Open Access
Table 1
Primers and PCR conditions to amplify pcydhps.
| Primer name | Binding location in Chromosome 14 | Sequence (5’→3’) | PCR conditions | Product (bp) |
|---|---|---|---|---|
| PcyDHPS_N1F: | 13303-1…1330273 (–) | GGCTATACGTATTGAAAGATAAAGTATCA | 94°C for 30 s; 50°C for 30 s; | 838 |
| PcyDHPS_R: | 1329480…1329464 (–) | TCGAAGCCCCCATTGGT | 72°C for 1 min for 35 cycles. | |
| PcyDHPS_N2F: | 1330185…1330164 (–) | AAGCTGTGGAAAGGATGTTCG | 94°C for 30 s; 57°C for 30 s; | 721 |
| 72°C for 1 min for 30 cycles. |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.