Limitations of PCR detection of filarial DNA in human stools from subjects non-infected with soil-transmitted helminths

Open Access

Table 1

Primers list, PCR conditions, and references.

Host target	Gene	Primer			Thermal profile^a							Ref.
		Designation	Sequence (5′ – 3′)	Product	Step 1		Step 2	Step 3			N
		Designation	Sequence (5′ – 3′)	Size (bp)	T	D	T	D	T	D	N
Homo sapiens	HVRI	L15997	CACCATTAGCACCCAAAGCT	~400	94	30	50	30	72	30	40	[17]
Homo sapiens	HVRI	H16498	CCTGAAGTAGGAACCAGATG	~400	94	30	50	30	72	30	40	[17]
L. loa/M. perstans	12S rDNA	12SdegF2/	ATTACYTATTYTTAGTTTA	~600	94	30	45	30	72	45	40	[2]
		12SnemR2	CTACCATACTACAACTTACGC	~600	94	30	45	30	72	45	40
		12SF/	GTTCCAGAATAATCGGCTA	~450	94	30	54	30	72	30	35
		12SdegR	ATTGACGGATGRTTTGTACC	~450	94	30	54	30	72	30	35
L. loa/M. perstans	coxI	FCo1extdF1	TATAATTCTGTTYTDACTA	~970	94	30	44	30	72	60	40	[2]
		FCo1extdR1	ATGAAAATGAGCYACWACATAA	~970	94	30	44	30	72	60	40
		COIintF/	TGA TTG GTG GTT TTG GTA A	~650	94	30	45	30	72	45	35
		COIintR	ATA AGT ACG AGT ATC AAT ATC	~650	94	30	45	30	72	45	35
Oesophagostomum/Necator sp.	ITS2	NC1	ACGTCTGGTTCAGGGTTGTT	NA	94	30	50	30	72	45	45	[7]
		NC2	TTAGTTTCTTTTCCTCCGCT	NA	94	30	50	30	72	45	45
		OesophITS2	TGTRACACTGTTTGTC-GAAC	250-300	94	30	55	30	72	30	35
		NC2	TTAGTTTCTTT-TCCTCCGCT	250-300	94	30	55	30	72	30	35
Thrichuris trichiura	ITS2	ExtITS2	GGATCACTTGGCTGGTAG	NA	94	30	56	30	72	45	45	[8]
		NC2	TTAGTTTCTTTTCCTCCGCT	NA	94	30	56	30	72	45	45
		IntITS2	CTTGAATACTTTGAACGCACATTG	~700	94	30	49	30	72	45	35
		NC2	TTAGTTTCTTTTCCTCCGCT	~700	94	30	49	30	72	45	35
Acaris lumbricoides	ITS1	ITS F1	CGAGCAGAAAAAAAAAAGTCTCC	NA	94	30	50	45	72	45	45	[3]
		ITS R1	GGAATGAACCCGATGGCGCAAT	NA	94	30	50	45	72	45	45
		ITS F2	CGAGCAGAAAAAAAAAAAAGTCTCC	~500	94	30	52	30	72	30	35
		ITS R2	GCTGCGTTCTTCATCGAT	~500	94	30	52	30	72	30	35
Mansonella perstans	ITS1	Mp-SEN-F	AGGATCATTAACGAGCTTCC	~187	94	30	50	30	72	30	35^b	[1]
Mansonella perstans	ITS1	Mp-SEN-R	CGAATATCACCGTTAATTCAGT	~187	94	30	50	30	72	30	35^b	[1]
Loa loa	LL20 15KDa	15r3-LL-F	CGAAAAATTATAGGGGGAAAC	~148	94	30	50	30	72	30	35^b	[15]
Loa loa	LL20 15KDa	15r3-LL-R	TCGTAGACCAAACTGCGAAC	~148	94	30	50	30	72	30	35^b	[15]

All PCRs start at 95 °C – 15 min and finish at 72 °C – 10 min.

35× for DBS and 45× for stool samples.

NA: not available. In all cases, the PCR reaction was performed in 50 μL reaction volume containing 10 μL and 5 μL of template DNA for primary and nested PCR respectively, 10 pM of each primer, 25 μL HotStarTaq Master Mix (Qiagen, Courtaboeuf, France), providing a final concentration of 1.5 mM MgCl₂ and 200 μM each dNTP, 1 μg of Bovine Serum Albumin (SIGMA, USA).

Abbreviations: Step 1, denaturation; Step 2, annealing; Step 3, elongation; T, temperature (°C); D, duration (s); N, number of cycles.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.