EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 30 (2023) Parasite, 30 (2023) 22 Full HTML
Open Access
Issue
Parasite
Volume 30, 2023
Article Number 22
Number of page(s) 20
DOI https://doi.org/10.1051/parasite/2023024
Published online 17 June 2023

© M. Ondračková et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

The topmouth gudgeon Pseudorasbora parva (Temminck & Schlegel, 1846) is a freshwater cyprinid fish native to East Asia, including Japan, the Korean section of the Amur River basin, northern and central China and the southeastern part of Russia [3, 39]. The species was accidentally introduced into Europe in the 1960s with commercial fish imported from China and stocked in fishponds along the Romanian stretch of the Danube River [5]. Following early introductions into several European countries around the Black Sea (e.g., Romania, Hungary, Lithuania and Ukraine) in the early 1960s, the species rapidly became established in most waterbodies in Europe, parts of Eurasia and North Africa as a result of secondary introductions [82]. Recent genetic studies focused on identifying introduction pathways and colonisation history have indicated that topmouth gudgeon populations in Europe and Asia Minor result from two separate introduction events via two dispersal routes [31].

The majority of European topmouth gudgeon introduction events occurred accidentally along with stocking of Chinese carp (e.g., grass carp Ctenopharyngodon idella [Valenciennes in Cuvier & Valenciennes] and silver carp Hypophthalmichthys molitrix [Valenciennes, 1844]) for aquaculture and their further escape from fish farms [82], supplemented by occasional introductions either as ornamental fish [12] or as food for predatory fish in hatcheries [17]. Unlike intentional introductions, which can generally be controlled and managed through appropriate risk assessment, accidental introductions lack this regulatory procedure and, consequently, their risk can only be estimated retrospectively [26]. Such risks include disease transmission and co-introduction of new parasites and pathogens, which further increase the dangers of accidentally introduced non-native species for local fauna [86]. There are a range of examples of fish parasite co-introductions that have had detrimental effects on native fish species, most of which have shown as co-introduced parasites that are more virulent when successfully switching to native hosts (see [46]). One of the best documented examples is the introduction of the swim-bladder nematode Anguillicola crassus from Asia into Europe [37]. This nematode naturally infects Japanese eel (Anguilla japonica) at relatively low intensities, with no obvious adverse effects on fish physiology or condition [55]. After its successful introduction into Europe in the 1980s, however, the parasite switched to European eel Anguilla anguilla [37], reaching much greater infection intensities and causing severe pathological effects leading to mortality [22].

Reports on monogenean parasites co-introduced into Europe with topmouth gudgeon include two dactylogyrid species, Dactylogyrus squameus Gusev, 1955 and Bivaginogyrus obscurus (Gusev, 1955), and one gyrodactylid species, Gyrodactylus gobioninum Gusev, 1955. To date, D. squameus has been accidentally introduced from waterbodies in the Czech Republic [62, 78], Italy [23] and Ukraine [94], while single records of B. obscurus and G. gobioninum are known from Ukraine [94] and Bulgaria [48], respectively. In its native range, topmouth gudgeon is also parasitised by Ancyrocephalus parvae Achmerow, 1952 and Gyrodactylus parvae You et al., 2008 [29, 58, 93]. Owing to their monoxenous life cycle, co-introduction of monogenean parasites is relatively common, especially in species translocated in higher numbers. There are many examples of monogeneans co-introduced into Europe, including for example Dactylogyrus inexpectatus and D. dulkeiti co-introduced with Prussian carp, Carassius gibelio; D. lamellatus with grass carp Ctenopharyngodon idella; Pseudodactylogyrus bini and P. anguillae with Japanese eel Anguilla japonica from Asia (summarised in [54]), and Onchocleidus spp., Actinocleidus spp., Gyrodactylus centrarchi and Cleidodiscus robustus with pumpkinseed sunfish Lepomis gibbosus [44, 65] and Gyrodactylus nebulosus, G. melas, Ligictaluridus pricei and L. monticellii with bullheads Ameiurus nebulosus and A. melas [64, 71, 90] from North-America. Most of these parasites are host specific and usually do not switch to other fish species. However, the two Pseudodactylogyrus species, for example, co-introduced with Japanese eel (P. bini and P. anguillae) were able to switch to European eel and after a relatively short period had increased their distribution throughout the European continent [84].

Though introduced species may serve as suitable hosts for local parasites, they are mostly generalists that take advantage of the “free niche” offered by the new hosts [68]. Monogeneans are among the most host-specific of parasites in general, and may be the most host-specific of all fish parasites [91]. Of these, Dactylogyrus species especially exhibit a high degree of host specificity [79], with potential host-switch usually only occurring between closely related cyprinid species (e.g. [80]). On the other hand, viviparous Gyrodactylidae are known to show a lower degree of host specificity [4]; thus, the introduction of a new competent host increases the chances of expanding the host spectrum for parasites with low host specificity. Interestingly, the topmouth gudgeon appears to be susceptible to a range of local generalist pathogens in its non-native range without showing clinical signs of pathology, suggesting that it is able to act as a healthy carrier for a number of pathogens [2]; nevertheless, just one report of infection by local monogeneans has been reported to date [48].

The main aim of this study was to identify monogenean parasites infecting topmouth gudgeon in the Czech Republic and at sites on the Dnieper River in Ukraine. We also compare parasite morphometric data obtained from non-native populations with parasites collected in the topmouth gudgeon’s native range, Chu-pej province in China, which is the presumed original source of fish introduction [82]. Using data from ribosomal DNA and morphometric analysis, we describe a new Gyrodactylus species introduced from Asia, which was found in both the Czech and Ukrainian regions. Finally, we provide insights into the phylogenetic relationships of parasites infecting topmouth gudgeon, with a special emphasis on their association with other East Asian species.

Materials and methods

Ethics

This research was undertaken in line with the ethical requirements of the Czech Republic and was approved by the appropriate ethics committee. The maintenance and care of fish, as well as the method of fish killing, complied with the legal requirements of the Czech Republic (§ 7 law No. 114/1992 on the Protection of Nature and Landscape and § 6, 7, 9 and 10 regulation No. 419/2012 on the Care, Breeding and Use of Experimental Animals).

Fish sampling

Non-native topmouth gudgeon were collected by electrofishing in the Lower Dnieper irrigation system (Ukraine), the Kyjovka River and oxbows of the Morava and Dyje Rivers (Czech Republic). For comparative purposes, native fish were sampled from the Niushan and Bao’an Lakes (China; for locality details see Table 1). In total, 81 topmouth gudgeon were collected and transported alive in aerated cans to the nearby laboratory, where they were humanely dispatched and dissected for monogenean parasites within two days of capture, following Kvach et al. [42]. Prior to dissection, each fish was measured for standard length (SL) to the nearest 1 mm (Table 1).

Table 1

List of topmouth gudgeon Pseudorasbora parva sampling sites for monogenean assesment (2010 = native range, 2020–2022 = non-native range), showing coordinates, number of fish collected (n), fish host standard length range (SL, mm), and monogenean prevalence (%), intensity range (min-max) and mean abundance.

Parasite collection and morphometric analysis

Gyrodactylid and dactylogyrid parasites collected from fins, gills, opercula and the body surface were mounted in glycerine-ammonium-picrate [47] as semi-permanent slides for morphological and morphometric analyses. Monogeneans dehydrated in ethanol and mounted in Canada Balsam are deposited in the Helminthological collection at the Institute of Parasitology, Academy of Sciences of the Czech Republic, České Budějovice (No: IPCAS-M-393, M-774, M-775). A subsample of monogeneans collected from the species’ non-native range was preserved in 96% ethanol for further molecular analysis.

Parasites were characterised according to the shape and size of the haptoral hard parts (anchors, connective bars, marginal hooks and/or copulatory organ) using a BX51 light microscope (Olympus Optical Co., Tokyo, Japan) equipped with phase-contrast and differential interference contrast. Drawings of haptoral hard components were made with the aid of a drawing attachment and phase-contrast optics. Measurements were obtained using the OLYMPUS cellSens Standard digital image analysis package (Olympus Optical Co., Hamburg, Germany). For gyrodactylids, 12 morphological characters of the anchors, ventral and dorsal bars, along with eight characters of the marginal hooks were measured according to Shinn et al. [76], supplemented by length and width of the whole body, pharynx and male copulatory organ (MCO). For dactylogyrids, 20 morphological characters of the anchors, ventral and dorsal bars, marginal hooks and copulatory organ were measured following Nitta and Nagasawa [57], supplemented by length and width of the whole body and pharynx (see Supplementary Tables S1, S2). For comparative morphometric analysis, 12 specimens of native Gyrodactylus sp., ten specimens of native B. obscurus and two specimens of D. squameus collected in China were subjected to the same morphometric procedure. Moreover, in addition to specimens obtained from topmouth gudgeon, we measured related G. gobii and G. gobiensis from Romanogobio behlingi and Gobio gobio collected in the Velička River as part of the study reported by Kvach et al. [43].

Prevalence (in %), intensity of infection (range, minimum–maximum) and mean abundance were calculated following Bush et al. [15]. A principal component analysis (PCA) based on standardised data was used to visualise the position of Gyrodactylus species in morphological space according to Dávidová et al. [21], applying measurements of 19 morphological characters. Owing to high inter-individual variation, the aperture distance was excluded from the PCA analysis. All statistical analyses were performed using Statistica v.14.1 (StatSoft Inc., USA; [85]).

DNA extraction, amplification and sequencing

For parasites collected in Europe, the haptor of a previously ethanol-preserved parasite was excised and mounted in Hoyer’s medium for morphological confirmation of species, the remaining part of the body being placed in a 1.5 mL Eppendorf tube with 96% ethanol for genomic DNA extraction. Bisected parasite specimens preserved in 96% ethanol were dried using a centrifugal vacuum concentrator (Eppendorf, Hamburg, Germany). Genomic DNA was extracted separately from each parasite specimen using a DNeasy Blood & Tissue Kit (QIAGEN, Hilden, Germany), following the provided protocol for purification of total DNA from animal tissues.

For Gyrodactylus species, ten specimens of Gyrodactylus sp. from the Dnieper River (n = 5), D3 oxbow (n = 2) and Melanbon borrow pit (n = 3) were used for molecular analysis, along with two specimens of G. prostae from the Melanbon borrow pit (for information on sites, see Table 1). The region of the ribosomal DNA (rDNA) encompassing the 3′ end of 18S rDNA, ITS1, 5.8S rDNA, ITS2 and the 5′ end of 28S rDNA was amplified using the primers ITS1F (5′–GTTTCCGTAGGTGAACCT–3′) [74] and ITS2 (5′–TCCTCCGCTTAGTGATA–3′) [20]. The PCR reaction was performed at a final volume of 30 μL, including 5 μL of DNA extract (corresponding to 20 ng/μL), 1× PCR Buffer (Fermentas, Thermo Fisher Scientific, Waltham, MA, USA), 1.5 mM MgCl2, 200 μM dNTPs, 0.5 μM of each primer and 1.5 U Taq Polymerase (Fermentas). Cycling conditions were as follows: initial denaturation for 3 min at 96 °C, 35 cycles of 50 s at 95 °C, 50 s at 52 °C, 50 s at 72 °C and a final extension for 7 min at 72 °C.

For dactylogyrid species, one specimen of D. squameus from the Melanbon borrow pit, along with two specimens of B. obscurus from the Dnieper River and two specimens from the Melanbon borrow pit were used for molecular identification. The partial fragment of 28S rDNA was amplified using the primers C1 (5′–ACCCGCTGAATTTAAGCA–3′) and D2 (5′–TGGTCCGTGTTTCAAGAC–3′) [33], and a second fragment, spanning partial 18S rDNA, 5.8S rDNA and the entire ITS1 region (18S–ITS1), was amplified using the primers S1 (5′–ATTCCGATAACGAACGAGACT–3′) [83] and Lig5.8R (5′–GATACTCGAGCCGAGTGATCC–3′) [13]. The PCR reaction contained 5 μL of DNA extract, 1× PCR buffer (Fermentas, USA), 1.5 mM MgCl2, 0.5 μM (28S) or 0.8 μM (18S–ITS1) of each primer, 200 μM of each dNTP and 1 U of Taq polymerase (Fermentas, USA) at a final volume of 30 μL. The PCR was performed under the following conditions: initial denaturing step for 2 min at 94 °C; 39 cycles of denaturing for 60 s (18S–ITS1) or 20 s (28S) at 94 °C, annealing for 60 s at 50 °C (18S–ITS1) or for 30 s at 56 °C (28S), extending for 90 s at 72 °C and a final extending step for 10 min at 72 °C. All PCR products were electrophoresed on 1.5% agarose gels stained with GoodView (SBS Genetech, Bratislava, Slovakia) and then purified using ExoSAP-IT™ (Amplia, Bratislava, Slovakia), following the manufacturer’s protocol. The purified PCR products were sequenced directly in both directions using the same primers as in the amplification reaction. For ITS sequencing of Gyrodactylus species, an additional internal primer ITSR3A (5′–GAGCCGAGTGATCCACC–3′) [49], complementary to the sequence at the 5′ end of the 5.8S gene, was used. Sequencing was carried out using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Thermo Fisher Scientific, Prague, Czech Republic) and an Applied Biosystems 3130 Genetic Analyser (Applied Biosystems, Thermo Fisher Scientific). The DNA sequences were assembled and edited using Sequencer software (Gene Codes Corp., Ann Arbor, MI, USA) and the newly generated monogenean sequences were deposited in GenBank (for accession numbers, see Tables 2 and 3.

Table 2

List of gyrodactylid taxa, host species, collection localities and GenBank accession numbers for ITS sequences used in the phylogenetical analysis. Newly generated sequences from the present study are highlighted in bold.

Table 3

List of dactylogyrid taxa, host species, collection localities and GenBank accession numbers for the 28S rDNA sequences used in the phylogenetical analysis. Newly generated sequences from the present study are highlighted in bold.

Phylogenetic analysis

Both Gyrodactylus and Dactylogyrus phylogenies were analysed using Maximum Likelihood (ML) and Bayesian inference (BI) methods. Additional monogenean sequences for phylogenetic analysis were retrieved from GenBank (for accession numbers, see Tables 2 and 3). The Gyrodactylus dataset for the ITS rDNA sequences included three species parasitising topmouth gudgeon (Gyrodactylus pseudorasborae n. sp., G. parvae and G. prostae) and 19 selected Gyrodactylus species mainly collected from fish hosts in the Eurasian regions and from phylogenetically related hosts (Gobioninae) comprising three main lineages previously observed in Gyrodactylus phylogeny [25, 50, 96]. The species Gyrodactyloides bychowskii Albova, 1948 was used as outgroup (Table 2).

To determine the phylogenetic position of B. obscurus within Dactylogyridae, a 28S rDNA dataset, including the newly generated sequences for dactylogyrids parasitising topmouth gudgeon and those available from GenBank representing the four main phylogenetic lineages of Dactylogyrus according to Šimková et al. [81], was created and analysed. The five dactylogyridean species representing three genera (Ancyrocephalus, Gobioecetes and Pseudodactylogyrus) were selected as an outgroup (Table 3).

All alignments were performed with MAFFT v.7 [36], using the “G-INS-I” strategy and optimised manually in BioEdit [30]. ModelFinder [35] was employed to infer the optimal evolutionary model for each genetic segment using the Bayesian information criterion. The following optimal evolutionary models were selected: TVM + F + G for ITS1, TIM2e + G for 5.8S and TVM + F + G for ITS2 in Gyrodactylus phylogeny; GTR + F + I + G for 28S rDNA in Dactylogyridae phylogenetic reconstruction. ML analysis was conducted using the program IQ-TREE [56], as implemented in W-IQ-TREE [88], with nodal support assessed through 1,000 ultrafast bootstrap (“UFBoot”) replicates [52]. BI analysis was performed using MrBayes v. 3.2.1 [75], using four simultaneous chains (one cold and three heated) of the Markov Chain Monte Carlo (MCMC) algorithm run twice for 1,000,000 generations. Tree topologies were sampled every 100 generations, whereby the first 25% of trees from each run were discarded as burn-in. Convergence was indicated by an average standard deviation of split frequencies per parallel run of < 0.01, and subsequently checked using Tracer v.1.7.1. [73]). The resulting trees were visualised and edited in FigTree v.1.4.3. [72]. Finally, the genetic divergence between morphologically similar species was calculated using uncorrected p-distances for each genetic segment in MEGA X [40].

Results

1 Gyrodactylidae

Two species, G. prostae Ergens, 1964 and G. pseudorasborae n. sp. were recorded within the topmouth gudgeon non-native range. Gyrodactylus prostae was found on a fish’s gills at a single locality, the Melanbon borrow pit (Dyje River floodplain) in April 2022, with prevalence of 20%, abundance 0.4 and intensity of infection ranging between 1 and 4 (Table 1). The size of the marginal hooks corresponded to G. prostae sensu Galli et al. [24], while the size of the anchors was smaller and corresponded to the related G. laevis (Table 4). Identical sequences of the 886 bp ITS rDNA fragment (submitted to the GenBank database under accession number OQ598691) were obtained from two specimens. A BLASTn search (February 2023) showed maximum similarity to G. prostae from cyprinids in the Czech Republic (100%; AJ567673; [50]) and Finland (99.89%; AY278038; [96]).

Table 4

Morphometric parameters (mean, range; μm) of Gyrodactylus prostae collected from topmouth gudgeon Pseudorasbora parva in the Melanbon borrow pit, Czech Republic, compared with published data.

A morphologically similar Gyrodactylus species that did not correspond to any other Gyrodactylus species known from topmouth gudgeon or related fish hosts was found at all European sampling localities (non-native range) and China (native range). Specimens from localities in both native and non-native ranges varied in size and largely overlapped in the measurements of haptoral hard parts (Supplementary Table S1). However, the mean size of haptoral hard parts was larger in introduced worms (Fig. 1). As an exception, all gyrodactylids collected from the Melanbon borrow pit exhibited larger sizes in most features than those from other sites (Supplementary Table S1), and were separated from other localities (i.e., Dnieper and Kyjovka Rivers, D3 oxbow and the Bao’an and Niushan Lakes) on the PCA plot along the PC1 axis (Fig. 2). All sequences of the ITS rDNA fragment obtained from 10 specimens collected from the Dnieper River, the D3 oxbow and the Melanbon borrow pit were identical. A BLASTn search (February 2023) revealed highest similarity with the ITS rDNA sequences of Gyrodactylus sp. (99.57%; OP577877; Chen et al. unpublished) and Gyrodactylus parvae (93.43%; EF450249; [93]), obtained from native topmouth gudgeon sampled in the Qinling mountains of central China. The parasite is therefore described as a new species.

thumbnail Figure 1

Response ratios depicting the mean length of selected parameters for monogenean hard parts (length of anchor, ventral bar, sickle and shaft for gyrodactylids; length of anchor, ventral and dorsal bars and accessory piece of copulatory organ for dactylogyrids). The x-axis is the log of the ratio of measurements in introduced vs. native ranges. Positive numbers indicate enhanced performance in the introduced range.

thumbnail Figure 2

Plot of a principal component analysis based on 19 metric characters for the haptoral hard parts. The plot shows the position of Gyrodactylus pseudorasborae n. sp. obtained from Pseudorasbora parva in its native Asian (China; full circles) and non-native European (Czech Republic, Ukraine; empty circles) ranges, along with related G. gobii (empty triangles) obtained from Romanogobio vladykovi, and G. gobiensis (empty squares) obtained from Gobio gobio in the Czech Republic, in morphological space. Ellipses covering 95% range.

Description of the new species

Family Gyrodactylidae Cobbold, 1864

Genus Gyrodactylus von Nordmann, 1832

Gyrodactylus pseudorasborae n. sp. Ondračková, Seifertová & Tkachenko (Fig. 3)

urn:lsid:zoobank.org:act:78975C09-695F-4C2F-ACA2-51EB6D8ACFC8

thumbnail Figure 3

Line drawings of Gyrodactylus pseudorasborae n. sp. ex Pseudorasbora parva. A = Holotype (China), B = Paratype (Ukraine), C = Paratype (Czech Republic). a = opisthaptoral central hook complex; b = marginal hook; c = male copulatory organ. Scale bar = 10 μm.

Type host: Pseudorasbora parva (Temminck & Schlegel, 1846), Cypriniformes

Site on the host: fins, gills, opercula, body surface

Type locality: Bao’an Lake, Hubei Province (30.237226, 114.729771), China

Other localities: Dnieper River basin (46.272784, 32.734128), Ukraine; Babice oxbow, Morava basin (49.122634, 17.490357); D3 oxbow (48.684603, 16.916679), Melanbon borrow pit, Dyje basin (48.676099, 16.923803); Kyjovka River (48.723237, 16.971280); Danube basin, Czech Republic; Niushan Lake, Hubei Province (30.347805, 114.522061) China.

Type specimens: Holotype and three paratypes mounted in Canada Balsam, and three hologenophores, deposited in the Helminthological collection at the Institute of Parasitology, Academy of Sciences of the Czech Republic, České Budějovice (IPCAS M-775). Two paratypes deposited in the Natural History Museum in Vienna, Austria (NHMW-ZOO-EV-M-5883, NHMW-ZOO-EV-M-5884), and two parasites deposited in Hasselt University in Diepenbeek, Belgium (HU XIX.2.21, HU XIX.2.22).

Etymology: The specific epithet has a root from the fish host genus name, Pseudorasbora.

Note: The authors of the new taxa are different from the authors of this paper: Article 50.1 and Recommendation 50A of the International Code of Zoological Nomenclature [34].

Material examined: 58 flattened specimens (morphology; 5 specimens from type locality), 10 ethanol preserved specimens (DNA analysis, Europe).

Morphological description (Fig. 3, Table 5)

General morphology based on 58 specimens (i.e., n = 58, unless otherwise stated). Measurements from different sampling sites are shown in Supplementary Table S1. Body small to medium, elongate, with length 549 (299–703) and width 116 (72–187) at midbody (n = 52). Haptor circular to oval, 116 (71–181) long, 99 (60–142) wide, pharynx 34 (20–50) long and 33 (21–47) wide (n = 52). MCO circular, located laterally to pharynx, 15 (10–18) long and 15 (13–20) wide, observed in 12 specimens at five localities. MCO armed with one principal spine, two medium spines and 6–7 smaller spines in a single row (Fig. 3B–c). Anchors robust, total length 51.9 (46.2–59.0), shaft length 34.6 (29.2–39.6), root length 16.4 (11.9–24.2), point length 23.6 (18.5–27.9), and aperture length 17.8 (13.0–24.5; n = 57). Dorsal bar 1.9 (1.2–2.6) long, 19.9 (17.1–25.4) wide, with protrusions at the top on either side of the bar, about one-quarter from the attachment to the anchor. Ventral bar (n = 55) median length 6.8 (5.2–8.3), total length 21.9 (18.1–27.5), width 23.0 (19.1–27.6), anterolateral processes of ventral bar 2.7 (1.5–4.0) long. Membrane 12.1 (9.4–16.4) long, subrectangular, tongue tapering. Marginal hook total length 25.0 (22.8–27.4), shaft length 20.0 (18.2–22.3). Marginal hook sickles 5.2 (4.5–5.9) long, 2.6 (2.0–3.1) wide distally, 3.4 (2.7–3.9) wide proximally, aperture 4.1 (3.5–4.8) long; sickle toe 1.2 (0.9–1.4) wide, filament 11.0 (9.6–12.7) long.

Table 5

Comparison of morphometric parameters (mean, range; μm) for Gyrodactylus pseudorasborae n. sp. collected in various localities in Europe and China with other closely related monogenean species.

Representative DNA sequence

The 1233 bp sequence comprising the partial 18S rDNA (15 bp) and 28S rDNA (9 bp), and complete ITS1 (625 bp), 5.8S rDNA (157 bp) and ITS2 (427 bp) sequences, have been deposited in the GenBank database under accession number OQ598690.

Remarks

The morphology and size of the haptoral hard parts of G. pseudorasborae n. sp. are closely related to those of G. parvae, recently described from topmouth gudgeon in China [93], and to G. gobiensis and G. gobii parasitising various gudgeon species in Eurasia [24, 77]. The size of the anchors is comparable with those of G. parvae and G. gobii, though it is smaller than those of G. gobiensis ([24]; Table S1). Gyrodactylus pseudorasborae n. sp. differs from the other Gyrodactylus species in features related to the marginal hook, dorsal bar and MCO. Based on morphology and metrics of the marginal hooks, the new species differs (1) from G. parvae by the length of the marginal hook shaft and width of the marginal sickle toe, being smaller in G. pseudorasborae n. sp.; (2) from G. gobii by the sickle length, distal and proximal sickle width and toe width, which are larger in G. gobii; and (3) from G. gobioninum by the shape of the sickle, which is more straight and robust in G. pseudorasborae n. sp. (Fig. 4). The morphology of the dorsal bar, i.e., the presence of protrusions at the top on either side of the bar, resembles that of G. gobioninum, but differentiates the new species from G. gobii. Unfortunately, a drawing of the dorsal bar was not provided in the description of G. parvae and, moreover, the bar was not in focus in the microphotograph published in [93], making morphology of the dorsal bar unclear in G. parvae. Finally, G. pseudorasborae n. sp. differs from the other species in the number of spines on the MCO. While it consists of one large, two medium and 6–7 small spines in G. pseudorasborae n. sp., the MCO in G. parvae and G. gobii consists of one large, two medium and five small spines, and one large, two medium and three small spines in G. gobioninum [24, 93]. The ITS sequence data obtained, and their phylogenetic associations, support the designation of a new species, discriminating G. pseudorasborae n. sp. from the morphometrically similar species G. parvae and G. gobii.

thumbnail Figure 4

A–C: Line drawings of the marginal hook sickle of Gyrodactylus pseudorasborae n. sp. ex Pseudorasbora parva from China (A), Ukraine (B) and the Czech Republic (C); D: G. parvae ex Pseudorasbora parva, China, redrawn from You et al. (2008); E: G. gobioninum, redrawn from Galli et al. 2010, and F: G. gobii ex Romanogobio vladykovi, from the Czech Republic.

Phylogenetic positioning of Gyrodactylus pseudorasborae n. sp.

ML and BI analyses of ITS1-5.8S rDNA-ITS2 sequences yielded almost identical trees, with the topology roughly corresponding to the tree structure in Gilmore et al. [25], Zietara et al. [96] and Matějusová et al. [50]. Gyrodactylus species were found to form three major clades (Fig. 5), the new sequences of both Gyrodactylus species obtained in the present study being nested within two of the three recovered clades. Sequence data support the position of G. pseudorasborae n. sp. within the “long” ITS1 clade (sensu Cable et al. [16]) consisting of Eurasian species belonging to the subgenus Limnonephrotus. Gyrodactylus pseudorasborae n. sp., Gyrodactylus sp. and G. parvae, all parasites of topmouth gudgeon, were shown to be sister taxa and formed a well-supported clade in a basal position to the “wageneri” group, consisting of G. gobii, G. gobiensis, G. leucisci, G. longiradix, G. luciopercae, G. ouluensis, G. pungitii and G. salaris [96]. Gyrodactylus prostae was positioned within the clade consisting of Gyrodactylus species of the elegans/phoxini group of the subgenus G. (Gyrodactylus) parasitising European cyprinids.

thumbnail Figure 5

The phylogenetic relationships of Gyrodactylus pseudorasborae n. sp. and G. parvae parasitising Pseudorasbora parva within related Eurasian Gyrodactylus species. The phylogenetic tree is inferred from a Maximum Likelihood (ML) analysis of the 834 bp alignment of ITS1-5.8S rDNA-ITS2 sequences. Numbers along branches represent Bayesian posterior probability/ML bootstrap support (only values > 0.70 for BI and > 50% for ML shown). Newly obtained sequences from the present study are in bold. Sequences of Gyrodactylus species parasitising Pseudorasbora parva are highlighted in grey. The branch length scale bar indicates the number of substitutions per site.

2 Dactylogyridae

Of the three dactylogyrid species found within the topmouth gudgeon native Asian range, i.e., Ancyrocephalus parvae, D. squameus and B. obscurus, two have been recorded in Europe. Ancyrocephalus parvae was observed solely in fish from Niushan Lake in China (native range), infecting 80% of fish with a mean abundance of 9.8 and an intensity of infection ranging from 1 to 27 (Table 1).

Dactylogyrus squameus was found rarely on the Dnieper River (Ukraine), Kyjovka River and the Melanbon borrow pit (Czech Republic), with a maximum of two parasites per fish (Table 1). Similarly, only two specimens of D. squameus have been recorded on native fish at Niushan Lake in China (Table 1). Measurements of the hard parts of the haptor and copulatory organ of D. squameus were higher in fish from its non-native European range (Supplementary Table S2, Fig. 1). Our specimens (Accession Nos. OQ598693 and OQ598695 for 18S and 28S) displayed low intraspecific 28S rDNA variability (p-distance = 0.1%) when compared with native specimens retrieved from GenBank (KX812459, Yingjiang of Yunnan, China, 28S), but the same sequence variability was observed for 18S-ITS1 rDNA when compared with specimens obtained in the Czech Republic (AJ564156; [78]).

In its non-native range, B. obscurus (Fig. 6) parasitised fish in the Dnieper River and the Melanbon borrow pit, with a prevalence of up to 40%, a mean abundance of 0.5 and a maximum intensity of infection of three parasites per host in the Melanbon borrow pit (Table 1). While no fish were infected at Bao’an Lake, all fish from Niushan Lake were infected at a mean abundance of 7.2 and an intensity of infection ranging from 1 to 14 parasites per host. Measurements for B. obscurus were higher in fish from its non-native European range (Fig. 1; Supplementary Table S2). A 789 bp nucleotide sequence of partial 28S rDNA, and a nucleotide sequence representing a 1006 bp rDNA fragment spanning partial 18S rDNA (489 bp) and the ITS1 (517 bp) sequence have been deposited in GenBank under accession numbers OQ598692 and OQ598694. No sequence variability was observed between specimens from the Dnieper River and the Melanbon borrow pit for the partial 28S or 18S–ITS1 rDNA sequences. A BLASTn search of both gene fragments revealed no identical hits with entries in GenBank (February 2023). The closest hit for the 28S rDNA sequence was for D. primarius (92.45%; OP320903; Chang et al., unpublished) described from Chinese hooksnout carp Opsariichthys bidens in China, and for D. gobiocypris parasitising the gills of a rare minnow Gobiocypris rarus in China using the 18S–ITS1 sequence (89.94%; OP441417; [18]).

thumbnail Figure 6

Photomicrograph of Bivaginogyrus obscurus ex Pseudorasbora parva (A) in its native Asian range (Niushan Lake, China), with the detail showing the two vaginae (B, white arrows).

Phylogenetic position of B. obscurus within Dactylogyridae

BI and ML analyses both provided trees with identical topologies (Fig. 7). The phylogenetic reconstruction divided all taxa into four strongly supported clades and revealed the clear inclusion of B. obscurus within Dactylogyrus species (Fig. 7). Bivaginogyrus obscurus appears to be most closely related to Dactylogyrus species belonging to clade D (lineage IV sensu Šimková et al. [81]), comprising Eurasian species parasitising Gobionidae, Xenocyprididae, Acheilognathidae and Lateolabracidae. This clade is divided into two well supported groups, whereas the group including B. obscurus comprises three species (D. latituba, D. claveaformis and D. primarius) parasitising sharpbelly carp Hemiculter leucisculus and O. bidens (Xenocyprinidae) in China, and the three Dactylogyrus species (D. squameus, D. cryptomeres and D. pseudogobii) parasitising Eurasian Gobionidae (topmouth gudgeon, gudgeon Gobio gobio and Chinese false gudgeon Abbottina rivularis).

thumbnail Figure 7

The phylogenetic relationships of Bivaginogyrus obscurus parasitising Pseudorasbora parva within Dactylogyridae. The phylogenetic tree is inferred from a Maximum Likelihood (ML) analysis of the 763 bp alignment of partial 28S rDNA sequences. Numbers along the branches represent Bayesian posterior probability/ML bootstrap support (only values > 0.70 for BI and > 50% for ML shown). Newly obtained sequences from the present study are in bold. Sequences of Dactylogyrus species parasitising P. parva are highlighted in grey. The branch length scale bar indicates the number of substitutions per site.

Discussion

In its native range, the topmouth gudgeon is parasitised by three dactylogyrid and three gyrodactylid monogeneans. Of these, two dactylogyrids, D. squameus and B. obscurus, and two gyrodactylids, G. gobioninum and the G. pseudorasborae n. sp. described in this study, were co-introduced into Europe. To date, A. parvae and G. parvae have only been reported from the hostʼs native Asian range, while the three gyrodactylid species, including G. prostae (this study), G. cyprini and G. katharineri [48], were acquired once in Europe. Rare occurrence of native monogeneans along with the relatively low prevalence and abundance support the Enemy Release Hypothesis [87]. This theory suggests that some species may be temporarily advantaged by release of parasites and pathogens that are numerous in the native population but far less so in the new non-native population, contributing to their invasion success [69, 87]. Accordingly, avoidance of high parasite infections in the non-native range may possibly represent one of the factors contributing to the topmouth gudgeonʼs invasion success in Europe.

Distribution of co-introduced monogeneans

Occurrence of D. squameus and B. obscurus was confirmed in both regions of this study, i.e., the Lower Dnieper irrigation canal in Ukraine and the basins of the Lower Morava and Dyje Rivers (Middle Danube watershed) in the Czech Republic. Previous European records of D. squameus include lentic water bodies in the Dyje River floodplain [62] and along the Morava River [78] in the Czech Republic, Ticino River in Italy [23] and a fish pond near Kyiv (Dnieper river basin) in Ukraine [94]. All reports show accidental occurrence of the parasite species rather than common infection, which agrees both with our results, showing low prevalence and abundance in both regions (Danube and Dnieper basins), and with the infection of native topmouth gudgeon observed in Niushan Lake in China (Table 1). Likewise, a low intensity of infection (1–3) was observed at three native sites in Japan, despite a higher prevalence (25–100%), indicating that infection of topmouth gudgeon with D. squameus is naturally low, potentially limiting the probability of co-introduction into new areas. Though our results do not extend the distribution of the parasite to a wider scale (river basin), they confirm that D. squameus is maintained in the host population for a long time, even at low prevalence and intensities of infection.

Natural infection by B. obscurus is apparently higher than by D. squameus, with all fish in Niushan Lake in China being infected with a mean abundance of 7.2 (Table 1), and a similar prevalence and abundance found in Lake Kasumigaura in Japan [57]. Likewise, a 100% prevalence was recorded in congeneric Japanese moroco Pseudorasbora pumila pumila in Utabi and Ymabuse ponds in Japan [57]. Nevertheless, reports of B. obscurus introduction into Europe are scarce, with the species previously reported solely from ponds in the Dnieper River basin near Kyiv [94]. Thus, our data extends the European distribution of B. obscurus to the Dyje basin (Danube watershed) in the Czech Republic, a distance of over 1,000 km, though the frequency of occurrence and loading remain relatively low. This recent finding of the species may suggest a new introduction event of topmouth gudgeon, possibly as a pest transported along with commercially important fish species.

Unlike dactylogyrids, Gyrodactylus parasites native to topmouth gudgeon were found at all sampling sites, often at high prevalence, including a new species, G. pseudorasborae n. sp. (see Table 1), indicating its wider distribution in Europe. While frequent occurrence of Asian G. gobioninum was observed in a Bulgarian fish farm [48], no further European records of this species have been published since that time. However, the taxonomy of G. gobioninum is still unresolved and probably involves a group of species [32]. Absence of G. pseudorasborae n. sp., as well as any dactylogyrids, in topmouth gudgeon from the Bulgarian fish farm may indicate that those fish were introduced from a source different from that of fish inhabiting lentic water bodies along the Morava, Dyje and Dnieper Rivers.

Description of a new parasite species in its host’s non-native range

One side-effect of species introductions is the co-introduction of their parasites, and these species may receive more attention in their area of introduction than their native area. Thus, it is not unusual that some hitherto undescribed species is found and described in the host’s non-native range. As an example, the monogenean Dactylogyrus extensus was first described from common carp Cyprinus carpio in North America, though later phylogenetic studies indicated that the parasite is very likely of Eurasian origin [78], while cryptic diversity of G. nebulosus led to the description of G. melas from American bullhead Ameiurus melas in its non-native European range [64]. Similarly, thanks to more advanced imaging techniques and genetic methods, G. pseudorasborae n. sp. was distinguished as a separate species, despite its high morphological similarity with G. parvae. High genetic similarity with Chinese Gyrodactylus sp. obtained from topmouth gudgeon (99.57%; Chang et al., unpublished), morphological consistence between European and our own data from two Chinese populations (Figs. 2 and 3) and the phylogenetic positioning of G. pseudorasborae n. sp. as a sister species to G. parvae, a native parasite of topmouth gudgeon, all support our suggestion that G. pseudorasborae n. sp. is of Asian origin and was introduced into Europe along with its fish host.

Parasite acquisition in host’s non-native range

Parasite acquisition occurs relatively often after the introduction of a new host species into a novel environment, with the local parasite species acquired by invaders usually being those with low host specificity or those infecting phylogenetically related species [68]. Monogenean parasites are often host specific, particularly those of the Dactylogyridae [51, 79]; thus, it is no surprise that no local dactylogyrid species have been found to infect topmouth gudgeon in Europe. Gyrodactylidae are generally less specific and include species from strict specialists to generalists infecting fish over different families and orders [4]. Based on the published data, G. prostae appears able to infect a range of cyprinid species [29, 54], and infection of another cyprinid such as topmouth gudgeon would therefore be expected. It is rather surprising, therefore, that records of topmouth gudgeon infection by less specific local gyrodactylids are so rare (see Margaritov and Kiristis [48] for an exception) and that fish from only one locality in our study were infected with local gyrodactylid species, at relatively low prevalence and abundance. These results correspond to the findings of Margaritov and Kiristis [48], who reported only accidental occurrence of G. cyprini and low parasite loading by G. katharineri acquired on a Bulgarian fish farm, in contrast to the higher infection load in co-introduced G. gobioninum.

Do parasites grow better in their non-native range?

Better performance of invasive species compared to their conspecifics in native ranges has been documented for a wide range of organisms, though this pattern is not universal and many other species largely perform the same across ranges. This increase in the size of invasive species has been promoted as one of the factors contributing to their invasion success [67]. Although neither of the parasites found in this study are considered invasive species, the length of the attachment apparatus hard parts and, in the case of dactylogyrids, of the copulatory organ, was generally larger in the introduced parasites. Previous studies have attributed the size of the haptoral hard parts in monogeneans to the size of the host [7, 51] or water temperature [21, 53]. In temperate zones, many gyrodactylids are cold-water preferring parasites and, accordingly, their abundance and the size of the haptoral hard parts does indeed tend to decrease with water temperature [21, 53]. This association may explain the significantly larger worms found in the coldest month sampled in this study (April, water temperature 14 °C) compared to other samples (Fig. 2) and the similar values between Chinese (native) and Ukrainian (non-native) parasites, both being collected in June. Nevertheless, larger mean measurements were observed across all samples from the non-native range, irrespective of season (Table S1). In contrast to gyrodactylids, studies have shown that the size of hard parts in dactylogyrids tends to reflect their host size [51]. On the other hand, host size could not explain the larger size of other dactylogyrids co-introduced to Europe from North America, i.e., Onchocleidus dispar and Actinocleidus recurvatus [63], as the host displayed a much slower growth rate and smaller adult size than fish in native range [19]. In comparison, the topmouth gudgeon collected in Europe were much larger than those from its native China (Table 1), suggesting that the species may perform better in its non-native range as space competition for gill parasites is lowered (absence of A. pseudorasborae), thus resulting in larger individuals. It is also possible that parasites co-introduced to Europe were those with larger attachment apparatuses, and that these better survive transportation and go on to establish populations in the host’s new range.

Phylogenetic positioning of Bivaginogyrus obscurus within Dactylogyridae

Bivaginogyrus obscurus was originally described as a Dactylogyrus species from topmouth gudgeon in the Amur River basin [27]. Owing to its unique feature of possessing two vaginae (Fig. 6), however, Gusev and Gerasev [28] established a monotypic genus, i.e., Bivaginogyrus, for the species. Recent investigation of endemic gobionid fish in Japan, however, led to the description of three new Bivaginogyrus species infecting two Gnathopodon species [61]. Similarly to their observation, our phylogenetic analysis indicated inclusion of B. obscurus within Dactylogyrus species, with B. obscurus clustered with Dactylogyrus species parasitising Gobionidae and Xenocyprididae, including D. squameus, another dactylogyrid species infecting topmouth gudgeon (Fig. 7). Even though several studies have suggested a monophyletic origin of the Dactylogyrus (e.g., [78, 79]), more recent studies present data supporting its paraphyly by representatives of Acolpenteron, Dogielius and Dactylogyroides [1, 38]. This is consistent with our own results, with Bivaginogyrus being in a sister relationship with D. primarius infecting xenocyprid fish. As with Acolpenteron ureteroecetes, B. obscurus was included within clade G sensu Aguiar et al. [1] (clade IV sensu Šimková et al. [81]). Our results, therefore, further support the recent suggestions of a paraphyletic origin of the Dactylogyrus, suggesting the need for detailed phylogenetic studies including a wider range of dactylogyrid genera, as recommended by Kmentová et al. [38].

Conclusions

Our results show that topmouth gudgeon, one of the most successful freshwater fish invaders in Europe, appears able to avoid high parasite infections in its non-native range. The fish were less parasitised by their native, co-introduced parasites compared to their native conspecifics, and acquisition of local parasite species occurred only rarely. Release from parasites has been considered one of the factors affecting successful establishment of non-native species and their subsequent invasiveness [87], which may well be applicable for topmouth gudgeon. A relatively low monogenean prevalence and abundance found in our study further corresponds to the generally low infection load by local species found over a wide range of European topmouth gudgeon populations [26].

Conflict of interest

The authors declare that they have no conflicts of interest.

Acknowledgments

This study was supported financially by the Czech Science Foundation, project No. 20-29111S. We would like to thank our colleagues from the Czech Academy of Sciences (Institute of Vertebrate Biology) and the Faculty of Science, Masaryk University, for their support during fish sampling and parasite processing. We would also like to thank Dr. Kevin Roche for proofreading the English text.

Supplementary material

Supplementary Table S1: Comparison of morphometric parameters (mean, range; µm) for Gyrodactylus pseudorasborae n. sp. (Monogenea: Gyrodactylidae) collected from Pseudorasbora parva in various localities in Europe (non-native range) and China (native range).

Supplementary Table S2: Comparison of morphometric parameters (mean, range; µm) for Bivaginogyrus obscurus and Dactylogyrus squameus (Monogenea: Dactylogyridae) collected from Pseudorasbora parva in various localities in Europe (non-native range), China (native range) and published data.

Access here

References

  1. Aguiar JC, Maia AAM, Silva MRM, Ceccarelli PS, Domingues MV, Adriano EA. 2017. An integrative taxonomic study of Pavanelliella spp. (Monogenoidea, Dactylogyridae) with the description of a new species from the nasal cavities of an Amazon pimelodid catfish. Parasitology International, 66, 777–788. [CrossRef] [PubMed] [Google Scholar]
  2. Ahne W, Thomsen I. 1986. Isolation of pike fry rhabdovirus from Pseudorasbora parva (Temminck and Schlegel). Journal of Fish Diseases, 9, 555–556. [CrossRef] [Google Scholar]
  3. Azuma M, Motomura Y. 1998. Feeding habits of largemouth bass in a non-native environments: the case of a small lake with bluegill in Japan. Environmental Biology of Fishes, 52, 379–389. [CrossRef] [Google Scholar]
  4. Bakke TA, Cable J, Harris PD. 2007. The biology of gyrodactylid monogeneans: the “Russian-doll killers”. Advanced in Parasitology, 64, 161–376. [CrossRef] [Google Scholar]
  5. Bănărescu P. 1964. Fauna Republicii Populare Române. 13. Pisces - Osteichthyes (peşti ganoizi şi osoşi), vol 13, Academiei Republicii Populare Române: Bucuresti. [Google Scholar]
  6. Behrmann-Godel J, Roch S, Brinker A. 2014. Gill worm Ancyrocephalus percae (Ergens 1966) outbreak negatively impacts the Eurasian perch Perca fluviatilis L. stock of Lake Constance, Germany. Journal of Fish Diseases, 37(10), 925–930. [CrossRef] [PubMed] [Google Scholar]
  7. Belova SV. 1988. Variability of chitinoid structures of Dactylogyrus hypophtalmichthys (Monogenoidea) in relation to host size and season, in Investigations of Monogeneans in the USSR. Skarlato OA, Editor. Balkema: Rotterdam. p. 38–43. [Google Scholar]
  8. Benovics M, Kičinjaová ML, Šimková A. 2017. The phylogenetic position of the enigmatic Balkan Aulopyge huegelii (Teleostei: Cyprinidae) from the perspective of host-specific Dactylogyrus parasites (Monogenea), with a description of Dactylogyrus omenti n. sp. Parasites & Vectors, 10, 547. [CrossRef] [PubMed] [Google Scholar]
  9. Benovics M, Desdevises Y, Vukic J, Sanda R, Simkova A. 2018. The phylogenetic relationships and species richness of host-specific Dactylogyrus parasites shaped by the biogeography of Balkan cyprinids. Scientific Reports, 8(1), 13006. [CrossRef] [PubMed] [Google Scholar]
  10. Benovics M, Desdevises Y, Šanda R, Vukić J, Scheifler M, Doadrio I, Sousa-Santos C, Šimková A. 2020. High diversity of fish ectoparasitic monogeneans (Dactylogyrus) in the Iberian Peninsula: a case of adaptive radiation? Parasitology, 147, 418–430. [CrossRef] [PubMed] [Google Scholar]
  11. Benovics M, Nejat F, Abdoli A, Simkova A. 2021. Molecular and morphological phylogeny of host-specific Dactylogyrus parasites (Monogenea) sheds new light on the puzzling Middle Eastern origin of European and African lineages. Parasites & Vectors, 14(1), 372. [CrossRef] [PubMed] [Google Scholar]
  12. Beyer K. 2004. Escapees of potentially invasive fishes from an ornamental aquaculture facility: the case of topmouth gudgeon Pseudorasbora parva. Journal of Fish Biology, 65(Suppl. A), 326–327. [CrossRef] [Google Scholar]
  13. Blasco-Costa MI, Míguez-Lozano R, Sarabeev V, Balbuena JA. 2012. Molecular phylogeny of species of Ligophorus (Monogenea: Dactylogyridae) and their affinities within the Dactylogyridae. Parasitology International, 61, 619–627. [CrossRef] [PubMed] [Google Scholar]
  14. Bruno DW, Collins CM, Cunningham CO, MacKenzie K. 2001. Gyrodactyloides bychowskii (Monogenea: Gyrodactylidae) from sea-caged Atlantic salmon Salmo salar in Scotland: occurrence and ribosomal RNA sequence analysis. Diseases of Aquatic Organisms, 45, 191–196. [CrossRef] [PubMed] [Google Scholar]
  15. Bush AO, Lafferty KD, Lotz JM, Shostak AW. 1997. Parasitology meets ecology on its own terms: Margolis et al. Revisited. Journal of Parasitology, 83, 575–583. [Google Scholar]
  16. Cable J, Harris PD, Tinsley RC, Lazarus CM. 1999. Phylogenetic analysis of Gyrodactylus spp. (Platyhelminthes: Monogenea) using ribosomal DNA sequences. Canadian Journal of Zoology, 77(9), 1439–1449. [CrossRef] [Google Scholar]
  17. Cakic P, Lenhardt M, Kolarevic J, Mickovic B, Hegedis A. 2004. Distribution of the Asiatic cyprinid Pseudorasbora parva in Serbia and Montenegro. Journal of Fish Biology, 65, 1431–1434. [CrossRef] [Google Scholar]
  18. Cheng J, Zou H, Li M, Wang J, Wang G, Li W. 2023. Morphological and Molecular Identification of Dactylogyrus gobiocypris (Monogenea: Dactylogyridae) on Gills of a Model Fish, Gobiocypris rarus (Cypriniformes: Gobionidae). Pathogens, 12(2), 206. [CrossRef] [PubMed] [Google Scholar]
  19. Copp GH, Fox MG. 2007. Growth and life history traits of introduced pumpkinseed (Lepomis gibbosus) in Europe, and the relevance to its potential invasiveness, in Biological invaders in inland waters: Profiles, distribution, and threats. Gherardi F, Editor. Springer: Dordrecht. p. 289–306. [CrossRef] [Google Scholar]
  20. Cunningham CO. 1997. Species variation within the internal transcribed spacer (ITS) region of Gyrodactylus (Monogenea: Gyrodactylidae) ribosomal RNA genes. Journal of Parasitology, 83(2), 215–219. [CrossRef] [Google Scholar]
  21. Dávidová M, Jarkovský J, Matějusová I, Gelnar M. 2005. Seasonal occurrence and metrical variability of Gyrodactylus rhodei Žitňan 1964 (Monogenea, Gyrodactylidae). Parasitology Research, 95, 398–405. [CrossRef] [PubMed] [Google Scholar]
  22. Fazio G, Sasal P, Mouahid G, Lecomte-Finiger R, Moné H. 2012. Swim bladder nematodes (Anguillicoloides crassus) disturb silvering in european eels (Anguilla anguilla). Journal of Parasitology, 98(4), 695–705. [CrossRef] [PubMed] [Google Scholar]
  23. Galli P, Strona G, Benzoni F, Crosa G, Stefani F. 2007. Monogenoids from freshwater fish in Italy, with comments on alien species. Comparative Parasitology, 74, 264–272. [CrossRef] [Google Scholar]
  24. Galli P, Pugachev ON, Kritsky D. 2010. Guide to Monogenoidea of freshwater fish of Palaearctic and Amur regions. Ledizioni-Ledi Publishing: Milan. [Google Scholar]
  25. Gilmore SR, Cone DK, Lowe G, King SK, Jones SRM, Abbott CL. 2012. Molecular phylogeny of Gyrodactylus (Monogenea) parasitizing fishes in fresh water, estuarine, and marine habitats in Canada. Canadian Journal of Zoology, 90(6), 776–786. [CrossRef] [Google Scholar]
  26. Gozlan RE, Andreou D, Asaeda T, Beyer K, Bouhadad R, Burnard D, Caiola N, Cakic P, Djikanovic V, Esmaeili HR, Falka I, Golicher D, Harka A, Jeney G, Kováč V, Musil J, Nocita A, Povz M, Poulet N, Virbickas T, Wolter C, Tarkan AS, Tricarico E, Trichkova T, Verreycken H, Witkowski A, Zhang CG, Zweimueller I, Britton JR. 2010. Pan-continental invasion of Pseudorasbora parva: towards a better understanding of freshwater fish invasions. Fish & Fisheries, 11, 315–340. [CrossRef] [Google Scholar]
  27. Gussev AV. 1955. Monogenetic trematodes of the fishes of Amur River system. Trudy Zoologicheskogo Instituta Academii Nauk USSR, 19, 171–400. [Google Scholar]
  28. Gussev AV, Gerasev PI. 1985. Rod Bivaginogyrus Gussev et Gerasev 1985, in Opredelitel’ Parazitov Presnovodnykh Ryb Fauny SSSR, Tom 2. Bauer ON, Editor. Nauka: Leningrad. p. 192–194 [In Russian]. [Google Scholar]
  29. Gusev AV, Dubinina MN, Raikova EV, Khotenkovskiy IA, Pugachev ON, Ergens R. 1985. Paraziticheskiye mnogokletochnye. Part 1. Monogenea, in Opredelitel’ Parazitov Presnovodnykh Ryb Fauny SSSR, Tom 2. Bauer ON, Editor. Nauka: Leningrad. p. 10–268 [In Russian]. [Google Scholar]
  30. Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98. [Google Scholar]
  31. Hardouin EA, Andreou D, Zhao Y, Chevret P, Fletcher DH, Britton JR, Gozlan RE. 2018. Reconciling the biogeography of an invader through recent and historic genetic patterns: the case of topmouth gudgeon Pseudorasbora parva. Biological Invasions, 20, 2157–2171. [CrossRef] [Google Scholar]
  32. Harris PD, Shinn AP, Cable J, Bakke TA. 2004. Nominal species of the genus Gyrodactylus von Nordmann 1832 (Monogenea: Gyrodactylidae), with a list of principal host species. Systematic Parasitology, 59, 1–27. [Google Scholar]
  33. Hassouna N, Michot B, Bachellerie JP. 1984. The complete nucleotide sequence of mouse 28S rRNA gene. Implications for the process of size increase of the large subunit rRNA in higher eukaryotes. Nucleic Acids Research, 12(8), 3563–3583. [CrossRef] [PubMed] [Google Scholar]
  34. ICZN. 1999. International Code of Zoological Nomenclature. The International Trust for Zoological Nomenclature: London. http://www.nhm.ac.uk/hosted-sites/iczn/code/. [Google Scholar]
  35. Kalyaanamoorthy S, Minh B, Wong T, von Haeseler A, Jermiin LS. 2017. ModelFinder: fast model selection for accurate phylogenetic estimates. Nature Methods, 14(6), 587–589. [CrossRef] [PubMed] [Google Scholar]
  36. Katoh K, Rozewicki J, Yamada KD. 2019. MAFFT online service: multiple sequence alignment, interactive sequence choice and visualization. Briefings in Bioinformatics, 20(4), 1160–1166. [CrossRef] [PubMed] [Google Scholar]
  37. Kirk RS. 2003. The impact of Anguillicola crassus on European eels. Fisheries Management and Ecology, 10, 385–394. [CrossRef] [Google Scholar]
  38. Kmentová N, Cruz-Laufer AJ, Pariselle A, Smeets K, Artois T, Vanhove MPM. 2022. Dactylogyridae 2022: a meta-analysis of phylogenetic studies and generic diagnoses of parasitic flatworms using published genetic and morphological data. International Journal for Parasitology, 52, 427–457. [CrossRef] [PubMed] [Google Scholar]
  39. Kottelat M, Freyhof J. 2007. Handbook of European freshwater fishes. Publications Kottelat, Cornol and Freyhof: Berlin. [Google Scholar]
  40. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35(6), 1547–1549. [CrossRef] [PubMed] [Google Scholar]
  41. Kuusela J, Zietara MS, Lumme J. 2008. Description of three European cryptic species of Gyrodactylus Nordmann, 1832 supported by nuclear and mitochondrial phylogenetic characterisation. Acta Parasitologica, 53(2), 120–126. [CrossRef] [Google Scholar]
  42. Kvach Y, Ondračková M, Janáč M, Jurajda P. 2016. Methodological issues affecting the study of fish parasites. I. Duration of live fish storage prior to dissection. Diseases of Aquatic Organisms, 119, 107–115. [CrossRef] [PubMed] [Google Scholar]
  43. Kvach Y, Ondračková M, Bryjová A, Jurajda P. 2017. Parasites as biological tags of divergence in Central European gudgeon populations (Actinopterygii: Cyprinidae: Gobioninae). Biologia, 72, 671–679. [CrossRef] [Google Scholar]
  44. Kvach Y, Ondračková M, Kutsokon Y, Dzyziuk N. 2018. New record of monogenean parasites on non-indigenous fishes in the Ukrainian Danube delta. BioInvasions Records, 7, 65–72. [CrossRef] [Google Scholar]
  45. Li RR, Li WX, Wu XD, Wang GT. 2014. Identification of Gyrodactylus species in goldfish (Carassius auratus) through morphological study and the analysis of rDNA ITS sequence. Acta Hydrobiologica Sinica, 38, 903–909. [Google Scholar]
  46. Lymbery AJ, Morine M, Kanani HG, Beatty SJ, Morgan DL. 2014. Co-invaders: the effects of alien parasites on native hosts. International Journal for Parasitology: Parasites and Wildlife, 3, 171–177. [CrossRef] [Google Scholar]
  47. Malmberg G. 1970. The excretory systems and the marginal hooks as a basis for the systematics of Gyrodactylus (Trematoda, Monogenea). Arkiv für Zoology, 23, 1–235. [Google Scholar]
  48. Margaritov NM, Kiritsis SG. 2011. Parasites of topmouth gudgeon Psudorasbora parva (Schlegel) in fish farms in Bulgaria. Acta Zoologica Bulgarica, 63, 187–193. [Google Scholar]
  49. Matějusová I, Gelnar M, McBeath AJA, Collins CM, Cunningham CO. 2001. Molecular markers for gyrodactylids (Gyrodactylidae: Monogenea) from five fish families (Teleostei). International Journal for Parasitology, 31, 738–745. [CrossRef] [PubMed] [Google Scholar]
  50. Matejusová I, Gelnar M, Verneau O, Cunningham CO, Littlewood DTJ. 2003. Molecular phylogenetic analysis of the genus Gyrodactylus (Platyhelminthes: Monogenea) inferred from rDNA ITS region: subgenera versus species groups. Parasitology, 127(6), 603–611. [CrossRef] [PubMed] [Google Scholar]
  51. Mendlová M, Šimková A. 2014. Evolution of host specificity in monogeneans parasitizing African cichlid fish. Parasites & Vectors, 7, 69. [CrossRef] [PubMed] [Google Scholar]
  52. Minh BQ, Nguyen MAT, von Haeseler A. 2013. Ultrafast approximation for phylogenetic bootstrap. Molecular Biology and Evolution, 30(5), 1188–1195. [CrossRef] [PubMed] [Google Scholar]
  53. Mo TA. 1991. Variation of opisthaptoral hard parts of Gyrodactylus salaris Malmberg, 1957 (Monogenea: Gyrodactylidae) on rainbow trout Oncorhynchus mykiss (Walbaum, 1792) in a fish farm, with comments on the spreading of the parasite in south-eastern Norway. Systematic Parasitology, 20, 1–10. [Google Scholar]
  54. Moravec F. 2001. Checklist of metazoan parasites of fishes of the Czech Republic and the Slovak Republic (1873–2000). Akademia: Praha. [Google Scholar]
  55. Nagasawa K, Kim Y-G, Hirose H. 1994. Anguillicola crassus and A. globiceps (Nematoda: Dracunculoidea) parasitic in the swimbladder of eels (Anguilla japonica and A. anguilla) in East Asia: a review. Folia Parasitologica, 41, 127–137. [Google Scholar]
  56. Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ, Notes A. 2015. IQ-TREE: a fast and effective stochastic algorithm for estimating maximum-likelihood phylogenies. Molecular Biology and Evolution, 32(1), 268–274. [CrossRef] [PubMed] [Google Scholar]
  57. Nitta M, Nagasawa K. 2014. Bivaginogyrus obscurus (Monogenea: Dactylogyridae), a gill parasite of two cyprinids Pseudorasbora pumila pumila and Pseudorasbora parva, new to Japan. Species Diversity, 19, 167–171. [CrossRef] [Google Scholar]
  58. Nitta M, Nagasawa K. 2016. New geographical records of three gill monogeneans (Platyhelminthes) parasitic on Pseudorasbora parva (Cypriniformes: Cyprinidae) in Japan. Species Diversity, 21, 1–7. [CrossRef] [Google Scholar]
  59. Nitta M, Nagasawa K. 2016. A new species of Dactylogyrus (Monogenea: Dactylogyridae) parasitic on an endangered freshwater fish, Rhodeus atremius atremius, endemic to Japan. Parasitology International, 65, 483–487. [CrossRef] [PubMed] [Google Scholar]
  60. Nitta M, Nagasawa K. 2020. Gobioecetes longibasais n. sp. (Monogenea: Dactylogyridae) from Rhinogobius similis Gill (Perciformes: Gobiidae) from Okinawa-jima Island, the Ryukyu Archipelago, Southern Japan, with a new host record for Gobioecetes biwaensis Ogawa and Itoh, 2017. Systematic Parasitology, 97(2), 193–200. [Google Scholar]
  61. Nitta M, Nagasawa K. 2023. Gill monogeneans (Platyhelminthes) parasitic on Gnathopogon elongatus elongatus and G. caerulescens (Cypriniformes: Gobionidae) from Japan, with descriptions of one new species of Dactylogyrus and three new species of Bivaginogyrus (Dactylogyridae). Species Diversity, 28, 69–97. [CrossRef] [Google Scholar]
  62. Ondračková M, Matějusová I, Šimková A, Gelnar M. 2004. New reports of dactylogyridean species (Monogenea) for Central Europe. Helminthologia, 41, 139–145. [Google Scholar]
  63. Ondračková M, Dávidová M, Přikrylová I, Pečínková M. 2011. Monogenean parasites of introduced pumpkinseed Lepomis gibbosus (Centrarchidae) in the Danube River basin. Journal of Helminthology, 85, 435–441. [CrossRef] [PubMed] [Google Scholar]
  64. Ondračková M, Seifertová M, Bryjová A, Leis E, Jurajda P. 2020. Morphometric and genetic evidence for cryptic diversity in Gyrodactylus (Monogenea) infecting non-native European populations of Ameiurus nebulosus and A. melas. Parasitology, 147, 1700–1711. [CrossRef] [PubMed] [Google Scholar]
  65. Ondračková M, Bartáková V, Kvach Y, Bryjová A, Trichkova T, Ribeiro F, Carassou L, Martens A, Masson G, Zechmeister T, Jurajda P. 2021. Parasite infection reflects host genetic diversity in the pumpkinseeds non-native range. Hydrobiologia, 848, 2169–2187. [CrossRef] [Google Scholar]
  66. Paladini G, Hansen H, Fioravanti ML, Shinn AP. 2011. Gyrodactylus longipes n. sp. (Monogenea: Gyrodactylidae) from farmed gilthead seabream (Sparus aurata L.) from the Mediterranean. Parasitology International, 60, 410–418. [CrossRef] [PubMed] [Google Scholar]
  67. Parker JD, Torchin ME, Hufbauer RA, Lemoine NP, Alba C, Blumenthal DM, Bossdorf O, Byers JE, Dunn AM, Heckman RW, Mn Hejda, Jarošík V, Kanarek AR, Martin LB, Perkins SE, Pyšek P, Schierenbeck K, Schlöder C, van Klinken R, Vaughn KJ, Williams W, Wolfe LM. 2013. Do invasive species perform better in their new ranges? Ecology, 94, 985–994. [CrossRef] [PubMed] [Google Scholar]
  68. Poulin R, Mouillot D. 2003. Host introductions and the geography of parasite taxonomic diversity. Journal of Biogeography, 30, 837–845. [CrossRef] [Google Scholar]
  69. Prenter J, MacNeil C, Dick JTA, Dunn AM. 2004. Roles of parasites in animal invasions. Trends in Ecology and Evolution, 19, 385–390. [CrossRef] [Google Scholar]
  70. Přikrylová I, Matějusová I, Jarkovský J, Gelnar M. 2008. Morphometric comparison of three members of the Gyrodactylus nemachili-like species group (Monogenea: Gyrodactylidae) on Barbatula barbatula L. in the Czech Republic, with a reinstatement of G. papernai Ergens and Bychowsky, 1967. Systematic Parasitology, 69, 33–44. [Google Scholar]
  71. Prost M. 1973. Fish Monogenoidea of Poland. II. Parasites of Ictalurus nebulosus (Le Sueur). Revision of genera Cleidodiscus Mueller, 1934 and Urocleidus Mueller, 1934. Acta Parasitologica Polonica, 21, 315–326. [Google Scholar]
  72. Rambaut A. 2017. FigTree (version 1.4.3). Available at: http://tree.bio.ed.ac.uk/software/figtree/. [Google Scholar]
  73. Rambaut A, Drummond AJ, Xie D, Baele G, Suchard MA. 2018. Posterior summarization in Bayesian phylogenetics using Tracer 1.7. Systematic Biology, 67(5), 901–904. [CrossRef] [PubMed] [Google Scholar]
  74. Rokicka M, Lumme J, Ziętara MS. 2007. Identification of Gyrodactylus ectoparasites in Polish salmonid farms by PCR-RFLP of the nuclear ITS segment of ribosomal DNA (Monogenea, Gyrodactylidae). Acta Parasitologica, 52(3), 185–195. [CrossRef] [Google Scholar]
  75. Ronquist F, Teslenko M, van der Mark P, Ayres DL, Darling A, Höhna S, Larget B, Liu L, Suchard MA, Huelsenbeck JP. 2012. MrBayes 3.2: Efficient Bayesian phylogenetic inference and model choice across a large model space. Systematic Biology, 61(3), 539–542. [CrossRef] [PubMed] [Google Scholar]
  76. Shinn AP, Hansen H, Olstad K, Bachmann L, Bakke TA. 2004. The use of morphometric characters to discriminate specimens of laboratory-reared and wild populations of Gyrodactylus salaris and G. thymalli (Monogenea). Folia Parasitologica, 51, 239–252. [CrossRef] [PubMed] [Google Scholar]
  77. Shinn AP, Harris PD, Cable J, Bakke TA, Paladini G, Bron JE. 2010. GyroDb. World Wide Web electronic publication. www.gyrodb.net, version (06/2022). [Google Scholar]
  78. Šimková A, Morand S, Jobet E, Gelnar M, Verneau O. 2004. Molecular phylogeny of congeneric monogenean parasites (Dactylogyrus): a case of intrahost speciation. Evolution, 58, 1001–1018. [PubMed] [Google Scholar]
  79. Šimková A, Verneau O, Gelnar M, Morand S. 2006. Specificity and specialization of congeneric monogeneans parasitizing cyprinid fish. Evolution, 60, 1023–1037. [Google Scholar]
  80. Šimková A, Navrátilová P, Dávidová M, Ondračková M, Sinama M, Chappaz R, Gilles A, Costedoat C. 2012. Does invasive Chondrostoma nasus shift the parasite community structure of endemic Parachondrostoma toxostoma in sympatric zones? Parasites & Vectors, 5, 200. [CrossRef] [PubMed] [Google Scholar]
  81. Šimková A, Benovics M, Rahmouni I, Vukić J. 2017. Host-specific Dactylogyrus parasites revealing new insights on the historical biogeography of Northwest African and Iberian cyprinid fish. Parasites & Vectors, 10, 589. [CrossRef] [PubMed] [Google Scholar]
  82. Simon A, Gozlan RE, Robert Britton J, van Oosterhout C, Hänfling B. 2015. Human induced stepping-stone colonisation of an admixed founder population: the spread of topmouth gudgeon (Pseudorasbora parva) in Europe. Aquatic Sciences, 77, 17–25. [CrossRef] [Google Scholar]
  83. Sinnappah ND, Lim SL-H, Rohde K, Tinsley R, Combes C, Verneau O. 2001. A paedomorphic parasite associated with a neotenic amphibian host: phylogenetic evidence suggests a revised systematic position for Sphyranuridae within anuran and turtle polystomatoineans. Molecular Phylogenetics and Evolution, 18(2), 189–201. [CrossRef] [PubMed] [Google Scholar]
  84. Škoríková B, Scholz T, Moravec F. 1996. Spreading of introduced monogeneans Pseudodactylogyrus anguillae and P. bini among eel populations in the Czech Republic. Folia Parasitologica, 43, 155–156. [PubMed] [Google Scholar]
  85. StatSoft. 2022. STATISTICA (Data Analysis Software System), Version 14.1. [Google Scholar]
  86. Taraschewski H. 2006. Hosts and parasites as aliens. Journal of Helminthology, 80, 99–128. [CrossRef] [PubMed] [Google Scholar]
  87. Torchin ME, Lafferty KD, Dobson AP, McKenzie VJ, Kuris AM. 2003. Introduced species and their missing parasites. Nature, 421, 628–629. [CrossRef] [PubMed] [Google Scholar]
  88. Trifinopoulos J, Nguyen L-T, von Haeseler A, Minh BQ. 2016. W-IQ-TREE: a fast, online phylogenetic tool for maximum likelihood analysis. Nucleic Acids Research, 44(W1), W232–W235. [CrossRef] [PubMed] [Google Scholar]
  89. Tu X, Ling F, Huang A, Wang G. 2015. An infection of Gyrodactylus kobayashii Hukuda, 1940 (monogenea) associated with the mortality of goldfish (Carassius auratus) from central China. Parasitology Research, 114, 737–745. [CrossRef] [PubMed] [Google Scholar]
  90. Vancheva N, Bobeva A, Pehlivanov L, Stefanov T, Georgiev BB. 2020. Alien parasites on an alien fish species: monogeneans from the black bullhead Ameiurus melas (Siluriformes) in the Lake Srebarna Biosphere Reserve, Bulgaria, with the fist record of Gyrodactylus nebulosus in the Palaearctic. Parasitology Research, 119, 2105–2112. [CrossRef] [PubMed] [Google Scholar]
  91. Whittington ID, Cribb BW, Hamwood TE, Halliday J. 2000. Host-specificity of monogenean (platyhelminth) parasites: a role for anterior adhesive areas? International Journal for Parasitology, 30, 305–320. [CrossRef] [PubMed] [Google Scholar]
  92. Winger AC, Hansen H, Bachmann L, Bakke TA. 2008. Gyrodactylus species (Monogenea) infecting alpine bullhead (Cottus poecilopus Heckel, 1837) in Norway and Slovakia, including the description of Gyrodactylus mariannae sp. nov. Acta Parasitology, 53(3), 240–250. [Google Scholar]
  93. You P, Easy R, Cone DK. 2008. Gyrodactylus parvae n. sp. (Monogenea) from the fins and body surface of Pseudorasbora parva (Cyprinidae) in central China. Comparative Parasitology, 75, 28–32. [CrossRef] [Google Scholar]
  94. Yuryshynets V, Zaichenko N. 2015. Comparative analysis of the parasite fauna of Pseudorasbora parva (Cyprinidae) in the native and non-native areas of its distribution. Hydrobiological Journal, 51, 101–109. [CrossRef] [Google Scholar]
  95. Ziętara MS, Lumme J. 2002. Speciation by host switch and adaptive radiation in a fish parasite genus Gyrodactylus (Monogenea, Gyrodactylidae). Evolution, 56, 2445–2458. [Google Scholar]
  96. Ziętara M, Lumme J. 2004. Comparison of molecular phylogeny and morphological systematics in fish parasite genus Gyrodactylus Nordmann, 1832 (Monogenea, Gyrodactylidae). Zoologica Poloniae, 49(1–4), 5–28. [Google Scholar]
  97. Zietara MS, Huyse T, Lumme J, Volckaert FA. 2002. Deep divergence among subgenera of Gyrodactylus inferred from rDNA ITS region. Parasitology, 124(1), 39–52. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Ondračková M, Seifertová M, Tkachenko MY, Vetešník L, Liu H, Demchenko V & Kvach Y. 2023. The parasites of a successful invader: monogeneans of the Asian topmouth gudgeon Pseudorasbora parva, with description of a new species of Gyrodactylus. Parasite 30, 22.

All Tables

Table 1

List of topmouth gudgeon Pseudorasbora parva sampling sites for monogenean assesment (2010 = native range, 2020–2022 = non-native range), showing coordinates, number of fish collected (n), fish host standard length range (SL, mm), and monogenean prevalence (%), intensity range (min-max) and mean abundance.

In the text
Table 2

List of gyrodactylid taxa, host species, collection localities and GenBank accession numbers for ITS sequences used in the phylogenetical analysis. Newly generated sequences from the present study are highlighted in bold.

In the text
Table 3

List of dactylogyrid taxa, host species, collection localities and GenBank accession numbers for the 28S rDNA sequences used in the phylogenetical analysis. Newly generated sequences from the present study are highlighted in bold.

In the text
Table 4

Morphometric parameters (mean, range; μm) of Gyrodactylus prostae collected from topmouth gudgeon Pseudorasbora parva in the Melanbon borrow pit, Czech Republic, compared with published data.

In the text
Table 5

Comparison of morphometric parameters (mean, range; μm) for Gyrodactylus pseudorasborae n. sp. collected in various localities in Europe and China with other closely related monogenean species.

In the text

All Figures

thumbnail Figure 1

Response ratios depicting the mean length of selected parameters for monogenean hard parts (length of anchor, ventral bar, sickle and shaft for gyrodactylids; length of anchor, ventral and dorsal bars and accessory piece of copulatory organ for dactylogyrids). The x-axis is the log of the ratio of measurements in introduced vs. native ranges. Positive numbers indicate enhanced performance in the introduced range.
In the text
thumbnail Figure 2

Plot of a principal component analysis based on 19 metric characters for the haptoral hard parts. The plot shows the position of Gyrodactylus pseudorasborae n. sp. obtained from Pseudorasbora parva in its native Asian (China; full circles) and non-native European (Czech Republic, Ukraine; empty circles) ranges, along with related G. gobii (empty triangles) obtained from Romanogobio vladykovi, and G. gobiensis (empty squares) obtained from Gobio gobio in the Czech Republic, in morphological space. Ellipses covering 95% range.
In the text
thumbnail Figure 3

Line drawings of Gyrodactylus pseudorasborae n. sp. ex Pseudorasbora parva. A = Holotype (China), B = Paratype (Ukraine), C = Paratype (Czech Republic). a = opisthaptoral central hook complex; b = marginal hook; c = male copulatory organ. Scale bar = 10 μm.
In the text
thumbnail Figure 4

A–C: Line drawings of the marginal hook sickle of Gyrodactylus pseudorasborae n. sp. ex Pseudorasbora parva from China (A), Ukraine (B) and the Czech Republic (C); D: G. parvae ex Pseudorasbora parva, China, redrawn from You et al. (2008); E: G. gobioninum, redrawn from Galli et al. 2010, and F: G. gobii ex Romanogobio vladykovi, from the Czech Republic.
In the text
thumbnail Figure 5

The phylogenetic relationships of Gyrodactylus pseudorasborae n. sp. and G. parvae parasitising Pseudorasbora parva within related Eurasian Gyrodactylus species. The phylogenetic tree is inferred from a Maximum Likelihood (ML) analysis of the 834 bp alignment of ITS1-5.8S rDNA-ITS2 sequences. Numbers along branches represent Bayesian posterior probability/ML bootstrap support (only values > 0.70 for BI and > 50% for ML shown). Newly obtained sequences from the present study are in bold. Sequences of Gyrodactylus species parasitising Pseudorasbora parva are highlighted in grey. The branch length scale bar indicates the number of substitutions per site.
In the text
thumbnail Figure 6

Photomicrograph of Bivaginogyrus obscurus ex Pseudorasbora parva (A) in its native Asian range (Niushan Lake, China), with the detail showing the two vaginae (B, white arrows).
In the text
thumbnail Figure 7

The phylogenetic relationships of Bivaginogyrus obscurus parasitising Pseudorasbora parva within Dactylogyridae. The phylogenetic tree is inferred from a Maximum Likelihood (ML) analysis of the 763 bp alignment of partial 28S rDNA sequences. Numbers along the branches represent Bayesian posterior probability/ML bootstrap support (only values > 0.70 for BI and > 50% for ML shown). Newly obtained sequences from the present study are in bold. Sequences of Dactylogyrus species parasitising P. parva are highlighted in grey. The branch length scale bar indicates the number of substitutions per site.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.