Open Access
Research Article

Table 1

Primer sequences for RAA-Cas13a-LFD assay.

Primers Sequences (5′ to 3′) Amplicon sizes (bp) Description
TOX-F1 ACTACAGACGCGATGCCGCTCCTCC 283 Candidates for RAA primers screened in this study. TOX-F1/TOX-R1 pair was used for follow-up experimental tests.
TOX-R1 TGTCTCCCTCGCCCTCTTCTCCACT
TOX-F2 ACACCGGAATGCGATCCAGACGAGA 126
TOX-R2 GTCCAAGCCTCCGACTCTGTCTCCC
TOX-F3 ATATCAGGACTGTAGATGAAGGCGAGGGT 176
TOX-R3 CGTCTCGTCTGGATCGCATTCCGGTGTCT
TOX-F4 TAGATGAAGGCGAGGGTGAGGATGAGGGG 121
TOX-R4 CTCCAGGAAAAGCAGCCAAGCCGGAAACA
TOX-F5 AAGATGTTTCCGGCTTGGCTGCTTTTCCTG 162
TOX-R5 CCGACTCTGTCTCCCTCGCCCTCTTCTCCA
T7 promoter GAAATTAATACGACTCACTATAGGG Promoting the transcription of amplified DNA to RNA.
Probe 1 CGUCUCGUCUGGAUCGCAUUCCGGUGUC Expected sequences of guide RNA obtained from in vitro transcription. Probel was used for follow-up experimental tests.
Probe 2–5-a UUCUCUCCGCCAUCACCACGAGGAAAGC
Probe 2–5-b CAAUUCUCUCCGCCAUCACCACGAGGAA
Probe 3–4-a CUCCGACUCUCGUCGCUUCCCAACCACG
Probe 3–4-b CCGACUCUCGUCGCUUCCCAACCACGCC
Lateral flow reporter FAM/mArArUrGrGrCmAmArArUrGrGrCmA/Bio Trans-cleavage reporter for Cas13a.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.