EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 32 (2025) Parasite, 32 (2025) 11 Full HTML
Open Access
Issue
Parasite
Volume 32, 2025
Article Number 11
Number of page(s) 7
DOI https://doi.org/10.1051/parasite/2025006
Published online 17 February 2025

© Z. Cui et al., published by EDP Sciences, 2025

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Blastocystis sp. is a common single-celled gastrointestinal protozoan found in humans and many other mammalian species [5]. It is estimated that over one billion individuals worldwide are colonized or infected with Blastocystis sp. [6]. The potential positive effect of this organism on the gut microbiome, as well as the situations in which its presence causes symptomatic infection, is being intensively studied [9, 25]. The transmission of Blastocystis primarily occurs via the fecal-oral route or through indirect contact, resulting in a higher prevalence rate in places with poor sanitary conditions [1]. Moreover, certain subtypes of Blastocystis sp. exhibit a high prevalence among individuals with irritable bowel syndrome (IBS), resulting in a variety of gastrointestinal symptoms, including diarrhea, nausea, and abdominal pain [7, 28]. In general, the manifestation and severity of clinical symptoms, as well as the disease’s overall impact, are influenced by various subtypes of Blastocystis [2, 10, 23].

Blastocystis is well-known for its morphological polymorphism and genetic diversity, and there is a likelihood of discovering more subtypes in the future [32]. To date, the subtyping of Blastocystis has enabled the identification of at least 44 proposed subtypes (STs) at the SSU rDNA locus, including some of the most widely recognized and accepted subtypes, such as ST1–ST17, ST21, and ST23–ST48 [18, 31, 32]. Among these subtypes, 17 have been documented in humans, including ST1 to ST10, ST12, ST14–ST16, ST23, ST35, and ST41 [12, 26]. These subtypes have also been identified in other mammals and birds, suggesting the potential for zoonotic transmission [5, 30]. Although Blastocystis STs lack host specificity, ST1–ST3 are most commonly identified in both humans and NHPs (non-human primates), while ST6 and ST7 are primarily associated with avian species, especially poultry, and are generally considered avian-adapted subtypes [29, 38]. ST10 and ST14, on the other hand, are most frequently found in ungulates [15, 27]. Therefore, accurately identifying the subtypes of Blastocystis in different hosts through molecular characterization is crucial for understanding its zoonotic transmission and its impact on public health.

The Bird Park is a bird culture theme park located in Henan Province, covering an area of over 600 acres. It has been rated as a national 4A level tourist attraction. Visitors have the opportunity to engage directly with wild animals in captivity, which poses a higher risk of zoonotic Blastocystis infection. A previous study showed that the same genetic variants are present simultaneously among animals and their caretakers, as well as in non-human primates’ zookeepers, providing strong evidence for the transmission of Blastocystis from animals to humans and vice versa [17].

The objectives of this study were to investigate the occurrence and genetic diversity of Blastocystis in captive wild animals at the Bird Park in Henan Province, Central China, and to evaluate the potential risk of zoonotic transmission between humans and animals.

Materials and methods

Ethics statement

Before initiating this study, the research protocol was reviewed and approved by the Ethics Review Committee of Xuchang University. The collection of stool samples was conducted following the acquisition of appropriate authorization from the zoo managers. It is important to note that no animals were subjected to any form of harm during the collection process of fecal samples.

Study sites and collection of animal samples

A total of 204 fresh fecal samples were collected from a variety of captive wild animals from October to December, 2023. Each fecal sample was collected from a single individual animal. Fecal samples from birds and other animals were collected using swabs for birds and sterile gloves for other animals and were then preserved in sterile centrifuge tubes of 15 mL, and labeled with the region of collection and the animal species. The fecal samples were securely packaged with ice packs and transported to the laboratory. Upon arrival, all samples were stored at −20 °C until DNA extraction.

DNA extraction

The samples were collected from the −20 °C freezer and washed twice with double distilled water by centrifugation at 12,000× g for 3 min to remove impurities, and 200 mg of sediment from each sample was used for the extraction of genomic DNA, using a TIANamp Stool DNA kit (TIANGEN, Beijing, China), according to the manufacturer’s specifications. Each DNA extraction product was stored at −20 °C for subsequent PCR amplification.

PCR amplification and subtype identification

The prevalence and genotypes of Blastocystis sp. were examined using PCR, specifically targeting the region of approximately 600 bp of the SSU rRNA gene [19]. The primers used in this study were: RD5: 5′–ATCTGGTTGATCCTGCCAGT–3’; BhRDr: 5′–GAGCTTTTTAACTGCAACAACG–3′. The annealing temperature was set at 55 °C. The PCR mixture (25 μL) contained 2.5 μL 10× ExTaq buffer (Mg2+ free), 1.5 mM MgCl2, 0.2 mM deoxyribonucleoside triphosphate (dNTP), 0.625 U of ExTaq DNA polymerase (Takara, Dalian, China), 2 μL genomic DNA, and 0.4 μM of each primer. Each PCR reaction included positive and negative controls. Six microliters of PCR products were subjected to electrophoresis using 1.5% agarose gel electrophoresis and visualized under UV light after staining with Exred (Zoman, Beijing, China).

Nucleotide sequencing and phylogenetic analysis

The amplified PCR products, approximately 600 base pairs in length, were subjected to sequencing using the primer RD5/BhRDr, in the process of PCR amplification conducted by Sangon Biotech (Shanghai, China) using an ABI 730 Auto-sequencer. The obtained nucleotide sequences were subsequently edited with Clustal X (http://www.clustal.org) and Chromas Pro (http://technelysium.com.au/ChromasPro.html). To identify overlooked mixed infections and double peaks, as well as any unclear positions, the raw chromatograms of both sequences for each sample were thoroughly examined visually. The consensus sequences were then validated as Blastocystis SSU rRNA gene sequences through BLAST alignment NCBI (https://blast.ncbi.nlm.nih.gov/Blast.cgi) based on homology identification. Following this, the subtypes of Blastocystis sp. isolates were identified by an online platform: Blastocystis locus/sequence definitions database (https://pubmlst.org/bigsdb?db=pubmlst_blastocystis_seqdef).

Six representative sequences from this study and reference sequences download from GenBank within NCBI were aligned and analyzed with Clustal W embedded in the MEGA 7 program (http://www.megasoftware.net/). In the final dataset, there were 594 sequence sites left after trimming the alignment, and all ambiguous positions were removed for each sequence pair (pairwise deletion option). To identify Blastocystis sp. subtypes, the phylogenetic analysis of Blastocystis sp. obtained from this study was compared with the known subtypes with neighbor-joining (NJ) analyses. The Kimura 2-parameter model and bootstrap method were used to assess the robustness of the clusters using 1,000 replicates, where only branch support values above 50% were retained.

Nucleotide sequence accession numbers

The representative nucleotide sequences of the present study were submitted to GenBank under accession numbers PQ740455–PQ740456.

Results

The prevalence of Blastocystis sp. in captive wild animals

The overall prevalence of Blastocystis sp. in captive wild animals was found to be 13.73% (28 out of 204). Among the 20 species examined, a significant proportion, 5 (25%), tested positive for Blastocystis sp., as recorded in Table 1. The species exhibiting the highest prevalence was the bar-headed goose, with a 100% (2 out of 2) positivity rate.

Table 1

Occurrence of Blastocystis sp. in captive wildlife in Henan, China.

Following closely were the crab-eating macaque, with a positivity rate of 50% (4 out of 8), and the macaque, with a 40% (8 out of 20) positivity rate. In contrast, the prevalence of Blastocystis sp. in the peafowl was comparatively lower, representing 7.84% (8 out of 102). It is important to note that the small sample sizes of most host species precluded the establishment of statistical significance.

Subtype distributions of Blastocystis sp. in captive wild animals

Sequence alignment revealed the presence of a total of four known Blastocystis sp. subtypes, namely ST1, ST3, ST5, and ST27. Among these subtypes, ST27 was the most prevalent, found in 10 out of 28 positive samples (35.71%), followed by ST1 (32%, 8 out of 28), ST5 (21.42%, 6 out of 28), and ST3 (14.28%, 4 out of 28). Table 1 provides the distribution of the different Blastocystis sp. subtypes among the animals.

Genetic characteristics and phylogenetic analysis of Blastocystis sp. subtypes

The identity analysis of the SSU rRNA gene revealed that eight sequences of ST1 isolates identified in NHPs (macaque and crab-eating macaque) were similar to those from Macaca fascicularis philippinensis (KY929107, from 99.65% to 100%) and Macaca mulatta from Bangladesh (MN3380074, from 99.83% to 100%). The four sequences of ST3 isolates identified in the macaque were similar to those from a Rex rabbit from China (OP866804, 100%). Six sequences of ST5 isolates isolated from ostriches were similar to those from sheep in China (ON062968, 100%) and an ostrich in China (MF991106, 99.66%). ST27 was isolated for the first time from the bar-headed goose in our study. The ST27 sequences revealed 100% sequence identity with MK861944 (a peafowl isolated from China, listed as a new subtype) and shares 99.32% identity with ST27 (MW887934). Similarly, the ST27 sequence isolated from the peafowl in this study also showed 100% similarity.

In the current study, a total of 6 representative sequences were obtained from 28 Blastocystis sp. isolates. The newly acquired sequences belong to ST1, ST3, ST5, and ST27. Furthermore, the phylogenetic analysis confirmed the presence of polymorphism within the SSU rRNA gene of Blastocystis isolates (Fig. 1).

thumbnail Figure 1

Phylogenetic relationships among nucleotide sequences of barcode regions of the small subunit ribosomal RNA (SSU rRNA) of Blastocystis sp.; Blastocystis subtypes identified in the present study are indicated in bold type.

Discussion

In recent decades, a multitude of researchers have engaged in comprehensive studies regarding various facets of Blastocystis sp., yet the debate surrounding its classification, pathogenicity, subtypes, and functions persists [4, 9, 13, 25, 30]. Consequently, a thorough comprehension of the prevalence and genetic diversity of Blastocystis sp. across diverse host populations globally is essential for unraveling the enigma associated with this organism. This study aimed to address this gap by analyzing the prevalence and subtype distribution of Blastocystis sp. among captive wildlife species at the Bird Park, Henan Province, for the first time.

In the context of this study, which encompassed a total of 20 species of captive wild animals, we found that 25% (5 out of 20) tested positive for Blastocystis sp. (Table 1). The overall occurrence of Blastocystis sp. in wild animals in captivity, specifically birds at the Bird Park, was recorded at 13.73%, which is comparable with the findings in wild animals from Colombia (13.0%) [8] and wild birds in Brazil (14.7%) [21], yet lower than in domestic and zoo animals in Algeria (38.9%) [14], animals across five zoos in China (24.5%) [3], wild primates in six European zoos (20.3%) [17], and higher than in free-ranging wild birds in Xinxiang, China (1.5%) [20], and pet birds in China (0.8%) [34]. The variations in prevalence could be attributed to sampling size, detection methods, and susceptibilities of livestock to Blastocystis sp. The prevalence of Blastocystis sp. varies among different animals, which may be cause by differences in sample collection from different hosts.

Four Blastocystis STs., namely ST1, ST3, ST5, and ST27, were identified in this study from 28 samples collected from captive wild animals. Among the identified subtypes, ST1 and ST3 were observed in non-human primates (NHPs), namely macaque and the crab-eating macaque. Generally, ST1-3 has frequently been determined in humans and NHPs, and represents 95% of human infections [33, 40]. In addition, a recent study has shown that zoo animals and staff have been infected with the ST1-3 subtype of Blastocystis sp., a finding that is in alignment with previously documented sequences from NHPs [24]. Therefore, zoos are the primary areas where zoonotic transmission of Blastocystis sp. from NHPs may occur.

To date, 13 subtypes (ST1, ST3-10, ST14, and ST23-25) of Blastocystis have been detected in birds (Greater White-Fronted Goose, White Stork, Oriental White Stork, Bean Goose, Red crowned crane, Black Swan, Ruddy Shelduck, Green peafowl, Ostrich, Canary, White-rumped munia, Budgerigar, Blue-eared pheasant, Hotan Black chickens, pigeons, and Whooper swan) in China, and ST7 is the dominant subtype among them [3, 11, 20, 36, 38]. It is worth mentioning that researchers recently reported a new discovery, in which they detected Blastocystis in bar-headed geese and confirmed it as ST7 through molecular identification [37]. Since the full-length SSU rRNA gene reference sequence of ST27 (MW887934) has been reported, its barcode region can now be compared with other barcode sequences available in GenBank [21, 22]. The ST27 sequences isolated from bar-headed geese revealed 100% sequence identity with the ST27 sequence isolated from peafowls within the same study, and sharing 99.32% identity with reference sequence of ST27. The phylogenetic analysis clearly demonstrated that the sequences isolated from bar-headed geese and peafowls clustered with the reference sequence of ST27 (MW887934). Distinctly, in the present study, based on our current knowledge, this is the first report of Blastocystis ST27 in birds (bar-headed geese and peafowls) in China.

Further, the remaining six ST5 sequences isolated from ostriches have been described previously [35, 39]. ST5 was the most predominant subtype in pigs, but it was also identified in various animals, such as NHPs, cattle, sheep, rodents, and birds [16]. Notably, the detection of all zoonotic subtypes in the current study suggests a potential transmission risk of Blastocystis to humans via contact with feces.

Conclusions

This study documented the presence of Blastocystis sp. infections in various captive wildlife species within a bird park located in Henan Province, Central China. The prevalence of these infections was found to be 13.73% (28 out of 204 samples) and 25% (5 out of 20 species), marking the first identification of Blastocystis sp. ST27 in bar-headed geese and peafowls. Furthermore, three distinct zoonotic subtypes of Blastocystis sp. (ST1, ST3, and ST5) were identified across seven different host species, indicating that avian parks may serve as potential reservoirs for zoonotic Blastocystis sp. infections in humans. These findings provide fundamental data for a deeper understanding of the transmission dynamics of Blastocystis sp.

Acknowledgments

This research was funded by Natural Science Foundation of Henan (242300421590), Key Research Projects of Higher Education Institutions in Henan Province (24A230017), Key Research Projects of Xuchang University (2024ZD013, 2024YB017), Open Project of Tarim Animal Disease Diagnosis and Control Engineering Laboratory of Xinjiang Production and Construction Corps (ELDC202301).

Conflicts of interest

The authors declare that they have no conflicts of interest.

a

These authors contributed equally to the research.

References

  1. Abu-Madi M, Aly M, Behnke JM, Clark CG, Balkhy H. 2015. The distribution of Blastocystis subtypes in isolates from Qatar. Parasites & Vectors, 8, 465. [CrossRef] [PubMed] [Google Scholar]
  2. Alinaghizade A, Mirjalali H, Mohebali M, Stensvold CR, Rezaeian M. 2017. Inter- and intra-subtype variation of Blastocystis subtypes isolated from diarrheic and non-diarrheic patients in Iran. Infection, Genetics and Evolution, 50, 77–82. [CrossRef] [PubMed] [Google Scholar]
  3. An D, Jiang T, Zhang C, Ma L, Jia T, Pei Y, Zhu Z, Liu Q, Liu J. 2024. Epidemiology and molecular characterization of zoonotic gastrointestinal protozoal infection in zoo animals in China. Animals, 14(6), 853. [CrossRef] [PubMed] [Google Scholar]
  4. Aykur M, Malatyalı E, Demirel F, Cömert-Koçak B, Gentekaki E, Tsaousis AD. 2024. Blastocystis: A mysterious member of the gut microbiome. Microorganisms, 12(3), 461. [CrossRef] [PubMed] [Google Scholar]
  5. Barati M, KarimiPourSaryazdi A, Rahmanian V, Bahadory S, Abdoli A, Rezanezhad H, Solhjoo K, Taghipour A. 2022. Global prevalence and subtype distribution of Blastocystis sp. in rodents, birds, and water supplies: A systematic review and meta-analysis. Preventive Veterinary Medicine, 208, 105770. [CrossRef] [PubMed] [Google Scholar]
  6. Billy V, Lhotská Z, Jirků M, Kadlecová O, Frgelecová L, Parfrey LW, Pomajbíková KJ. 2021. Blastocystis colonization alters the gut microbiome and, in some cases, promotes faster recovery from induced colitis. Frontiers in Microbiology, 12, 641483. [CrossRef] [PubMed] [Google Scholar]
  7. Collins SM. 2014. A role for the gut microbiota in IBS. Nature Reviews Gastroenterology & Hpatology, 11(8), 497–505. [CrossRef] [PubMed] [Google Scholar]
  8. Cruz-Saavedra L, Arévalo VA, Garcia-Corredor D, Jiménez PA, Vega L, Pulido-Medellín M, Ortiz Pineda M, Ramírez JD. 2023. Molecular detection and characterization of Giardia spp., Cryptosporidium spp., and Blastocystis in captive wild animals rescued from central Colombia. International Journal for Parasitology – Parasites and Wildlife, 22, 1–5. [CrossRef] [Google Scholar]
  9. Deng L, Wojciech L, Gascoigne NRJ, Peng G, Tan KSW. 2021. New insights into the interactions between Blastocystis, the gut microbiota, and host immunity. PLoS Pthogens, 17(2), e1009253. [CrossRef] [Google Scholar]
  10. El Safadi D, Meloni D, Poirier P, Osman M, Cian A, Gaayeb L, Wawrzyniak I, Delbac F, El Alaoui H, Delhaes L, Dei-Cas E, Mallat H, Dabboussi F, Hamze M, Viscogliosi E. 2013. Molecular epidemiology of Blastocystis in Lebanon and correlation between subtype 1 and gastrointestinal symptoms. American Journal of Tropical Medicine and Hygiene, 88(6), 1203–1206. [CrossRef] [PubMed] [Google Scholar]
  11. Feng X, Xin L, Zhang B, Wang Z, Meng Z, Yu F. 2024. Molecular characterization of Blastocystis spp. in Hotan Black chickens in southern Xinjiang. Journal of Eukaryotic Microbiology, 71(2), e13012. [CrossRef] [PubMed] [Google Scholar]
  12. Fu X, Lyu J, Shi Y, Cao B, Liu D, Yang X, Huang L, Liang Q, Liao D, He S. 2024. Epidemiological survey on prevalence and subtypes distribution of Blastocystis sp. in Southern Guizhou, China. Biomolecules Biomedicine, Epub ahead of print, https://doi.org/10.17305/bb.2024.11303. [Google Scholar]
  13. Fusaro C, Bernal JE, Baldiris-Ávila R, González-Cuello R. 2024. Molecular prevalence and subtypes distribution of Blastocystis spp. in humans of Latin America: A systematic review. Tropical Medicine and Infectious Disease, 9(2), 38. [CrossRef] [PubMed] [Google Scholar]
  14. Guilane A, Haleche I, Tazerouti F, Ziam H, Kernif T, Boutellis A. 2024. New haplotypes of Blastocystis sp. identified in faeces from various animal groups in Algeria. Acta Parasitologica, 69(3), 1338–1351. [CrossRef] [PubMed] [Google Scholar]
  15. Hublin JSY, Maloney JG, Santin M. 2021. Blastocystis in domesticated and wild mammals and birds. Research in Veterinary Science, 135, 260–282. [CrossRef] [PubMed] [Google Scholar]
  16. Jiménez PA, Jaimes JE, Ramírez JD. 2019. A summary of Blastocystis subtypes in North and South America. Parasites & Vectors, 12(1), 376. [CrossRef] [PubMed] [Google Scholar]
  17. Köster PC, Martínez-Nevado E, González A, Abelló-Poveda MT, Fernández-Bellon H, de la Riva-Fraga M, Marquet B, Guéry JP, Knauf-Witzens T, Weigold A, Dashti A, Bailo B, Imaña E, Muadica AS, González-Barrio D, Ponce-Gordo F, Calero-Bernal R, Carmena D. 2021. Intestinal protists in captive non-human primates and their handlers in six European zoological gardens. Molecular evidence of zoonotic transmission. Frontiers in Veterinary Science, 8, 819887. [Google Scholar]
  18. Koehler AV, Herath H, Hall RS, Wilcox S, Gasser RB. 2024. Marked genetic diversity within Blastocystis in Australian wildlife revealed using a next generation sequencing-phylogenetic approach. International Journal for Parasitology: Parasites and Wildlife, 23, 100902. [CrossRef] [Google Scholar]
  19. Li J, Dong H, Karim MR, Yang X, Chao L, Liu S, Song H, Zhang L. 2021. Molecular identification and subtyping of Blastocystis sp. in hospital patients in Central China. European Journal of Protistology, 79, 125796. [CrossRef] [PubMed] [Google Scholar]
  20. Li T, Feng H, Zheng Y, Lv J, Zhang C, Yang X, Liu X. 2023. First identification and molecular subtyping of Blastocystis in free-living wild birds from urban Xinxiang, China. Veterinary Research Communications, 47(4), 2357–2362. [CrossRef] [PubMed] [Google Scholar]
  21. Maloney JG, Molokin A, da Cunha MJR, Cury MC, Santin M. 2020. Blastocystis subtype distribution in domestic and captive wild bird species from Brazil using next generation amplicon sequencing. Parasite Epidemiology and Control, 9, e00138. [CrossRef] [PubMed] [Google Scholar]
  22. Maloney JG, Santin M. 2021. Mind the gap: new full-length sequences of Blastocystis subtypes generated via oxford nanopore minion sequencing allow for comparisons between full-length and partial sequences of the small subunit of the ribosomal RNA gene. Microorganisms, 9(5), 997. [CrossRef] [PubMed] [Google Scholar]
  23. Moosavi A, Haghighi A, Mojarad EN, Zayeri F, Alebouyeh M, Khazan H, Kazemi B, Zali MR. 2012. Genetic variability of Blastocystis sp. isolated from symptomatic and asymptomatic individuals in Iran. Parasitology Research, 111(6), 2311–2315. [CrossRef] [PubMed] [Google Scholar]
  24. Oliveira-Arbex AP, David ÉB, Tenório MDS, Cicchi PJP, Patti M, Coradi ST, Lucheis SB, Jim J, Guimarães S. 2020. Diversity of Blastocystis subtypes in wild mammals from a zoo and two conservation units in southeastern Brazil. Infection, Genetics and Evolution, 78, 104053. [CrossRef] [PubMed] [Google Scholar]
  25. Piperni E, Nguyen LH, Manghi P, Kim H, Pasolli E, Andreu-Sánchez S, Arrè A, Bermingham KM, Blanco-Míguez A, Manara S, Valles-Colomer M, Bakker E, Busonero F, Davies R, Fiorillo E, Giordano F, Hadjigeorgiou G, Leeming ER, Lobina M, Masala M, Maschio A, McIver LJ, Pala M, Pitzalis M, Wolf J, Fu J, Zhernakova A, Cacciò SM, Cucca F, Berry SE, Ercolini D, Chan AT, Huttenhower C, Spector TD, Segata N, Asnicar F. 2024. Intestinal Blastocystis is linked to healthier diets and more favorable cardiometabolic outcomes in 56, 989 individuals from 32 countries. Cell, 187(17), 4554–4570.e18. [CrossRef] [PubMed] [Google Scholar]
  26. Popruk S, Adao DEV, Rivera WL. 2021. Epidemiology and subtype distribution of Blastocystis in humans: A review. Infection, Genetics and Evolution, 95, 105085. [CrossRef] [PubMed] [Google Scholar]
  27. Rondón S, Cavallero S, Link A, González C, D’Amelio S. 2023. Prevalence and molecular characterisation of Blastocystis sp. infecting free-ranging primates in Colombia. Pathogens, 12(4), 569. [CrossRef] [PubMed] [Google Scholar]
  28. Sánchez A, Munoz M, Gómez N, Tabares J, Segura L, Salazar Á, Restrepo C, Ruíz M, Reyes P, Qian Y, Xiao L, López MC, Ramírez JD. 2017. Molecular epidemiology of Giardia, Blastocystis and Cryptosporidium among indigenous children from the Colombian Amazon Basin. Frontiers in Mcrobiology, 8, 248. [Google Scholar]
  29. Salehi R, Rostami A, Mirjalali H, Stensvold CR, Haghighi A. 2022. Genetic characterization of Blastocystis from poultry, livestock animals and humans in the southwest region of Iran-zoonotic implications. Transboundary and Emerging Diseases, 69(3), 1178–1185. [CrossRef] [PubMed] [Google Scholar]
  30. Sanggari A, Komala T, Rauff-Adedotun AA, Awosolu OB, Attah OA, Farah Haziqah MT. 2022. Blastocystis in captivated and free-ranging wild animals worldwide: a review. Tropical Biomedicine, 39(3), 338–372. [CrossRef] [PubMed] [Google Scholar]
  31. Santin M, Figueiredo A, Molokin A, George NS, Köster PC, Dashti A, González-Barrio D, Carmena D, Maloney JG. 2024. Division of Blastocystis ST10 into three new subtypes: ST42-ST44. Journal of Eukaryotic Microbiology, 71(1), e12998. [CrossRef] [PubMed] [Google Scholar]
  32. Šejnohová A, Koutenská M, Jirků M, Brožová K, Pavlíčková Z, Kadlecová O, Cinek O, Maloney JG, Santín M, Petrželková KJ, Jirků K. 2024. A cross-sectional survey of Blastocystis sp. and Dientamoeba fragilis in non-human primates and their caregivers in Czech zoos. One Health, 19, 100862. [Google Scholar]
  33. Stensvold CR, Clark CG. 2016. Current status of Blastocystis: A personal view. Parasitology International, 65(6 Pt B), 763–771. [CrossRef] [PubMed] [Google Scholar]
  34. Su C, Mei X, Wei L, Zhang F, Wang J, Chang Y, Wang M, Tian X, Zhang Z, Li X, Wang S. 2022. First report of Blastocystis spp. infection in pet birds in Henan Province, Central China. Vector Borne and Zoonotic Diseases, 22(7), 370–381. [CrossRef] [PubMed] [Google Scholar]
  35. Tantrawatpan C, Vaisusuk K, Thanchomnang T, Pilap W, Sankamethawee W, Suksavate W, Chatan W, Bunchom N, Kaewkla O, Stensvold CR, Saijuntha W. 2023. Distribution of Blastocystis subtypes isolated from various animal hosts in Thailand. Research in Veterinary Science, 162, 104939. [CrossRef] [PubMed] [Google Scholar]
  36. Wang H, Chen D, Ma Z, Liu C, Li W, Hao Y, Yang J, Lin Q, Zhang D, Li Y, Yu Y, Cong W, Song L. 2024. Molecular detection, subtyping of Blastocystis sp. in migratory birds from nature reserves in northeastern China. Acta Tropica, 258, 107355. [CrossRef] [PubMed] [Google Scholar]
  37. Xue N, Qin S, Qin Y, Wang H, Hou Q, Yang X, Jiang J, Ni H. 2024. Existence of Blastocystis infection in bar-headed goose (Anser indicus). Research in Veterinary Science, 178, 105380. [CrossRef] [PubMed] [Google Scholar]
  38. Zhang K, Qin Z, Qin H, Wang Y, Wang L, Fu Y, Hou C, Ji C, Yuan Y, Zhang L. 2023. First detection of Blastocystis sp. in migratory whooper swans (Cygnus cygnus) in China. One Health, 16, 100486. [CrossRef] [PubMed] [Google Scholar]
  39. Zhao GH, Hu XF, Liu TL, Hu RS, Yu ZQ, Yang WB, Wu YL, Yu SK, Song JK. 2017. Molecular characterization of Blastocystis sp. in captive wild animals in Qinling Mountains Parasitology Research, 116(8), 2327–2333. [CrossRef] [PubMed] [Google Scholar]
  40. Zhu W, Wei Z, Li Q, Lin Y, Yang H, Li W. 2020. Prevalence and subtype diversity of Blastocystis in human and nonhuman primates in North China. Parasitology Research, 119(8), 2719–2725. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Cui Z, Huang X, Zhang S, Li K, Zhang A, Li Q, Zhang Y, Li J & Qi M. 2025. Molecular characterization and subtype analysis of Blastocystis sp. in captive wildlife in Henan, China. Parasite 32, 11. https://doi.org/10.1051/parasite/2025006.

All Tables

Table 1

Occurrence of Blastocystis sp. in captive wildlife in Henan, China.

In the text

All Figures

thumbnail Figure 1

Phylogenetic relationships among nucleotide sequences of barcode regions of the small subunit ribosomal RNA (SSU rRNA) of Blastocystis sp.; Blastocystis subtypes identified in the present study are indicated in bold type.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.