Open Access
Issue
Parasite
Volume 30, 2023
Article Number 12
Number of page(s) 6
DOI https://doi.org/10.1051/parasite/2023013
Published online 07 April 2023

© J. Martinet et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Mermithids nematodes are obligate endoparasites of Arthropoda, especially insects. They are considered host specific, usually at the host-species or at the family-species level [17]. Species parasitising mosquitoes have probably been the most studied, as they can be used as biological agents to control their host populations [1, 6, 15, 16]. The presence of mosquito mermithids in France is poorly known, except for the description of a new species isolated from Aedes detritus in Southern France [7]. During a research program related to mosquito arboviruses, mosquitoes were sampled in Northern France. We report here the presence of mermithids in three different mosquito species analyzed by partial 18S ribosomal DNA sequencing.

Materials and methods

Mosquito sampling

During a three-year epidemiological program focusing on mosquito arboviruses, mosquito larvae were episodically collected to create a qualitative inventory and assess the feasibility of establishing laboratory colonies of local mosquitoes for vector competence experiments. To this end, mosquito larvae were sampled in 2019 in two selected localities in north-eastern France: Berru on April 1st (49.267533 N, 4.133583 E) and in the vicinity of the Der-Chantecoq Lake on April 16th (48.576553 N, 4.692353 E).

Water puddles located in sylvatic environments were sampled by hand using a deeper. Collected larvae were placed in jars containing water from the local environment, then immediately transported to the insectary and placed in two labelled cages before emergence of adults. Larvae were fed yeast pellets and maintained at 22 °C. Adults were maintained at 22 °C, 60% relative humidity and given free access to a 10% sucrose solution. Each population was monitored daily in the laboratory. Mermithid infestation was characterized by the emergence of parasites escaping from adult mosquitoes.

Mosquito processing

Emerged mosquitoes were anesthetized by cold, and morphologically identified at the species level using the MosKeyTool taxonomic key [9].

Legs were used for molecular identification. DNA was extracted with a DNeasy Blood and Tissue extraction kit (Qiagen, Hilden, Germany), following the manufacturer’s instructions. Polymerase chain reaction was performed on a 648 bp fragment of the COI gene using primers LEPF1 (5′–TTTCTACAAATCATAAAGATATTGG–3′) and LEPR1 (5′–TAAACTTCTGGATGTCCAAAAAATCA–3′), according to experimental conditions found in the literature [10, 13, 18].

Mermithid processing

The anterior and posterior parts of each worm were cut off and cleared in Amman lactophenol between the slide and cover slide. These specimens are available upon request to the authors. Pictures were taken using Stream Essentials© software version 1.7 and a DP-26 video camera connected to a SZX10 stereomicroscope (Olympus, Tokyo, Japan).

Genomic DNA was extracted from the middle part of the worm. Molecular identification of mermithids was performed by amplification and sequencing of partial 18S rDNA thanks to cycles and primers Merm forward 5′–CAAGGACGAAAGTTAGAGGTTC–3′ and Merm reverse 5′–GGAAACCTTGTTACGACTTTTA–3′ as proposed by Kobylinski et al. [12].

To amplify COI mtDNA, several couples of primers were used as described in the literature [19], including JB3 (5′–TTTTTTGGGCATCCTGAGGTTTAT–3′) and JB4.5 (5′–TAAAGAAAGAACATAATGAAAATG–3′) [11]. Due to the lack of amplification, we designed three pairs of consensus primers by alignment of sequences from other mermithids obtained from GenBank. The in-house designed forward primers were 5′–ARAACAAAATGAAAGTG–3′; 5′–AGTTAATAACATAGTAATAGC–3′; 5′–ACKACAAARTAKGTRTCATG–3′. The in-house designed reverse primers were 5′–ATTYTWCCTGYBTTTGG–3′; 5′–CCTGARGTWTAYRTWYTAATT–3′; 5′–ATAATTTTTTTTATRGTTATACC–3′. All these primers were combined and tested at hybridization temperatures ranging from 40 °C to 55 °C.

Molecular analysis

Amplicons were sequenced through Sanger technology (Genewiz, Leipzig, Germany). First, mosquito and mermithid sequences (Table 1) were compared to existing GenBank sequences with the BLAST algorithm [2] and mosquito identification was considered accurate when similarity was higher than 99%. Second, mermithid sequences were edited and aligned using Muscle software [8]. The GTR+G model of molecular evolution was determined with ModelTest-NG [5] and the phylogenetic tree was constructed using the maximum likelihood (ML) method in MEGA11 [20].

Table 1

Mosquitoes, their mermithids and sequences.

Results

Mosquitoes

Mosquito larvae collected in Berru included 45 females (12 Aedes cantans, 1 Ae. communis and 32 Ae. rusticus). Samples collected in the Der-Chantecoq lake included 55 Ae. rusticus females. As the first evidence of parasitism was observed on female mosquitoes at a time when males were already discarded from the cages, we do not possess data concerning Mermithid infestation in male mosquitoes.

Five female mosquitoes from Berru were infested by mermithids: four Ae. cantans and one Ae. communis.

Four female mosquitoes from the Der-Chantecoq lake were infested by mermithids (Fig. 1).

thumbnail Figure 1

Aedes rusticus parasitized by a mermithid (A) and microphotographs of mermithid specimens isolated from Ae. rusticus. B, E: head; C, F: tail showing details, exhibiting a spur; D: vagina.

The identification of the infested mosquitoes was based upon morphological characters and by sequencing showing more than 99.6% of similarity with the reference sequences (MK403102, MK403531 and MK403516 for Ae. cantans; MT149922 for Ae. communis; MK403533 for Ae. rusticus).

Sequences of mosquitoes collected in the present study are available in GenBank under accession numbers OQ244837OQ244845.

Mermithids

Observation of the parasite juvenile stages revealed a posterior part with a straight spur (Fig. 1).

Sequences of 776 bp were obtained on the processed specimens. We analyzed an alignment of 750 bp of partial 18S rDNA sequences in order to compare our sequences with homologous ones available in GenBank. The sequences obtained from the mermithids isolated from the nine infected females were all identical (100% homology: no variability observed in the specimens processed in the present study). They are available in GenBank under accession numbers OQ249533OQ249544.

The BLAST analysis showed that the closest sequence is that of a Mermithidae sp. isolated in some Anopheles gambiae from Senegal (99.21% homology with sequence KC243312 obtained by comparison of 756 bp of JOSN1 showing 6 variable and 750 conserved positions out of a total of 756 compared nucleotides) followed by several sequences of Strelkovimermis spiculatus (95.67% homology, meaning 729 conserved and 33 variable positions out of a total of 762). The ML tree obtained is shown in Figure 2.

thumbnail Figure 2

Maximum-likelihood tree based on partial 18S rDNA sequences available in GenBank, including the sequence of mermithids processed in the present study (in red). Bootstrap values are indicated on specific branches.

We were, however, unable to amplify the COI domain of the mermithids with both published and in-house designed primers.

Discussion

Reliable morphological identification of mermithids must be performed on adults which constitute a free stage of these parasites. Unfortunately, we were not able to observe such stages and thus could not reliably identify the parasites collected. According to Nickle, they could belong to several genera (Reesimermis, Perutilimermis) [14].

According to 18S rDNA sequences, the specimens most closely related to ours were those isolated from Senegalese malaria vector mosquitoes Anopheles gambiae [12], which remained unidentified according to i) the difficulty in identifying parasites stages using morphological characters, and ii) the lack of a match with other sequences available in GenBank.

The specimens we collected and processed exhibited 6 mutations (99.21% homology) when compared to these Senegalese mermithids (GenBank accession number KJ636371). Considering that 18S rDNA is a highly conserved molecular marker, we cannot conclude regarding the exact identification of our samples at a species nor genus level. Studies carried out on triatomine bugs [4] as well as one study carried out on the digenean Fasciola hepatica [3], estimated that the conventional molecular clock rate is 1.8 × 10−10 substitutions per site per year (1.8% per 100 my) for the evolution of the 18S gene. If this calibration is accurate, the divergence time between Senegalese and French mosquito specimens would be close to 100 million years. Unfortunately, we were not able to amplify mermithid COI mtDNA, despite several repeats and the use of published and in-house designed primers. Nonetheless, based on the 100% homology of sequences between our samples, we can only conclude that they should belong either to the same species or to a very closely related one. The absence of Empidomermis, Culicimermis, Hydromermis, or Perutilimermis 18 S rDNA sequence entries in GenBank does not allow reliable identification down to the species level.

To date, Strelkovimermis samples (closest species identified in GenBank with 95.67% homology with our samples) have never been collected in France. To our knowledge, the only available report of a mermithid nematode in French mosquitoes is related to the original description of Empidomermis riouxi Doucet, Laumond & Bain, 1979 from Aedes detritus in Southern France [7]. We cannot exclude, based on our results, that the specimens processed in the present study could belong to this species.

The paucity of available data prohibits positive identification of the parasites we processed as previously encountered in the mermithid parasitism of bees or black flies [19, 21]. Considering the importance of these nematodes in the biocontrol of mosquitoes, our work will, however, provide some information for future investigations on mermithids. Repeated and large-scale use of current vector control strategies based on long lasting insecticide net distribution and indoor residual spraying of insecticides has led to an increased prevalence of mosquito resistance. Similarly, excessive insecticide use in agriculture has led to environmental pollution with an ecological impact on fauna and flora. New and innovative control strategies, such as the use of mermithids as biological agents to fight vector-borne diseases, remain to be explored.

Conflict of interests

The authors declare no conflict of interest.

Acknowledgments

We warmly thank Hubert Ferté who actively contributed to this work through his field and laboratory work, including the production of numerous photographic images. We also thank Matthieu L. Kaltenbach for proofreading this manuscript.

References

  1. Abagli AZ, Alavo TBC, Perez-Pacheco R, Platzer EG. 2019. Efficacy of the mermithid nematode, Romanomermis iyengari, for the biocontrol of Anopheles gambiae, the major malaria vector in sub-Saharan Africa. Parasites & Vectors, 12, 253. [Google Scholar]
  2. Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ. 1990. Basic local alignment search tool. Journal of Molecular Biology, 215, 403–410. [PubMed] [Google Scholar]
  3. Bargues MD, Halajian A, Artigas P, Luus-Powell WJ, Valero MA, Mas-Coma S. 2022. Paleobiogeographical origins of Fasciola hepatica and F. gigantica in light of new DNA sequence characteristics of F. nyanzae from hippopotamus. Frontiers in Veterinary. Science, 9, 990872. [Google Scholar]
  4. Bargues M, Marcilla A, Ramsey J, Dujardin J, Schofield C, Mas-Coma S. 2000. Nuclear rDNA-based molecular clock of the evolution of Triatominae (Hemiptera: Reduviidae), vectors of Chagas disease. Memórias do Instituto Oswaldo Cruz, 95, 567–573. [Google Scholar]
  5. Darriba D, Posada D, Kozlov AM, Stamatakis A, Morel B, Flouri T. 2020. ModelTest-NG: A new and scalable tool for the selection of DNA and protein evolutionary models. Molecular Biology and Evolution, 37, 291–294. [Google Scholar]
  6. Di Battista CM, Fischer S, Campos RE. 2020. Susceptibility of the floodwater mosquito Aedes albifasciatus from eggs of different dormancy times to the nematode parasite Strelkovimermis spiculatus. Medical and Veterinary Entomology, 34, 432–439. [Google Scholar]
  7. Doucet M-M, Laumond C, Bain O. 1979. Empidomermis riouxi n. sp. (Nematoda, Mermithidae parasite d’ Aedes (Ochlerotatus) detritus (Haliday, 1833). Annales de Parasitologie Humaine et Comparée, 54, 341–351. [CrossRef] [EDP Sciences] [Google Scholar]
  8. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792–1797. [CrossRef] [PubMed] [Google Scholar]
  9. Gunay F, Robert V. 2017. MosKeyTool, an interactive identification key for mosquitoes of Euro-Mediterranean Region. Version 2.2. Available at http://medilabsecure.com/moskeytoolhttp://medilabsecure.com/moskeytool. [Google Scholar]
  10. Hebert PDN, Penton EH, Burns JM, Janzen DH, Hallwachs W. 2004. Ten species in one: DNA barcoding reveals cryptic species in the neotropical skipper butterfly Astraptes fulgerator. Proceedings of the National Academy of Sciences of the United States of America, 101, 14812–14817. [Google Scholar]
  11. Hu M, Gasser RB, Chilton NB, Beveridge I. 2005. Genetic variation in the mitochondrial cytochrome c oxidase subunit 1 within three species of Progamotaenia (Cestoda: Anoplocephalidae) from macropodid marsupials. Parasitology, 130, 117–129. [Google Scholar]
  12. Kobylinski KC, Sylla M, Black W, Foy BD. 2012. Mermithid nematodes found in adult Anopheles from southeastern Senegal. Parasites & Vectors, 5, 131. [Google Scholar]
  13. Lessard BD, Kurucz N, Rodriguez J, Carter J, Hardy CM. 2021. Detection of the Japanese encephalitis vector mosquito Culex tritaeniorhynchus in Australia using molecular diagnostics and morphology. Parasites & Vectors, 14, 411. [Google Scholar]
  14. Nickle WR. 1972. A contribution to our knowledge of the Mermithidae (Nematoda). Journal of Nematology, 4, 113–146. [Google Scholar]
  15. Paily KP, Chandhiran K, Vanamail P, Kumar NP, Jambulingam P. 2013. Efficacy of a mermithid nematode Romanomermis iyengari (Welch) (Nematoda: Mermithidae) in controlling tree hole-breeding mosquito Aedes albopictus (Skuse) (Diptera: Culicidae) in a rubber plantation area of Kerala, India. Parasitology Research, 112, 1299–1304. [Google Scholar]
  16. Platzer EG. 1981. Biological control of mosquitoes with mermithids. Journal of Nematology, 13, 257–262. [Google Scholar]
  17. Poinar GO. 2018. Nematodes for Biological Control of Insects, 1st edn. Boca Raton, FL: CRC Press. [Google Scholar]
  18. Reeves LE, Medina J, Miqueli E, Sloyer KE, Petrie W, Vasquez C, Burkett-Cadena ND. 2021. Establishment of Aedes (Ochlerotatus) scapularis (Diptera: Culicidae) in mainland Florida, with notes on the ochlerotatus group in the United States. Journal of Medical Entomology, 58, 717–729. [Google Scholar]
  19. St-Onge M, LaRue B, Charpentier G. 2008. A molecular revision of the taxonomic status of mermithid parasites of black flies from Quebec (Canada). Journal of Invertebrate Pathology, 98, 299–306. [Google Scholar]
  20. Tamura K, Stecher G, Kumar S. 2021. MEGA11: Molecular Evolutionary Genetics Analysis version 11. Molecular Biology and Evolution, 38, 3022–3027. [Google Scholar]
  21. Tripodi AD, Strange JP. 2018. Rarely reported, widely distributed, and unexpectedly diverse: molecular characterization of mermithid nematodes (Nematoda: Mermithidae) infecting bumble bees (Hymenoptera: Apidae: Bombus) in the USA. Parasitology, 145, 1558–1563. [Google Scholar]

Cite this article as: Martinet J-P, Aatif I & Depaquit J. 2023. Three Aedes species infested by mermithids in France. Parasite 30, 12.

All Tables

Table 1

Mosquitoes, their mermithids and sequences.

All Figures

thumbnail Figure 1

Aedes rusticus parasitized by a mermithid (A) and microphotographs of mermithid specimens isolated from Ae. rusticus. B, E: head; C, F: tail showing details, exhibiting a spur; D: vagina.

In the text
thumbnail Figure 2

Maximum-likelihood tree based on partial 18S rDNA sequences available in GenBank, including the sequence of mermithids processed in the present study (in red). Bootstrap values are indicated on specific branches.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.