Open Access
Issue
Parasite
Volume 30, 2023
Article Number 29
Number of page(s) 13
DOI https://doi.org/10.1051/parasite/2023031
Published online 11 August 2023

© P.S. Molokomme et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Southeast Asia is home to one of the world’s greatest diversities of freshwater fish. The Cyprinoidei is the most diverse taxon and cyprinoids dominate nearly every water body in the area [70]. In the region, the most speciose fishes are those of Cyprinidae, namely Barbodes Bleeker, Barbonymus Kottelat, Cyclocheilichthys Bleeker, Hampala Kuhl & van Hasselt, Osteochilus Gunther, Puntius Hamilton, and Tor Gray [16]. Tinfoil barb, Barbonymus schwanenfeldii (Bleeker), is one of five valid species of the Barbonymus, all native to Southeast Asia [17]. Barbonymus schwanenfeldii is a tropical river fish that is abundant in Peninsular Malaysia’s rivers and lakes [26].

Species richness and distribution of parasites in host species are usually closely related to the history, dispersion, and diversity of their hosts [3]. Dactylogyrus Diesing, 1850 (Monogenea) is known for its high species richness, with over 900 nominal species [19] that are primarily restricted to species of the Cyprinoidei [57]. In the Southeast Asia region, Dactylogyrus spp. are known on three out of five currently known Barbonymus spp., namely B. altus (Gunther), B. gonionotus (Bleeker) and B. schwanenfeldii (Bleeker) [11]. There are seven species of Dactylogyrus reported from these hosts, e.g., D. kanchanaburiensis Chinabut & Lim, 1993, D. lampam (Lim & Furtado, 1986), D. pseudosphyrna Chinabut & Lim, 1993, D. sianensis Chinabut & Lim, 1993, D. tapienensis Chinabut & Lim, 1993, D. tonguthaii Chinabut & Lim, 1993, and D. viticulus Chinabut & Lim, 1993, with all from B. gonionotus and with four and three Dactylogyrus spp. recorded from B. schwanenfeldii and B. altus, respectively [11]. Moreover, one of these species, D. pseudosphyrna, can also be found in Thailand on a non-Barbonymus host, Cyclocheilichthys enoplos (Bleeker) [11].

For a long time, most taxonomic studies on Dactylogyrus spp. have been based on morphometry of the attachment organ’s sclerites and hard parts of reproductive organs only (i.e., male copulatory organ and vagina) [36, 39, 42]. However, recently it has been emphasised and demonstrated that the ideal way forward to secure accurate identification is the integrated approach combining morphometric and molecular data [1, 6, 40, 44, 45]. Currently, there are 898 entries available in the GenBank database for a variety of Dactylogyrus spp. (search December 2022) with most items found for Dactylogyrus vistulae Prost, 1957. Out of seven Dactylogyrus species that can be found on Barbonymus hosts, only a partial 18S and ITS1 rDNA region sequence for D. lampam is available in the database, representing only a direct entry from Malaysia and not linked to published results. There is, in general, a substantial lack of genetic data for Dactylogyrus spp. from Asia compared to the species from Europe or North America which have recently been studied intensively [38, 48, 51, 53].

Aquaristics is a popular hobby worldwide and in connection with this, ornamental trade has become a well-functioning industry with more than 50% of recognised countries being involved [68]. The translocation of millions of ornamental fish every year poses a risk of introduction of non-native parasites together with their hosts. It has been documented that fish were responsible for spreading their parasites into non-native regions more than other animals [30]. Several studies have confirmed the presence of monogeneans in imported or introduced fish [35, 65], with cases of spill-over of introduced parasites to native fish [25].

This study originally aimed to screen ornamental fish B. schwanenfeldii for the presence of parasites that may have been imported into South Africa. The finding of three Dactylogyrus species provided the opportunity to produce missing molecular data for the species, as well as supplement original morphometric descriptions. Additionally, the phylogenetic relationship to the other species of the genus could be determined.

Materials and methods

Parasite sampling

A total of 44 specimens of tinfoil barb, B. schwanenfeldii (TL = 7.3–10.8 cm; mean 8.80 ± 1.04) originating in Thailand and Sri Lanka were imported into South Africa through a well-established importing company. All samples were acclimatised upon arrival, following the protocol provided by the importing company and placed in 50-litre glass aquaria with a continuous oxygen supply generated from portable aerators and water heated to a temperature of 24 °C. Each fish was killed following the protocol for the Ethical Handling of Ectothermic Vertebrates by percussive stunning and cervical transection (University of Limpopo Animal Research and Ethics Committee Clearance AREC/05/22: PG). Gills of freshly killed fish specimens were extracted, placed in a Petri dish containing distilled water, and examined for the presence of parasites using a stereomicroscope Leica EZ4 (Leica Microsystems GmbH, Wetzlar, Germany). Internal organs were also screened for the presence of parasites. Total parasite count on the gills was noted and only a representative sample was preserved. Monogeneans were removed from the gills using fine needles and prepared as in Řehulková et al. [43]. Specimens used for morphological examination were completely flattened under coverslip pressure in order to best expose their sclerotised structures (haptoral and reproductive sclerites) and fixed in a mixture of ammonium picrate-glycerin [31]. Specimens used for DNA analysis were bisected using fine needles. Subsequently, one-half of the body (either the posterior part haptoral sclerites or the anterior part containing the male copulatory organ) was fixed in 96% ethanol for later DNA extraction. The mounted specimens were studied using a phase-contrast microscope Olympus BX51 (Olympus, Tokyo, Japan) equipped with a camera and imaging software (Stream Essential, Soft Imaging System GmbH 1986 version 1.5.1, Olympus). Drawings of the sclerotised structures were made with the aid of a camera lucida and digitised with Adobe Illustrator® software (Adobe Inc., San Jose, CA, USA) and a Wacom Intuos Pro drawing tablet (Wacom, Saitama, Japan), following Truter et al. [66]. Measurements were taken using a phase-contrast microscope Olympus BX51 following the scheme presented in Řehulková et al. [44]. All measurements (in micrometres) are provided as the range followed by the mean and number of measured specimens in brackets. The numbering of hook pairs (in Roman numerals I–VII) is that suggested by Mizelle [33]. Epidemiological characteristics such as parasite prevalence, P (percentage of infected hosts), the intensity of infection, IF (minimum and maximum number of parasites per infected host) and mean intensity of infection, MI (the mean number of parasites per infected host) were calculated for the cumulative numbers of Dactylogyrus spp. according to Bush et al. [9]. Voucher specimens collected during the present study and transferred into Canada balsam [15] were deposited at the Institute of Parasitology of the Czech Academy of Sciences (IPCAS), České Budějovice, Czech Republic, and in the National Museum, Bloemfontein (NMB), South Africa. A paratype specimen D. lampam (IPCAS M-286) was studied for comparative purposes.

DNA extraction and PCR amplification

Prior to DNA analysis, monogeneans were identified based on morphology and then preserved in 96% ethanol. Each Dactylogyrus part preserved in ethanol was dried using a vacuum centrifuge. DNA was extracted using the standard protocol (DNeasy Blood & Tissue Kit, Qiagen, Hilden, Germany). The partial 18S, entire ITS1, and partial 5.8S regions were amplified using the reverse primer S1 (5′ – ATTCCGATAACGAACGAGACT – 3′) and reverse primer IR8 (5′ – GCTAGCTGCGTTCTTCATCGA – 3′), which anneal to the segments of DNA coding 18S and 5.8S, respectively [47]. Amplification reactions followed protocols optimised in Benovics et al. [5]. The partial 28S region was amplified using the forward primer C1 (5′ – ACCCGCTGAATTTAAGCA – 3′) and reverse primer D2 (5′ – TGGTCCGTGTTTCAAGAC – 3′) [24], following the PCR protocol optimised by Šimková et al. [49]. The PCR products (~1000 bp for 18S, ITS1, and 5.8S, and ~ 800 bp for partial 28S) were checked on 1% agarose gel and purified using an ExoSAP-IT kit (Ecoli, Bratislava, Slovakia), following the standard protocol. For sequencing, the commercial services of Macrogen Europe (Amsterdam, Netherlands) were employed, and sequencing was carried out using the same primers as for the amplification reaction.

Phylogenetic analyses

In order to assess the molecular phylogenetic relationships of the three collected Dactylogyrus spp., ortholog sequences of selected Dactylogyrus spp. parasitising cyprinid fish hosts (family Cyprinidae according to the recent revision by Tan and Armbruster [59]) in Africa, Asia, and Europe, and one outgroup taxon Ancyrocephalus percae (Ergens, 1966) (selected as phylogenetically proximal taxon) according to Mendoza-Palmero et al. [32] were retrieved from GenBank (full list of species given in Table 1). Previous phylogenetic studies confirmed unique phylogenetic associations among Dactylogyrus of cyprinids and linked their diversification with the historical speciation of respective hosts (e.g., [1, 7, 52]). These studies also recorded the congruency between the molecular and morphological phylogenies in the Dactylogyrus of Cyprinidae. The sequences were aligned using the Fast Fourier transform algorithm in MAFFT [27] using the G-INS-I refinement method, and the ends were manually trimmed to unify their length. All parameters for phylogenetic analyses were treated as variables, therefore GTR (the general time-reversible evolutionary model) was selected as the preferred evolutionary model. The shape parameter of the gamma distribution (G) and the proportion of invariable sites (I) were selected using jModelTest v 2.1.10 [13, 20]. Phylogenetic analyses using maximum likelihood (ML) were computed employing RAxML v 8.1.12 [55, 56]. The best ML tree was selected from 100 iterations, and support for the branching pattern was validated through 103 pseudoreplicates. Phylogenetic analyses of Bayesian inference (BI) were carried out in MrBayes v 3.2 [46], and the resulting tree was constructed using the Metropolis-coupled Markov chain Monte Carlo algorithm. Four concurrent chains (one cold and three heated) ran for 5 × 106 generations, sampling trees every 100 generations. The first 30% of trees were discarded as a relative burn-in period after checking that the standard deviation split frequency fell below 0.01. Results were checked in Tracer v 1.7.1 [41] to assess convergence. Posterior probabilities were calculated as the frequency of samples recovering particular clades.

Table 1

List of Dactylogyrus spp., their host species, country of collection, and GenBank accession number for 28S sequences used for phylogenetic reconstruction. Newly generated sequences are given in bold.

Results

Specimens of Dactylogyrus spp., were found on the gills of B. schwanenfeldii received from Sri Lanka (n = 24, P = 87%, IF = 7–98, MI = 44.3) and Thailand (n = 20, P = 80%, IF = 1–54, MI = 21.7). The morphometric evaluation confirmed the presence of three species of Dactylogyrus, D. lampam, D. tapienensis and D. viticulus from the host specimens received from Thailand, while those from Sri Lanka were infected by D. lampam only. New 28S and 18S + ITS1 rDNA sequences were obtained from D. tapienensis and D. viticulus, only a 28S rDNA sequence was successfully obtained for D. lampam, and their phylogenetic relationship within the genus was inferred. Detailed redescriptions based on both morphometric and molecular data are presented below in alphabetic order. No other parasites were found on or in the studied specimens.

Order Dactylogyridea Bychowsky, 1937

Family Dactylogyridae Bychowsky, 1933

Dactylogyrus lampam (Lim & Furtado, 1986) (Fig. 1)

Type-host: Barbonymus schwanenfeldii (Bleeker, 1853).

thumbnail Figure 1

Line drawings of sclerotised structures of Dactylogyrus lampam (Lim & Furtado, 1986) ex Barbonymus schwanenfeldii. A, anchor; BD, dorsal bar; BV, ventral bar; I–VII, hooks; MCO, male copulatory organ; AP, accessory piece; P, penis. Scale bar 10 μm.

Other host: Barbonymus gonionotus (Bleeker, 1850).

Type-locality: Bukit Merah Reservoir, Merah, Malaysia.

Present records: Sri Lanka, Thailand.

Infection site: Gills.

Material deposited: 2 voucher specimens M-776 and 2 voucher specimens NMB P 948-9.

DNA sequence: A nucleotide sequence of partial 28S rDNA (823 bp; access. No. OR077123).

Redescription [based on 15 adult flattened specimens in GAP.] Composition of body as per definition by Gussev [21]. Body 222–325 (281; n = 9) long, greatest width 51–71 (67; n = 9) usually between 1/3 and mid length. Haptor differentiated from body proper, 33–55 (46; n = 9) long, 55–77 (66; n = 9). Measurements of haptoral sclerites and MCO are given in Table 2. One pair of anchors of varicorhini-type [21], with well develop inner and outer roots. Outer root short with rounded base, inner root elongated, about 1/3 of anchor shaft length. Shaft narrows in inner side before turning in point. Transversal bars of varicorhini-type: dorsal bar shape as birds-like wings, narrowing towards rounded ends. Thin V-shaped ventral bar with well-developed short middle process. Hooks seven pairs, all of similar shape, very fine point, robust shank without narrowing. Uneven in size, pairs I and V slightly smaller. MCO spiral shaped, composed of a 2–2.5× coiled tube with a slightly sclerotised accessory piece. Vagina not observed.

Table 2

Measurements of three Dactylogyrus spp. ex Barbonymus schwanenfeldii from the present study compared with values given in the original species descriptions. Min–max, (mean, number of measurements).

Remarks: The species was originally described by Lim and Furtado [28] as Dactylogyrus puntii in Malaysia, but later renamed on D. lampam by Lim (1991) as there was already an existing species of that name, Dactylogyrus puntii Buschkiel, 1930 described from Barbodes lateristriga (Valenciennes), formerly Puntius lateristriga, from Java. The morphology of the specimens collected during the present study corresponds with drawings presented by Lim and Furtado [28], but in size of haptoral hard parts newly collected specimens are slightly smaller. In the original species description of their species, Lim and Furtado [28] mention a similar species, Dactylogyrus quangfami Ha Ky, 1971, parasitic on Cirrhinus molitorella (Valenciennes) in Vietnam. From D. quangfami, D. lampam differs in (1) the general morphology of anchors – D. quangfami has a sturdier body of the shaft compared to D. lampam, (2) the morphology of the hooks – no evident narrowing of the shank in D. lampam vs. 1/3 thinner part of shank after the sickle proper of D. quangfami, and (3) the shape of a ventral bar – shown in Ha Ky [22] for D. quangfami as a simple fine type while D. lampam has a V-shape ventral bar with the middle process. From other Dactylogyrus spp. with the presence of two bars and those described from small cyprinids in Asia, D. lampam is similar to D. fasciculi Lim & Furtado, 1986, D. binotati Lim & Furtado, 1986, D. perakensis Lim & Furtado, 1986 and D. kanchanburiensis, in the general morphology of anchors, but none of D. fasciculi, D. binotati, D. perakensis or D. kanchanaburiensis do have a ventral bar with the pronounced middle process. Moreover, D. kanchanaburiensis has larger anchors 30–53 μm (48, inner/total length) than those of D. lampam (26–30 μm; 27, present study).

Dactylogyrus tapienensis Chinabut & Lim, 1993 (Fig. 2)

Type-host: Barbonymus gonionotus (Bleeker, 1850).

thumbnail Figure 2

Line drawings of sclerotised structures of Dactylogyrus tapienensis Chinabut & Lim, 1993 ex Barbonymus schwanenfeldii. A, anchor; BD, dorsal bar; I–VII, hooks; MCO, male copulatory organ; AP, accessory piece; P, penis. Scale bar 20 μm.

Other Hosts: Barbonymus altus (Gunther, 1868), Barbonymus schwanenfeldii (Bleeker, 1853).

Type locality: Vachiralongkorn Reservoir, Kanchanaburi Province, Thailand.

Present record: Thailand.

Infection site: Gills.

Material deposited: 2 voucher specimens M-777 and 2 voucher specimens NMB P 950-1.

DNA sequence: A nucleotide sequence of partial 28S rDNA (845 bp; access. No. OR077124) and nucleotide sequences representing a fragment (975 bp; access. No. OR081826) including partial 18S rDNA (487 bp), and the ITS1 region (488 bp).

Redescription [based on 15 adult flattened specimens in GAP.] Composition of body as per definition by Gussev [21]. Body 469–838 (617; n = 15) long, greatest width 100–172 (137; n = 15) usually between 1/3 and mid length. Haptor differentiated from body proper, 86–137 (108; n = 14) long, 94–149 (116; n = 14). Measurements of haptoral sclerites and MCO are given in Table 2. One pair of anchors of wunderi-type [21], of slightly sturdy appearance, with well-developed outer root and more prominent inner root. Outer root short with rectangular base, inner root elongated, nearly 1/2 of anchor shaft length. Shaft narrows in inner side before turning in point. Transversal bar bone-like, with rounded end. Hooks seven pairs, all of similar shape, short, fined point, well-demarcated gourd shape handle. Uneven in size, pair I and V slightly smaller. MCO composed of simple tube, narrowed into a fine tip. Accessory piece elongated, embraces tube in its half, usually lies along tube.

Remarks: The shape and size of hard parts of the specimens collected during the present study correspond with data and drawings presented by Chinabut and Lim [11]. Only the size of the marginal hooks from the present study were somewhat smaller, 16.3–23.3 μm, compared to the 23–28 μm given by Chinabut and Lim [11]. The following species, D. pahangensis Lim & Furtado, 1986, D. contrarmatus Lim & Furtado, 1984, and D. sclerovaginalis Lim & Furtado, 1986, are the closest congeners to D. tapienensis. From D. pahangensis, D. contrarmatus and D. sclerovaginalis, D. tapienensis differs in (1) the general morphology of anchors – the inner root is longer in D. pahangensis, the outer root closer to the inner root in D. contrarmatus, and the outer and inner root not well developed in D. sclerovaginalis; (2) the morphology of the hooks, and (3) the shape of a ventral bar. From other congeners of Dactylogyrus bearing haptoral sclerites of similar size of anchors and one transversal bar, D. tapienensis is similar to D. viticulus, but can easily be distinguished based on the size of the MCO, 83–93.4 μm for D. tapienensis vs. 43.5–50.7 μm for D. viticulus.

Dactylogyrus viticulus Chinabut & Lim, 1993 (Fig. 3)

Type-host: Barbonymus gonionotus (Bleeker, 1850).

thumbnail Figure 3

Line drawings of sclerotised structures of Dactylogyrus viticulus Chinabut & Lim, 1993 ex Barbonymus schwanenfeldii. A, anchor; BD, dorsal bar; I–VII, hooks; MCO, male copulatory organ; AP, accessory piece; P, penis. Scale bar 20 μm.

Other hosts: Barbonymus altus (Gunther, 1868), Barbonymus schwanenfeldii (Bleeker 1853).

Type-locality: Vachiralongkorn Reservoir, Kanchanaburi Province, Thailand.

Present record: Thailand.

Infection site: Gills.

Material deposited: 2 voucher specimens M-778 and 2 voucher specimens NMB P 952-3.

DNA sequence: A nucleotide sequence of partial 28S rDNA (840 bp; No. OR077125) and nucleotide sequences representing a fragment (975 bp; access. No. OR081827) including partial 18S rDNA (487 bp), and the ITS1 region (488 bp).

Redescription [based on 15 adult flattened specimens in GAP.] Composition of body as per definition by Gussev [21]. Body 446–904 (640; n = 13) long, greatest width 80–182 (143; n = 13) usually between 1/3 and midlength. Haptor differentiated from body proper, 96–150 (114; n = 15) long, 80–153 (112; n = 15). Measurements of haptoral sclerites and MCO are given in Table 2. One pair of anchors of wunderi-type [21], slightly slender appearance, with well-developed roots. Outer root short with rectangular base, inner root elongated, well 1/2 of anchor shaft length, with slightly turning end parts of roots. Shaft narrows in inner side before turning in point. Transversal bar stout shape, with slightly rounded end. Hooks seven pairs, all of similar shape, short and fine point, thin pivots and prominent handle. Hooks even in size. MCO consists of long simple tube, with single twist in distal section of tube, elongated accessory piece, rising along tube.

Remarks: The species was described by Chinabut and Lim [11] as the result of field sampling of small cyprinids and their screening for monogenean parasites. The shape of haptoral sclerites as well as the MCO morphology of the specimens collected during the present study are identical to the drawings presented in the species description [11]. In the description out of all Dactylogyrus spp. from small cyprinoid hosts in the area, D. viticulus is similar to D. tapienensis and D. pahangensis. From both species, D viticulus differs by having a significantly smaller MCO, 43.5–50.7 μm vs. 70–75 μm for D. pahangensis and 83–93.4 μm for D. tapienensis. However, the total length of the anchors does not differ significantly between D. viticulus and D. pahangensis (55.2–67 vs. 70–75 μm, respectively), D. pahangensis has a distinctively longer inner root (31–41 μm) compared to D. viticulus (18.8–25.3 μm).

Phylogenetic relationships of investigated Dactylogyrus species

The final sequence alignment encompassing 60 Dactylogyrus spp. and outgroup spanned 701 unambiguously aligned nucleotide positions. ML and BI analyses generated trees with identical topologies and BI tree with posterior probabilities and bootstrap values along respective nodes is presented in Figure 4. The phylogenetic analyses divided all the studied species into three major phylogenetic clades. The first one included all European (specifically Iberian) and African species possessing “varicorhini” morphotype of haptoral ventral bar (clade A). Within clade A were basally positioned D. quangfami with undescribed species Dactylogyrus sp. from China and D. lampam, and in the sister position to clade A was according to the analyses Dactylogyrus labei Musselieus & Gusev, 1976 from India. The second clade (clade B) included almost all other Dactylogyrus spp. parasitising European, North-west African and Middle Eastern cyprinids. The species of clade B possess either large “carpathicus” morphotype of ventral bar with five extremities, the triangular “rutili” morphotype, the intermediate forms with four extremities, or have a completely absent ventral bar (Dactylogyrus balistae Simon-Vicente, 1981 and Dactylogyrus legionensis Gonzales-Lanza & Alvarez-Pellitero, 1982). The last clade (clade C) included Dactylogyrus spp. associated with Cyprinus carpio L. and Carassius spp. which possess no ventral bar, and Dactylogyrus spp. parasitising large central African cyprinids (Labeo Cuvier) together with species parasitising African and Middle Eastern Carassobarbus spp. (i.e., Dactylogyrus marocanus El Gharbi, Birgi & Lambert, 1994 and Dactylogyrus pulcher Bykhovsky, 1957). The latter group (African and Middle Eastern Dactylogyrus spp.) is characterised by strong miniaturisation or complete absence of a connective ventral bar. The three Dactylogyrus spp. collected from B. schwanenfeldii were associated with two phylogenetically divergent Dactylogyrus lineages. Dactylogyrus tapienensis and D. viticulus were revealed by both analyses to be phylogenetically closely related species (uncorrected genetic distance 3.3%) and they were both in the sister position within clade C to the lineage encompassing six central-African Dactylogyrus spp., north-African D. marocanus, and Middle Eastern D. pulcher (uncorrected genetic distances between the species within clade C were 16.2–20.7%; for more details, see Table S1). Not so well-resolved was the phylogenetic position of the D. lampam which was according to the current phylogenetic analyses close to the Iberian, North-African, and Middle Eastern species possessing “varicorhini” morphotype of the haptoral ventral connective bar (clade A). Based on the uncorrected p-distances (see Table S1), D. lampam is “the closest” relative to Dactylogyrus daodrioi El Gharbi, Renaud & Lambert, 1993, D. lenkoranoides El Gharbi, Renaud & Lambert, 1993, D. zatensis El Gharbi, Birgi & Lambert, 1994 and D. mascomai El Gharbi, Renaud & Lambert, 1993 with 8.9, 9.2, 9.5 and 9.5%, respectively.

thumbnail Figure 4

Phylogenetic tree of 60 Dactylogyrus spp. parasitising various cyprinid fish hosts. The tree is based on the sequences of partial genes coding 28S rRNA and rooted using Ancyrocephalus percae. Values at the nodes indicate posterior probabilities from BI and bootstrap values from ML analyses. Dashes indicate values below 0.75 and 50, respectively. Letters (A–C) represent specific well-supported clades. The label at the clades shows shared haptoral ventral bar morphotype for respective species. The three species from the present study are in bold.

Discussion

The ornamental fish trade is a long-term, well operating industry, which every year is responsible for the relocation of a huge number of freshwater and marine fish all around the globe [10, 68]. This is associated with a risk of the introduction of ornamental fish into native environments, with many reports already confirmed worldwide, e.g., Australia [29], Canada [18], England [12] and Mexico [25]. Moreover, the ornamental fish can serve as an important pathway for the translocation of non-native parasites [14, 63, 68] as has already been confirmed in South Africa [35, 61]. The present study reporting the three species of Dactylogyrus on the gills of tinfoil barb imported into South Africa as ornamental fish represents another example that parasites are being moved all around the world together with their hosts, and that there is a continuously persistent risk of introduction of the non-native parasites, as previously documented [25, 30, 54].

However, B. schwanenfeldii can be under the natural condition parasitised by various groups of parasites, such as Trematoda [2, 37], Nematoda [23], or Myxozoa [58], but only Monogenea were found during the present survey, which included hosts bred under an artificial condition as a supply for the ornamental trade chain. It seems highly probable that monogenean species, parasites with a direct life cycle, can easily survive and live on fish under closed cultured conditions, while parasites with more complex life cycles (Nematoda, Trematoda, and Cestoda) do not complete their cycle under the closed conditions with no access to the required intermediate hosts. In the natural area of distribution of B. schwanenfeldii, Mekong and Chao Phraya basins, Malay Peninsula, Sumatra and Borneo [17], this fish was reported as the host for four Dactylogyrus spp. [11, 28], and only three of them were found on the cultured stock received from Thailand. The slightly lower parasite diversity could be explained by the loss of one of the more sensitive species during the translocation of the fish stock from its natural environment into a closed system. Such conditions can be comparable to the translocation of fish into non-native areas where parasite diversity is often lowered, defined as the enemy release hypothesis [38]. From the studies on parasites of cultured ornamental fish, it is evident that the presence of monogenean parasites is very common [60, 62, 63, 67]. As some of these parasites, such as Dactylogyrus extensus Mueller & Vancleave, 1932 and Dactylogyrus vastator Nybelin, 1924, can pose a serious concern and have been identified as a threat to indigenous fish, efforts have been made to develop non-invasive techniques for rapid and accurate identification of these species [64]. Despite newly developed techniques, screening for the presence of parasites in and on introduced/imported hosts is still mainly based on the morphometric approach for parasite identification [61, 65]. The present study supplements the original description of three Dactylogyrus spp. from B. schwanenfeldii and will undoubtedly serve as a good literature source for parasite identification.

The prevalence of Dactylogyrus spp. on B. schwanenfeldii was similar at 87% and 80% for the fish received from Sri Lanka and Thailand, respectively, and the MI was observed to be double in fish sourced from Sri Lanka (44.3) compared to Thailand (21.7). However, the study of Lim and Furtado [28] does not present a value for prevalence, but the MI can be derived from the values provided on the reports of 50 specimens per host, which is close to the observation made on fish from Sri Lanka in our study. The present study also shows that the species composition differed between the two shipments. Fish from Sri Lanka, a country that is not their natural area of distribution, were infected only by D. lampam (the smallest species), while fish originating in Thailand had three species. It can only be hypothesised that either the original stock has experienced loss of some more sensitive species, or the original stock already had a single species infection, as the composition of parasites can differ between studied sites [65]. Another probable explanation could be that the fishes from Sri Lanka originally had all three species, but were properly treated before being brought into a breeding facility, and the smallest parasite remained hidden between gill lamellae during the treatment bath and infection develop afterward.

Two species identified during the present study, D. tapienensis and D. viticulus bear anchors of the wunderi type, and both species have a single simple bar of the amphibotrium type [21]. They also share a similar shape of the MCO, a straight tube with an accessory piece lying along the tube of the anchoratus type. They can easily be distinguished from other congeners by the combination of shape and size of the whole complex of haptoral sclerites and MCO. The measurements of the haptoral hard parts, mainly anchors and dorsal bar, correspond well and overlap with values given by Chinabut and Lim [11]. Only the marginal hooks for D. tapienensis and D. viticulus were somewhat smaller than the size presented in the original descriptions of the species, but still overlapping (see Table 2). Dactylogyrus lampam is a species with haptoral sclerites of the varicorhini type, with two bars, the ventral bar having a pronounced process in the middle part, similar that of the African species Dactylogyrus matlopong Acosta, Truter, Malherbe, Smit, 2022. It seems that this specific detail might pose a challenge to being observed as in the drawing in Mohanta and Chandra [34], who did not show it. The sizes of haptoral sclerites of the D. lampam collected during the present study were slightly smaller than those given in the original species description (Table 2), except that of the marginal hook which corresponds well in its dimensions to values given by Lim and Furtado [28]. Also, Mohanta and Chandra [34] documented a slight difference in the size of sclerite between Thai and Bangladeshi specimens (see [34]).

According to the present phylogenetic analyses, three Dactylogyrus spp. parasitising B. schwanenfeldii are in a paraphyletic relationship, possibly suggesting their evolutionary divergent origin on Indo-Malaysian fish. Dactylogyrus tapienensis and D. viticulus were revealed to be phylogenetically proximal to Dactylogyrus spp. associated with African and Middle Eastern cyprinids possessing the magnihamatus type of haptoral ventral bar. This specific morphological element (specifically the shape of haptoral connective bars) is a phylogenetically important trait for assessing the phylogenetic relationships in Dactylogyrus [5, 7, 50], and thus, considering the morphological similarities, D. tapienensis and D. viticulus might appear as phylogenetically closer to Dactylogyrus spp. associated with C. carpio and Carassius sp. (e.g., D. vastator, D. falciformis, D. anchoratus), as all these species have no haptoral ventral bar. Nonetheless, the deep nodal split between the two species from B. schwanenfeldii and Dactylogyrus belonging to the magnihamatus type group suggests relatively early divergence of these two lineages; therefore, D. tapienensis and D. viticulus should represent a new phylogenetic lineage, potentially also encompassing other endemic Indonesian congeners. Similarly, D. lampam was in the sister position to other Dactylogyrus spp. possessing the same morphotype of the haptoral ventral bar, parasitising cyprinids in Africa, Europe, and the Middle East. Even though the phylogenetic relationships between lineages within clade A were not fully resolved, the topology of the phylogenetic tree and molecular differentiation also suggest early divergence of these lineages.

The phylogenetic relationships between the major cyprinid subfamilies, specifically Poropuntiinae (including Barbonymus), Cyprininae, and Barbinae (sensu [59]) are not yet fully resolved, even using a multilocus molecular approach [69]. However, considering the phylogenetic relationships of the associated Dactylogyrus parasites, a certain degree of cospeciation between Dactylogyrus and their cyprinoid hosts is expected, and we can expect that the poropuntiins will be phylogenetically closer to barbins, rather than cyprinins. Moreover, from the presence of Dactylogyrus spp. belonging to two such phylogenetically divergent clades on B. schwanenfeldii, we can hypothesize that the species of Barbonymus were independently colonised by Dactylogyrus spp. multiple times, and while D. tapienensis and D. viticulus originated from co-diversification (or intra-host speciation followed by cospeciation) with their Barbonymus hosts, D. lampam secondarily host-switched onto Barbonymus spp. from different cyprinoid fish in the Indonesian region. Nevertheless, in order to fully elucidate these historical diversification and dispersion processes, it would be necessary to obtain molecular data from other Indonesian Dactylogyrus spp. (especially for the other four species of Barbonymus), which are, unfortunately, still missing.

Acknowledgments

We thank Tony Nogueira from WCB Imports, Midrand South Africa for the assistance with fish import. The students of Parasitology Lab (SARChI Chair in Ecosystem Health) Department of Biodiversity, University of Limpopo are acknowledged for their help with fish dissection. This is contribution number 785 from the NWU – Water Research Group. This work is based on research supported by the South African Research Chairs Initiative of the Department of Science and Innovation and the National Research Foundation of South Africa (Grant No. 101054). All applicable institutional, national, and international guidelines for the care and use of animals were followed (University of Limpopo Animal Research and Ethics Committee Approval AREC/05/22: PG). The authors declare that they have no conflict of interest.

References

  1. Acosta AA, Truter M, Malherbe W, Smit NJ. 2022. Morphological description and molecular characterisation of Dactylogyrus matlopong sp. n. (Monogenea: Dactylogyridae) from the South African endemic Labeobarbus aeneus (Cyprinidae: Torinae). Folia Parasitologica, 69, 21. [CrossRef] [Google Scholar]
  2. Apiwong K, Wongsawad C, Butboonchoo P. 2018. Morphological and molecular characterization of Haplorchoides mehrai Pande and Shukla 1976 (Digenea: Heterophyidae) from Chiang Mai province. Helminthologia, 55, 334–342. [CrossRef] [PubMed] [Google Scholar]
  3. Benovics M, Desdevides Y, Vukić J, Šanda R, Šimková A. 2018. The phylogenetic relationships and species richness of host-specific Dactylogyrus parasites shaped by the biogeography of Balkan cyprinids. Scientific Reports, 8, 13006–13018. [CrossRef] [PubMed] [Google Scholar]
  4. Benovics M, Desdevides Y, Šanda R, Vukić J, Scheifler M, Doadrio I, Sousa-Santos C, Šimková A. 2020. High diversity of fish ectoparasitic monogeneans (Dactylogyrus) in the Iberian Peninsula: a case of adaptive radiation? Parasitology, 147, 418–430. [CrossRef] [PubMed] [Google Scholar]
  5. Benovics M, Vukić J, Šanda R, Rahmouni I, Šimková A. 2020. Disentangling the evolutionary history of peri-Mediterranean cyprinids using host-specific gill monogeneans. International Journal for Parasitology, 50(12), 969–984. [CrossRef] [PubMed] [Google Scholar]
  6. Benovics M, Francová K, Volta P, Dlapka V, Šimková A. 2021. Helminth communities of endemic cyprinoids of the Apennine Peninsula, with remarks on ectoparasitic monogeneans, and a description of four new Dactylogyrus Diesing, 1850 species. Parasitology, 148, 1003–1018. [CrossRef] [PubMed] [Google Scholar]
  7. Benovics M, Nejat F, Abdoli A, Šimková A. 2021. Molecular and morphological phylogeny of host-specific Dactylogyrus parasites (Monogenea) sheds new light on the puzzling Middle Eastern origin of European and African lineages. Parasites & Vectors, 14, 372. [CrossRef] [PubMed] [Google Scholar]
  8. Benovics M, Vukić J, Šanda R, Nejat F, Charmpila EA, Buj I, Shumka S, Porcelloti S, Tarkan SA, Aksu S, Emiroğlu O, Šimková A. 2023. Monogeneans and chubs: ancient host-parasite system under the looking glass. Molecular Phylogenetics and Evolution, 179, 107667. [CrossRef] [PubMed] [Google Scholar]
  9. Bush AO, Lafferty KD, Lotz JM, Shostak AW. 1997. Parasitology meets ecology on its own terms: Margolis et al. revisited. Journal of Parasitology, 83, 575–583. [Google Scholar]
  10. Cheong L. 1996. Overview of the current international trade in ornamental fish with special reference to Singapore. In: Preventing the spread of aquatic animal diseases. (Eds. B. J. Hill and T. Hastein). Revue Scientifique et Technique, 15, 445–481. [CrossRef] [PubMed] [Google Scholar]
  11. Chinabut L, Lim S. 1993. Seven new species of Dactylogyrus Diesing, 1850 (Monogenea) from Puntius hamilton (Cyprinidae) of Thailand. Raffles Bulletin of Zoology, 41, 47–59. [Google Scholar]
  12. Copp GH, Wesley KJ, Vilizzi L. 2005. Pathways of ornamental and aquarium fish introductions into urban ponds of Epping Forest (London, England): the human vector. Journal of Applied Ichthyology, 21, 263–274. [CrossRef] [Google Scholar]
  13. Darriba D, Taboala GL, Doallo R, Posada D. 2012. JModelTest2: more models, new heuristics and parallel computing. Nature Methods, 9, 772. [CrossRef] [Google Scholar]
  14. Dove AD, Ernst I. 1998. Concurrent invaders – four exotic species of Monogenea now established on exotic freshwater fishes in Australia. International Journal for Parasitology, 28, 1755–1764. [CrossRef] [PubMed] [Google Scholar]
  15. Ergens R. 1969. The suitability of ammonium picrate-glycerin preparing slides of lower Monogenoidea. Folia Parasitologica, 16(4), 320. [Google Scholar]
  16. Esa Y, Japning JRR, Rahim KAA, Siraj SS, Daud SK, Tan SN, Sungan S. 2012. Phylogenetic relationships among several freshwater fishes (Family: Cyprinidae) in Malaysia inferred from partial sequencing of the cytochrome b mitochondrial DNA (mtDNA). Pertanika Journal of Tropical Agricultural Science, 35(2), 307–318. [Google Scholar]
  17. Fricke R, Eschmeyer W, Van Der Laan R. 2021. Eschmeyer’s catalog of fishes. Genera, species references. http://researcharchive.calacademy.org/research/ichthyology/catalog/fishcatmain.asp. [Google Scholar]
  18. Gertzen E, Familiar O, Leung B. 2008. Quantifying invasion pathways: fish introductions from the aquarium trade. Canadian Journal of Fisheries and Aquatic Sciences, 65(7), 1265–1273. [CrossRef] [Google Scholar]
  19. Gibson DI, Timofeeva TA, Gerasev PI. 1996. A catalogue of the nominal species of the monogenean genus Dactylogyrus Diesing, 1850 and their host genera. Systematic Parasitology, 35, 3–48. [CrossRef] [Google Scholar]
  20. Guindon S, Gascuel O. 2003. A simple, fast and accurate algorithm to estimate large phylogenies by maximum likelihood. Systematic Biology, 27, 1759–1767. [Google Scholar]
  21. Gussev AV. 1985. Metazoan parasites. Part I. Key to parasites of freshwater fish of USSR, Vol. 2. Leningrad: Nauka. [Google Scholar]
  22. Ha K. 1971. New species of monogenean form freshwater fishes of Morth Vietnam. II. Parazitologia, 5, 429–440. [Google Scholar]
  23. Hafiza N, Shaharom-Harrison F. 2020. The description of Nematode in Barbonymus schwanenfeldii at Kenyir Lake, Terengganu. Universiti Malaysia Terengganu Journal of Undergraduate Research, 2, 31–36. [CrossRef] [Google Scholar]
  24. Hassouna N, Michot B, Bachellerie JP. 1984. The complete nucleotide sequence of mouse 28S rRNA gene. Implications for the process of size increase of the large subunit rRNA in higher eukaryotes. Nucleic Acids Research, 12, 3563–3583. [Google Scholar]
  25. Jiménez-García MI, Vidal-Martínez VM, López-Jiménez S. 2001. Monogeneans in introduced and native cichlids in Mexico: evidence for transfer. Journal of Parasitology, 87, 907–909. [Google Scholar]
  26. Kamarudin KR, Esa Y. 2009. Phylogeny and phylogeography of Barbonymus schwanenfeldii (Cyprinidae) from Malaysia inferred using partial cytochrome b mtDNA gene. Journal of Tropical Biology and Conservation, 5, 1–13. [Google Scholar]
  27. Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple sequence alignment based on Fourier transform. Nucleic Acids Research, 30, 3059–3066. [CrossRef] [PubMed] [Google Scholar]
  28. Lim LHS, Furtado JI. 1986. Sixteen new species of Dactylogyrus from Genus Puntius Hamilton (Cyprinidae). Folia Parasitologia, 33, 21–34. [Google Scholar]
  29. Lintermans M. 2004. Human-assisted dispersal of alien freshwater fish in Australia. New Zealand Journal of Marine and Freshwater Research, 38, 481–501. [CrossRef] [Google Scholar]
  30. Lymbery AJ, Morine M, Kanani HG, Beatty SJ, Morgan DL. 2014. Co-invaders: the effects of alien parasites on native hosts. International Journal for Parasitology: Parasites and Wildlife, 3, 171–177. [CrossRef] [Google Scholar]
  31. Malmberg G. 1957. On a new genus of viviparous monogenetic trematode. Arkiv for Zoologi, 10, 317–329. [Google Scholar]
  32. Mendoza-Palmero CA, Blasco-Costa I, Scholz T. 2015. Molecular phylogeny of Neotropical monogeneans (Platyhelminthes: Monogenea) from catfishes (Siluriformes). Parasites & Vectors, 8, 164. [CrossRef] [PubMed] [Google Scholar]
  33. Mizelle JD. 1936. New species of trematodes from the gills of Illinois fishes. American Midland Naturalist, 17, 785–806. [CrossRef] [Google Scholar]
  34. Mohanta SK, Chandra KJ. 2000. Monogenean infestations in Thai silver barb (Barbodes gonionotus Bleeker) and their adaptations in Bangladesh waters. Bangladesh Journal of Fisheries Research, 4(2), 147–155. [Google Scholar]
  35. Mouton A, Basson L, Impson D. 2001. Health status of ornamental freshwater fishes imported to South Africa: a pilot study. Aquarium Sciences and Conservation, 3, 313–319. [CrossRef] [Google Scholar]
  36. Musilová N, Řehulková E, Gelnar M. 2009. Dactylogyrids (Platyhelminthes: Monogenea) from the gills of the African carp, Labeo coubie Rüppell (Cyprinidae), from Senegal, with descriptions of three new species of Dactylogyrus and the redescription of Dactylogyrus cyclocirrus Paperna, 1973. Zootaxa, 2241(1), 47–68. [CrossRef] [Google Scholar]
  37. Namsanor J, Kiatsopit N, Laha T, Andrews RH, Petney TN, Sithithaworn P. 2020. Infection dynamics of Opisthorchis viverrine Metacercariae in Cyprinid fishes from two endemic areas in Thailand and Lao PDR. American Journal of Tropical Medicine and Hygiene, 102, 110–116. [Google Scholar]
  38. Pettersen RA, Ostbye K, Holmen J, Vollestad LA, Mo TA. 2016. Gyrodactylus spp. Diversity in native and introduced minnow (Phoxinus phoxinus) populations: no support for “the enemy release” hypothesis. Parasites & Vectors, 9, 51. [CrossRef] [PubMed] [Google Scholar]
  39. Pugachev ON, Gerasev PI, Gussev AV, Ergens R, Khotenowsky I. 2009. Guide to Monogenoidea of freshwater fish of Palaearctic and Amur regions. Milan: Ledizione-LediPublishing, 568 p. [Google Scholar]
  40. Rahmouni I, Řehulková E, Pariselle A, Rkhami OB, Šimková A. 2017. Four new species of Dactylogyrus (Monogenea: Dactylogyridae) parasitizing the gills of northern Moroccan Luciobarbus (Cyprinidae): morphological and molecular characterization. Systematic Parasitology, 94, 575–591. [CrossRef] [PubMed] [Google Scholar]
  41. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67, 901–904. [Google Scholar]
  42. Raphahlelo ME, Přikrylová I, Matla MM. 2020. Dactylogyrus spp. (Monogenea, Dactylogyridae) from the gills of Enteromius spp. (Cypriniformes, Cyprinidae) from the Limpopo Province, South Africa with descriptions of three new species. Acta Parasitologica, 65, 396–412. [CrossRef] [PubMed] [Google Scholar]
  43. Řehulková E, Seifertová M, Přikrylová I, Francová K. 2018. Monogenea, in A guide to the parasites of African freshwater fishes, Scholz T, Vanhove MPM, Smit N, Jayasundera Z, Gelnar M, Editors. RBINS′ Scientific Publication Unit, ABC Taxa: Brussels. p. 185–243. [Google Scholar]
  44. Řehulková E, Benovics M, Šimková A. 2020. Uncovering the diversity of monogeneans (Platyhelminthes) on endemic cypriniform fishes of the Balkan Peninsula: new species of Dactylogyrus and comments on their phylogeny and host-parasite associations in a biogeographic context. Parasite, 27, 66. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  45. Řehulková E, Rahmouni I, Pariselle A, Šimková A. 2021. Integrating morphological and molecular approaches for characterizing four species of Dactylogyrus (Monogenea: Dactylogyridae) from Moroccan cyprinids, with comments on their host specificity and phylogenetic relationships. PeerJ, 9, 1067. [Google Scholar]
  46. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: efficient Bayesian phylogenetic inference and model choice across large model space. Systematic Biology, 61, 539–542. [CrossRef] [PubMed] [Google Scholar]
  47. Šimková A, Plaisance L, Matějusová I, Morand S, Verneau O. 2003. Phylogenetic relationships of the Dactylogyridae Bychowsky, 1933 (Monogenea: Dactylogyridae): the need for the systematic revision of the Ancyrophalinae Bychowsky, 1937. Systematic Parasitology, 54, 1–11. [CrossRef] [PubMed] [Google Scholar]
  48. Šimková A, Morand S, Jobet E, Gelnar M, Verneau O. 2004. Molecular phylogeny of congeneric monogenean parasites (Dactylogyrus): a case of intrahost speciation. Evolution, 58, 1001–1018. [PubMed] [Google Scholar]
  49. Šimková A, Matějusová I, Cunningham CO. 2006a. A molecular phylogeny of the Dactylogyridae sensu Kritsky & Boeger (1989) (Monogenea) based on the D1–D3 domains of large subunit rDNA. Parasitology, 133, 43–53. [CrossRef] [PubMed] [Google Scholar]
  50. Šimková A, Verneau O, Gelnar M, Morand S. 2006b. Specificity and specialization of congeneric monogeneans parasitizing cyprinid fish. Evolution, 60, 1023–1037. [Google Scholar]
  51. Šimková A, Pečínková M, Řehulková E, Vyskočilová M, Ondračková M. 2007. Dactylogyrus species parasitizing European Barbus species: morphometric and molecular variability. Parasitology, 134, 1751–1765. [CrossRef] [PubMed] [Google Scholar]
  52. Šimková A, Benovics M, Rahmouni I, Vukić J. 2017. Host-specific Dactylogyrus parasites revealing new insights on the historical biogeography of Northwest African and Iberian cyprinid fish. Parasites & Vectors, 10, 58. [CrossRef] [PubMed] [Google Scholar]
  53. Šimková A, Řehulková E, Choudhury A, Seifertová M. 2022. Host-specific parasites reveal the history and biogeographical contacts of their hosts: the monogenea of Nearctic cyprinoid fishes. Biology, 11(2), 223. [CrossRef] [PubMed] [Google Scholar]
  54. Smit NJ, Malherbe W, Hadfield KA. 2017. Alien freshwater fish parasites from South Africa: diversity, distribution, status and the way forward. International Journal for Parasitology: Parasites and Wildlife, 6, 386–401. [CrossRef] [Google Scholar]
  55. Stamatakis A. 2006. RAxML-VI-HPC: maximum likelihood-based phylogenetic analyses with thousands of taxa and mixed models. Bioinformatics, 22, 2688–2690. [CrossRef] [PubMed] [Google Scholar]
  56. Stamatakis A. 2014. RAxML version 8: a tool for phylogenetic analyses and post-analysis of large phylogenies. Bioinformatics, 30, 1312–1313. [CrossRef] [PubMed] [Google Scholar]
  57. Stout CC, Tan M, Lemmon AR, Lemmon EM, Armbruster JW. 2016. Resolving Cypriniformes relationships using an anchored enrichment approach. BMC Evolutionary Biology, 16, 1–13. [CrossRef] [PubMed] [Google Scholar]
  58. Székely Cs, Shaharom-Harrison F, Cech G, Ostoros G, Molnár K. 2009. Myxozoan infections in fishes of the Tasik Kenyir water reservoir, Terengganu, Malaysia. Diseases of Aquatic Organisms, 83, 37–48. [CrossRef] [PubMed] [Google Scholar]
  59. Tan M, Armbruster JW. 2018. Phylogenetic classification of extant genera of fishes of the order Cypriniformes (Teleostei: Ostariophysi). Zootaxa, 4476, 006–039. [Google Scholar]
  60. Tancredo KR, Martins ML. 2019. Three previous recorded species of Dactylogyrus Diesing, 1850 (Monogenea: Dactylogyridae) infecting cultured Carassius auratus in southern Brazil. Journal of Parasitic Diseases, 43(3), 522–527. [CrossRef] [PubMed] [Google Scholar]
  61. Tavakol S, Halajian A, Smit WJ, Hoffman A, Luus-Powell WJ. 2017. Guppies (Poecilia reticulata) introducing an alien parasite, Camallanus cotti (Nematoda: Camallanidae) to Africa, the first report. Parasitology Research, 116(12), 3441–3445. [CrossRef] [PubMed] [Google Scholar]
  62. Thilakaratne I, Rajapaksha G, Hewakopara A, Rajapakse R, Faizal A. 2003. Parasitic infections in freshwater ornamental fish in Sri Lanka. Diseases of Aquatic Organisms, 54, 157–162. [CrossRef] [PubMed] [Google Scholar]
  63. Trujillo-González A, Becker JA, Hutson KS. 2018. Parasite dispersal from the ornamental goldfish trade. Advances in Parasitology, 100, 239–281. [CrossRef] [PubMed] [Google Scholar]
  64. Trujillo-González A, Edmunds RC, Becker JA, Hutson KS. 2019. Parasite detection in the ornamental fish trade using environmental DNA. Scientific Reports, 9, 5173. [CrossRef] [PubMed] [Google Scholar]
  65. Truter M, Přikrylová I, Weyl OL, Smit NJ. 2017. Co-introduction of ancyrocephalid monogeneans on their invasive host, the largemouth bass, Micropterus salmoides (Lacepéde, 1802) in South Africa. International Journal for Parasitology: Parasites and Wildlife, 6, 420–429. [CrossRef] [Google Scholar]
  66. Truter M, Smit NJ, Malherbe W, Přikrylová I. 2021. Description of Gyrodactylus paludinosus sp. nov. (Monogenea: Gyrodactylidae) from the Straightfin Barb, Enteromius paludinosus (Peters, 1852), in South Africa. Acta Parasitologica, 67(1), 446–453. [Google Scholar]
  67. Tu X, Ling F, Huang A, Wang G. 2015. An infection of Gyrodactylus kobayashii Hukuda, 1940 (Monogenea) associated with the mortality of goldfish (Carassius auratus) from central China. Parasitology Research, 114(2), 737–745. [CrossRef] [PubMed] [Google Scholar]
  68. Whittington RJJ, Chong R. 2007. Global trade in ornamental fish from an Australian perspective: the case for revised import risk analysis and management strategies. Preventive Veterinary Medicine, 81, 92–116. [CrossRef] [PubMed] [Google Scholar]
  69. Yang L, Sado T, Hirt VM, Pasco-Viel E, Arunachalm M, Li J, Wang X, Freyhof J, Saitoh K, Simons AM, Miya M, He S, Mayden RL. 2015. Phylogeny and polyploidy: resolving the classification of cyprinine fishes (Teleostei: Cypriniformes). Molecular Phylogenetics and Evolution, 85, 97–116. [CrossRef] [PubMed] [Google Scholar]
  70. Zakaria-Ismail M. 1990. Cyprinid fishes of the Genus Cyclocheilichtys in Peninsular Malaysia. Malayan Nature Journal, 44, 109–121. [Google Scholar]

Cite this article as: Molokomme PS, Benovics M, Luus-Powell WJ, Lukhele LP & Přikrylová I. 2023. Dactylogyrus spp. (Dactylogyridae, Monogenea) from tinfoil barb, Barbonymus schwanenfeldii imported into South Africa: morphometric and molecular characterisation. Parasite 30, 29.

Supplementary material

Table S1. Uncorrected p-distances based on 28S sequences of the species included in the phylogenetic analysis. Access here

All Tables

Table 1

List of Dactylogyrus spp., their host species, country of collection, and GenBank accession number for 28S sequences used for phylogenetic reconstruction. Newly generated sequences are given in bold.

Table 2

Measurements of three Dactylogyrus spp. ex Barbonymus schwanenfeldii from the present study compared with values given in the original species descriptions. Min–max, (mean, number of measurements).

All Figures

thumbnail Figure 1

Line drawings of sclerotised structures of Dactylogyrus lampam (Lim & Furtado, 1986) ex Barbonymus schwanenfeldii. A, anchor; BD, dorsal bar; BV, ventral bar; I–VII, hooks; MCO, male copulatory organ; AP, accessory piece; P, penis. Scale bar 10 μm.

In the text
thumbnail Figure 2

Line drawings of sclerotised structures of Dactylogyrus tapienensis Chinabut & Lim, 1993 ex Barbonymus schwanenfeldii. A, anchor; BD, dorsal bar; I–VII, hooks; MCO, male copulatory organ; AP, accessory piece; P, penis. Scale bar 20 μm.

In the text
thumbnail Figure 3

Line drawings of sclerotised structures of Dactylogyrus viticulus Chinabut & Lim, 1993 ex Barbonymus schwanenfeldii. A, anchor; BD, dorsal bar; I–VII, hooks; MCO, male copulatory organ; AP, accessory piece; P, penis. Scale bar 20 μm.

In the text
thumbnail Figure 4

Phylogenetic tree of 60 Dactylogyrus spp. parasitising various cyprinid fish hosts. The tree is based on the sequences of partial genes coding 28S rRNA and rooted using Ancyrocephalus percae. Values at the nodes indicate posterior probabilities from BI and bootstrap values from ML analyses. Dashes indicate values below 0.75 and 50, respectively. Letters (A–C) represent specific well-supported clades. The label at the clades shows shared haptoral ventral bar morphotype for respective species. The three species from the present study are in bold.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.