R, Omidian M, Hassanipour S. 2021. A systematic review and meta-analysis on the global prevalence and subtypes distribution of Blastocystis sp. infection in cattle: A zoonotic concern. Comparative Immunology Microbiology and Infectious Diseases, 76, 101650. [CrossRef] [PubMed] [Google Scholar]
  58. Sharifi Y, Abbasi F, Shahabi S, Zaraei A, Mikaeili F, Sarkari B. 2020. Comparative genotyping of Blastocystis infecting cattle and human in the south of Iran. Comparative Immunology Microbiology and Infectious Diseases, 72, 101529. [Google Scholar]
  59. Song JK, Hu RS, Fan XC, Wang SS, Zhang HJ, Zhao GH. 2017. Molecular characterization of Blastocystis from pigs in Shaanxi province of China. Acta Tropica, 173, 130–135. [CrossRef] [PubMed] [Google Scholar]
  60. Stensvold CR, Clark CG. 2020. Pre-empting Pandora’s Box: Blastocystis subtypes revisited. Trends in Parasitology, 36(3), 229–232. [CrossRef] [PubMed] [Google Scholar]
  61. Sun Y, Nan H, Zhang C, Yang X, Zhao Y, Feng G, Ma L. 2024. Genetic characteristics of Blastocystis sp. in cattle from Hebei Province, China. Microbial Pathogenesis, 190, 106629. [Google Scholar]
  62. Tamura K, Stecher G, Kumar S, Battistuzzi FU. 2021. MEGA11: Molecular Evolutionary Genetics Analysis Version 11. Molecular Biology and Evolution, 38(7), 3022–3027. [CrossRef] [PubMed] [Google Scholar]
  63. Udonsom R, Prasertbun R, Mahittikorn A, Mori H, Changbunjong T, Komalamisra C, Pintong A-R, Sukthana Y, Popruk S. 2018. Blastocystis infection and subtype distribution in humans, cattle, goats, and pigs in central and western Thailand. Infection Genetics and Evolution, 65, 107–111. [Google Scholar]
  64. Wang J, Gong B, Yang F, Zhang W, Zheng Y, Liu A. 2018. Subtype distribution and genetic characterizations of Blastocystis in pigs, cattle, sheep and goats in northeastern China’s Heilongjiang Province. Infection Genetics and Evolution, 57, 171–176. [CrossRef] [Google Scholar]
  65. Wang P, Li S, Zou Y, Hong ZW, Wang P, Zhu XQ, Song DP, Chen XQ. 2021. Prevalence and subtype distribution of Blastocystis sp. in diarrheic pigs in Southern China. Pathogens, 10(9), 1189. [CrossRef] [PubMed] [Google Scholar]
  66. Wang R, Zhang Y, Jiang Y, Xing J, Tao D, Qi M. 2020. First report of Blastocystis infection in pigs from large farms in Xinjiang, China. Journal of Eukaryotic Microbiology, 67(6), 642–647. [Google Scholar]
  67. Wang W, Owen H, Traub RJ, Cuttell L, Inpankaew T, Bielefeldt-Ohmann H. 2014. Molecular epidemiology of Blastocystis in pigs and their in-contact humans in Southeast Queensland, Australia, and Cambodia. Veterinary Parasitology, 203(3–4), 264–269. [CrossRef] [PubMed] [Google Scholar]
  68. Wang X, Xue NY, Qin LT, Liu YY, Wang HX, Zhao Q, Ni HB, Lyu C. 2021. Molecular characterization of Blastocystis from beef cattle in northeastern China. Vector-Borne and Zoonotic Diseases, 21(12), 955–960. [Google Scholar]
  69. Wei CN, Qin RL, Zhang ZH, Zheng WB, Liu Q, Gao WW, Zhu XQ, Xie SC. 2023. Prevalence and genetic characterization of Blastocystis in sheep and pigs in Shanxi Province, North China: from a public health perspective. Animals, 13(18), 2843. [Google Scholar]
  70. World Health Organization. 2017. Guidelines for drinking-water quality, Fourth edition, Incorporating the first addendum. World Health Organization: Geneva, Switzerland. pp. 271–273. [Google Scholar]
  71. Yao L, Ya Ya L, Jin Jin M, Wen Bin Z, Qing L, Wen Wei G, Xing Quan Z, Shi Chen X. 2023. Molecular identification and genotyping of Cryptosporidium spp. and Blastocystis sp. in cattle in representative areas of Shanxi Province, north China. Animals, 13(18), 2929. [CrossRef] [PubMed] [Google Scholar]
  72. Yoshikawa H, Koyama Y, Tsuchiya E, Takami K. 2016. Blastocystis phylogeny among various isolates from humans to insects. Parasitology International, 65, 750–759. [Google Scholar]
  73. Yoshikawa H, Tokoro M, Nagamoto T, Arayama S, Asih PB, Rozi IE, Syafruddin D. 2016. Molecular survey of Blastocystis sp. from humans and associated animals in an Indonesian community with poor hygieneParasitology International, 65(6 Pt B), 780–784. [CrossRef] [PubMed] [Google Scholar]
  74. Yu X, Mu X, Yuan K, Wang S, Li Y, Xu H, Li Q, Zeng W, Li Z, Guo J, Hong Y. 2024. Occurrence and genotypic identification of Blastocystis spp. and Enterocytozoon bieneusi in bamaxiang pigs in Bama Yao Autonomous County of Guangxi Province, China. Animals, 14(22), 3344. [Google Scholar]
  75. Zhu W, Wei Z, Li Q, Lin Y, Yang H, Li W. 2020. Prevalence and subtype diversity of Blastocystis in human and nonhuman primates in North China, Parasitology Research, 119(8), 2719–2725. [CrossRef] [PubMed] [Google Scholar]
  76. Zou Y, Yang WB, Zou FC, Lin RQ, Zhu XQ, Hou JL. 2021. Molecular detection and subtype distribution of Blastocystis in farmed pigs in southern China. Microbial Pathogenesis, 151, 104751. [Google Scholar]

Cite this article as: Zhang Y, Li J, Lai X, Wang Y, Li X, Ren G, Yu X, Li Y, Liu R, Qiang Y, Li T, Zhou Y, Lei S, Wu Y, Zhao W & Lu G. 2025. Molecular characterization and zoonotic potential of Blastocystis subtypes in domestic pigs and cattle from Hainan, a tropical island province in China. Parasite 32, 77. https://doi.org/10.1051/parasite/2025070.

All Tables

Table 1

Risk factors associated with prevalence and subtype distribution of Blastocystis in domestic pigs and cattle in Hainan, China.

All Figures

thumbnail Figure 1

Map of sampling regions of domestic pigs and cattle in Hainan, China.

In the text
thumbnail Figure 2

Phylogenetic analysis by Neighbor-Joining (A) and Maximum Likelihood (B) methods of Blastocystis isolates based on SSU rDNA gene sequences in this study. The known and novel sequences identified in this study are indicated by black squares and red circles, respectively. The sequence of Proteromonas lacertae (U37108) was as an outgroup.

In the text
thumbnail Figure 3

SSU rDNA gene sequence polymorphism among novel and known sequences of ST5 (A) and ST10 (B) with the reference sequence.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.