Open Access
Research Article

Table 1

Primers list, PCR conditions, and references.

Host target Gene Primer
Thermal profilea
Ref.
Designation Sequence (5′ – 3′) Product
Step 1
Step 2
Step 3
N
Size (bp) T D T D T D
Homo sapiens HVRI L15997 CACCATTAGCACCCAAAGCT ~400 94 30 50 30 72 30 40 [17]
H16498 CCTGAAGTAGGAACCAGATG
L. loa/M. perstans 12S rDNA 12SdegF2/ ATTACYTATTYTTAGTTTA ~600 94 30 45 30 72 45 40 [2]
12SnemR2 CTACCATACTACAACTTACGC
12SF/ GTTCCAGAATAATCGGCTA ~450 94 30 54 30 72 30 35
12SdegR ATTGACGGATGRTTTGTACC
L. loa/M. perstans coxI FCo1extdF1 TATAATTCTGTTYTDACTA ~970 94 30 44 30 72 60 40 [2]
FCo1extdR1 ATGAAAATGAGCYACWACATAA
COIintF/ TGA TTG GTG GTT TTG GTA A ~650 94 30 45 30 72 45 35
COIintR ATA AGT ACG AGT ATC AAT ATC
Oesophagostomum/Necator sp. ITS2 NC1 ACGTCTGGTTCAGGGTTGTT NA 94 30 50 30 72 45 45 [7]
NC2 TTAGTTTCTTTTCCTCCGCT
OesophITS2 TGTRACACTGTTTGTC-GAAC 250-300 94 30 55 30 72 30 35
NC2 TTAGTTTCTTT-TCCTCCGCT
Thrichuris trichiura ITS2 ExtITS2 GGATCACTTGGCTGGTAG NA 94 30 56 30 72 45 45 [8]
NC2 TTAGTTTCTTTTCCTCCGCT
IntITS2 CTTGAATACTTTGAACGCACATTG ~700 94 30 49 30 72 45 35
NC2 TTAGTTTCTTTTCCTCCGCT
Acaris lumbricoides ITS1 ITS F1 CGAGCAGAAAAAAAAAAGTCTCC NA 94 30 50 45 72 45 45 [3]
ITS R1 GGAATGAACCCGATGGCGCAAT
ITS F2 CGAGCAGAAAAAAAAAAAAGTCTCC ~500 94 30 52 30 72 30 35
ITS R2 GCTGCGTTCTTCATCGAT
Mansonella perstans ITS1 Mp-SEN-F AGGATCATTAACGAGCTTCC ~187 94 30 50 30 72 30 35b [1]
Mp-SEN-R CGAATATCACCGTTAATTCAGT
Loa loa LL20 15KDa 15r3-LL-F CGAAAAATTATAGGGGGAAAC ~148 94 30 50 30 72 30 35b [15]
15r3-LL-R TCGTAGACCAAACTGCGAAC
a

All PCRs start at 95 °C – 15 min and finish at 72 °C – 10 min.

b

35× for DBS and 45× for stool samples.

NA: not available. In all cases, the PCR reaction was performed in 50 μL reaction volume containing 10 μL and 5 μL of template DNA for primary and nested PCR respectively, 10 pM of each primer, 25 μL HotStarTaq Master Mix (Qiagen, Courtaboeuf, France), providing a final concentration of 1.5 mM MgCl2 and 200 μM each dNTP, 1 μg of Bovine Serum Albumin (SIGMA, USA).

Abbreviations: Step 1, denaturation; Step 2, annealing; Step 3, elongation; T, temperature (°C); D, duration (s); N, number of cycles.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.