| Issue |
Parasite
Volume 27, 2020
|
|
|---|---|---|
| Article Number | 70 | |
| Number of page(s) | 10 | |
| DOI | https://doi.org/10.1051/parasite/2020068 | |
| Published online | 11 December 2020 | |
Research Article
Further investigation of the characteristics and biological function of Eimeria tenella apical membrane antigen 1
Étude approfondie des caractéristiques et de la fonction biologique de l’antigène 1 de la membrane apicale d’Eimeria tenella
Key Laboratory of Animal Parasitology of the Ministry of Agriculture, Shanghai Veterinary Research Institute, CAAS, 200241 Shanghai, PR China
* Corresponding author: donghui@shvri.ac.cn
Received:
15
July
2020
Accepted:
20
November
2020
Apical membrane antigen 1 (AMA1) is a type I integral membrane protein that is highly conserved in apicomplexan parasites. Previous studies have shown that Eimeria tenella AMA1 (EtAMA1) is critical for sporozoite invasion of host cells. Here, we show that EtAMA1 is a microneme protein secreted by sporozoites, confirming previous results. Individual and combined treatment with antibodies of EtAMA1 and its interacting proteins, E. tenella rhoptry neck protein 2 (EtRON2) and Eimeria-specific protein (EtESP), elicited significant anti-invasion effects on the parasite in a concentration-dependent manner. The overexpression of EtAMA1 in DF-1 cells showed a significant increase of sporozoite invasion. Isobaric tags for relative and absolute quantitation (iTRAQ) coupled with LC-MS/MS were used to screen differentially expressed proteins (DEPs) in DF-1 cells transiently transfected with EtAMA1. In total, 3953 distinct nonredundant proteins were identified and 163 of these were found to be differentially expressed, including 91 upregulated proteins and 72 downregulated proteins. The DEPs were mainly localized within the cytoplasm and were involved in protein binding and poly(A)-RNA binding. KEEG analyses suggested that the key pathways that the DEPs belonged to included melanogenesis, spliceosomes, tight junctions, and the FoxO and MAPK signaling pathways. The data in this study not only provide a comprehensive dataset for the overall protein changes caused by EtAMA1 expression, but also shed light on EtAMA1’s potential molecular mechanisms during Eimeria infections.
Résumé
L’antigène 1 de la membrane apicale (AMA1) est une protéine membranaire intégrale de type I hautement conservée chez les parasites Apicomplexa. Des études antérieures ont montré que l’AMA1 d’Eimeria tenella (EtAMA1) était importante pour l’invasion des cellules hôtes par les sporozoïtes. Nous montrons ici qu’EtAMA1 est une protéine des micronèmes sécrétée par les sporozoïtes, confirmant les résultats précédents. Un traitement individuel et combiné avec des anticorps d’EtAMA1 et de ses protéines en interaction, la protéine 2 du cou des rhoptries d’E. tenella (EtRON2) et la protéine spécifique d’Eimeria (EtESP), a provoqué des effets anti-invasion significatifs et dépendants de la concentration sur le parasite. La surexpression d’EtAMA1 dans les cellules DF-1 a montré une augmentation significative de l’invasion par les sporozoïtes. Des marqueurs isobares pour la quantification relative et absolue (iTRAQ) couplés à LC-MS/MS ont été utilisés pour cribler des protéines exprimées différentiellement (PED) dans des cellules DF-1 transfectées de manière transitoire avec EtAMA1. Au total, 3953 protéines non redondantes distinctes ont été identifiées et 163 d’entre elles se sont révélées exprimées de manière différentielle, dont 91 régulées à la hausse et 72 régulées à la baisse. Les PED étaient principalement localisées dans le cytoplasme et étaient impliquées dans la liaison aux protéines et la liaison au poly (A)-ARN. Les analyses de KEEG ont suggéré que les voies clés auxquelles appartenaient les PED comprenaient la mélanogenèse, les épissosomes, les jonctions étroites et les voies de signalisation FoxO et MAPK. Les données de cette étude fournissent non seulement un ensemble de données complet pour les modifications globales des protéines causées par l’expression d’EtAMA1, mais mettent également en lumière les mécanismes moléculaires potentiels d’EtAMA1 pendant les infections par Eimeria.
Key words: Apicomplexa / Eimeria tenella / Apical membrane antigen / iTRAQ / DF-1 cells
© Q. Wang et al., published by EDP Sciences, 2020
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Introduction
Parasites of the phylum Apicomplexa are responsible for some of the most devastating and burdensome diseases to humans and animals worldwide, including malaria, cryptosporidiosis, toxoplasmosis, and coccidiosis [5]. Host-cell invasion is an essential step in the life cycle and pathogenesis of apicomplexan parasites. A conserved feature of host cell invasion by these protozoan pathogens is the formation of an intimate and circumferential contact area with the host cell, called the moving junction (MJ) [1]. Initially formed at the apical tip of the invading parasite, the MJ is important for successful invasion as it represents a ring-like region of contact between the surfaces of the invading parasite and the host cell as the invaginated host plasma membrane is forced inward by the penetrating parasite [38].
Previous reports on Toxoplasma and Plasmodium detailed the composition of the MJ complex, which mainly includes rhoptry neck proteins (RONs) and apical membrane antigen1 (AMA1) [2, 3, 7]. More precisely, the parasite exports the microneme protein, AMA1, to its own surface and the rhoptry neck RON2 protein is the receptor inserted into the host cell with other RON partners [28]. Of all the MJ components, AMA1 is the best characterized. Initially identified in P. knowlesi nearly 40 years ago [13], AMA1 is a type I integral membrane protein that is highly conserved in apicomplexan parasites [6]. Numerous lines of evidence have found that AMA1 mediates invasion or attachment of Toxoplasma tachyzoites [24], Plasmodium merozoites [25], Neospora tachyzoites [45], and Babesia merozoites [33] to their respective host cells.
Eimeria tenella is widely considered to be the most economically relevant and well-known of the seven Eimeria species that cause coccidiosis in chickens [10]. Eimeria tenella has a complex life cycle that includes two major asexual developmental stages, including sporozoites and the merozoites [21]. The expressed sequence tags (ESTs) of the sporozoites and the merozoites were analyzed, and some ESTs exhibited homology with AMA1 [27]. Proteomic comparisons of four E. tenella life-cycle stages found that EtAMA1 was detected only in sporozoites [20]. Jiang et al. characterized EtAMA1 and found that it was expressed at higher levels in sporozoites than in other developmental stages [18]. Specific EtAMA1 antibodies, recombinant proteins, or binding peptides can significantly inhibit sporozoite invasion of host cells [18, 23, 29].
EtAMA1 can interact with E. tenella rhoptry neck protein 2 (EtRON2), microneme protein 2 (EtMIC2), and an Eimeria-specific protein (EtESP) (GenBank accession No. XM_013373193) [41, 44]. Other putative EtAMA1-interacting proteins include E. tenella putative cystathionine beta-synthase, four conserved hypothetical proteins (one in the serine/threonine protein kinase family), and seven unknown proteins, but other putative proteins must be further identified [16]. Thus, this study further characterized the function and mechanism of EtAMA1 during Eimeria host cell invasion.
Materials and methods
Ethics statement
All animal procedures were approved by the Animal Ethics Committee of the Shanghai Veterinary Institute, Chinese Academy of Agricultural Science. Experiments were conducted in accordance with animal ethics guidelines and approved protocols.
Parasites, birds, and cells
The Shanghai strain of E. tenella was maintained and propagated by regular in vivo passage through 2-week-old Yellow chickens reared under specific pathogen-free conditions [22]. Unsporulated oocysts, sporulated oocysts, sporozoites, and second-generation merozoites were collected and purified, as described previously [34]. The chicken embryo fibroblast cell line, DF-1, was cultured in complete medium (CM) (Dulbecco’s Modified Eagle’s Medium (DMEM) (Gibco BRL, Paisley, UK) containing 10% fetal calf serum (FCS) (Gibco), and 100 U/mL penicillin/streptomycin (Gibco).
EtAMA1 secretion assays
To test the secretion of EtAMA1, E. tenella microneme 2 protein (EtMIC2) was used as the experimental control [35, 43]. A total of 4 × 106 fresh sporozoites were resuspended in 100 μL PBS or complete medium and incubated for 2 h at 4 °C or at 41 °C. Then 5 μM, 10 μM, or 20 μM of staurosporine (Sigma-Aldrich, St. Louis, MO, USA), a protein kinase inhibitor known to specifically inhibit microneme secretion [9, 19], dissolved in dimethyl sulfoxide (DMSO) or solvent control (DMSO), was added, as described previously [19]. Sporozoites were then pelleted by centrifugation for 5 min at 6000 ×g (Eppendorf Centrifuge 5810R). Supernatants containing excretory-secretory antigens (ESAs) were harvested and EtAMA1 and EtMIC2 secretion was analyzed by western blotting with anti-rEtAMA1 or anti-rEtMIC2 antibodies, respectively [18, 43].
Immunofluorescence analysis
To identify co-localization of EtAMA1 and its interaction proteins, EtRON2 and EtESP, in E. tenella, the purified sporozoites were transferred to glass slides and air-dried. Sporozoites were fixed in 2% paraformaldehyde in PBS, air-dried, and permeabilized with 1% Triton X-100 in PBS for 15 min. The slides were blocked with 2% (w/v) bovine serum albumin in PBS for 2 h at 37 °C and incubated with polyclonal anti-rEtAMA1 mouse serum, and anti-rEtESP or anti-rEtRON2 rabbit serum [43] diluted in PBS (1:100) at 37 °C for 2 h. Slides were then incubated with Alexa Fluor™ 488 chicken anti-rabbit IgG or Alexa Fluor™ 647 chicken anti-mouse IgG secondary antibodies (1:500 dilution) for 1 h at 37 °C. Nuclei were stained with 2-(4-amidinophenyl)-6-indolecarbamidine dihydrochloride (Beyotime) (10 mg/mL) for 20 min at room temperature. After each step, the slides were washed three times for 10 min each with PBS containing 0.05% Tween 20. Slides were then mounted using Fluoromount Aqueous Mounting Medium (Sigma-Aldrich) and observed under a laser scanning confocal microscope (Zeiss, Germany).
Inhibition assays
A neutralization assay with antibodies was used to assess the potential involvement of EtAMA1 and its interaction proteins, EtRON2 and EtESP, in host cell invasion by E. tenella sporozoites. The ani-rEtAMA1, ani-rEtRON2, and ani-rEtESP antibodies were purified using protein A + G agarose (Beyotime), according to the manufacturer’s instructions. DF-1 cells (2 × 105 cells per well) were cultivated in 24-well plates (Corning, NY, USA) in CM for 12 h at 37 °C and 5% CO2. Freshly purified sporozoites were marked using carboxyfluorescein diacetate succinimidyl ester (CFSE; Beyotime Biotechnology), according to the manufacturer’s instructions. The labelled sporozoites were preincubated at 37 °C for 2 h with the purified anti-rEtAMA1, rEtESP or rEtRON2 IgG, or combinations of anti-rEtAMA1 and rEtESP IgGs (with a ratio of 1:1), or anti-rEtAMA1 and rEtRON2 IgGs (with a ratio of 1:1) at concentrations of 100, 200, 400, or 600 μg/mL [26]. The same amount of IgG from naive rabbit serum (Sigma-Aldrich) and IgG-untreated sporozoites were used as controls. Sporozoites were added to DF-1 cells for 8 h at 41 °C and 5% CO2 with a sporozoite/cell ratio of 3:1. The cells were washed, trypsinized, harvested, and analyzed using a flow cytometer (model Cytomics FC500; Beckman Coulter, USA). The infected cells, non-infected cells and free sporozoites were gated using the software RXP for subsequent delineation and counting of the infected (containing the labeled sporozoites) and non-infected (fluorescence-free) cells. Three replicates were performed for all the tests, and a total of three tests were conducted. The percentage of infected cells in the presence or absence of inhibitory antibodies was calculated as previously described [17].
In vitro sporozoite invasion of transiently EtAMA1-transfected DF-1 cells
The extracellular domain I of EtAMA1 (GenBank accession No. LN610018.1) was amplified using the primers: 5′–GCGAATTCATGGGGCCACCCCCGTCTTTGGCAAAAAC–3′ and 5′–GCAGA TCTGCACTTGG TCTCCCAGTCG–3′ containing EcoRI sand BgIII restriction sites (underlined). The PCR products were ligated into the pcDNA3.1(+) vector and designated as pcDNA3.1(+)-EtAMA1. The constructed plasmid was identified by sequencing and purified using a Qiagen Plasmid Giga Kit (Qiagen). The plasmid concentration was determined by spectrophotometry at 260 nm.
A monolayer of 80–90% confluent DF-1 cells in six-well plates was transfected with pcDNA3.1(+)-EtAMA1 or pcDNA3.1(+) using Lipofectamine® (Invitrogen). Six hours later, the DNA-transfection reagent mixture was replaced by opti-MEM. At 48 h post-transfection, the expression of EtAMA1 in transfected DF-1 cells was confirmed by indirect fluorescent antibody testing (IFA) (Dong et al. [15]). The proliferation of transfected cells was determined using Cell Counting Kit-8 (Beyotime), according to the manufacturer’s protocol.
The pcDNA3.1(+)-EtAMA1 or pcDNA3.1(+) transfected DF-1 cells were invaded by fluorescently-labeled E. tenella sporozoites with CFSE at a ratio of three sporozoites per cell for 8 h at 41 °C, and then subjected to flow cytometry to determine the invasion rate. The sporozoite-infected un-treated DF-1 cells were the control group.
iTRAQ-based comparative proteomic analysis of transiently EtAMA1-transfected DF-1 cells
The pcDNA3.1(+)-EtAMA1-transfected and empty vector pcDNA3.1(+)-transfected DF-1 cells were seeded into T25 culture flasks and cultured in a 5% CO2 incubator at 37 °C for 48 h. Each group was treated with three independent biological replicates. The transfected cells were washed three times with chilled PBS, collected with cell scrapers, and homogenized in lysis buffer (4% SDS, 1 mM DTT, 150 mM Tris-HCl pH 8.0, protease inhibitor), then incubated for 3 min in boiling water and sonicated twice on ice, and clarified by centrifugation at 16,000 ×g at 25 °C for 10 min. Protein content was determined using the BCA protein assay reagent (Beyotime). Protein digestion, iTRAQ labeling, peptide fractionation using strong cation exchange (SCX) chromatography, and liquid chromatography (LC)-electrospray ionization tandem MS (MS/MS) analyses with Q Exactive were conducted as previously described [4, 40, 42].
MS/MS spectra were searched using the Mascot 2.2 engine against the UniProt Gallus gallus database (36,539 sequences, downloaded on June 9, 2018) and the decoy database. For identification, the following options were used. Peptide mass tolerance = 20 ppm, MS/MS tolerance = 0.1 Da, enzyme = trypsin, Missed cleavage = 2, fixed modification: carbamidomethyl (C), iTRAQ8plex (K), iTRAQ8plex(N-term), variable modification: oxidation (M), and FDR ≤ 0.01. To define up- and downregulated proteins, the levels for significantly differentially expressed proteins (DEPs) were set at a fold change > 1.2 and < 0.83, respectively, with a p-value < 0.05 [32, 47].
The Gene Ontology (GO) program, Blast2GO (https://www.blast2go.com/), was used to annotate DEPs to create histograms of GO annotations. For pathway analysis, the DEPs were mapped to the terms in the KEGG (Kyoto Encyclopedia of Genes and Genomes) database using the KAAS program (http://www.genome.jp/kaas-bin/kaas_main).
Statistical analysis
All data were analyzed using SPSS version 20.0 for Windows (IBM, Armonk, NY, USA) and GraphPad Prism version 6.0 (GraphPad, La Jolla, CA, USA).
The significance of differences in sporozoite invasion rates or inhibitory percentages between the groups was evaluated by one-way analysis of variance (ANOVA) and the mean values were compared using Duncan’s multiple range test. Differences were considered significant and extremely significant if p < 0.05 and < 0.01, respectively.
Results
EtAMA1 is secreted by micronemes
To determine whether EtAMA1 is a secreted protein, sporozoites were incubated in PBS and CM at 4 °C or 41 °C, respectively. Western blotting showed that EtAMA1 was secreted when sporozoites were incubated at 41 °C in CM, and EtMIC2 was secreted in PBS and CM at 4 °C or 41 °C (Fig. 1a). Therefore, EtAMA1 secretion was stimulated by FCS and is temperature-dependent.
![]() |
Figure 1 EtAMA1 is secreted by micronemes. (a) EtAMA1 secretion is FCS- and temperature-dependent. Fresh sporozoites were incubated in PBS or complete medium (CM) at 4 °C or 41 °C for 2 h. Supernatants containing excretory-secretory antigens (ESAs) were harvested and analyzed by western blotting to detect EtAMA1 and EtMIC2. (b) EtAMA1 secretion is inhibited by staurosporine. Sporozoites were incubated in CM with various concentrations of staurosporine or DMSO at 41 °C for 2 h. Supernatants containing ESAs was harvested and analyzed by western blotting to detect EtAMA1 and EtMIC2. |
To demonstrate that EtAMA1 secretion was dependent on the micronemal pathway, staurosporine was used as this protein kinase inhibitor specifically inhibits micronemal secretion [9, 19]. In sporozoites treated with staurosporine, secretion of EtAMA1 or EtMIC2 in the supernatants decreased in a concentration-dependent manner with increases in inhibitor concentrations (Fig. 1b).
Co-localization of EtAMA1, and EtESP and EtRON2 in parasites
The locations of EtAMA1 and its interacting proteins, EtESP and EtRON2, were detected in sporozoites incubated in culture medium. IFAs showed that EtAMA1, EtESP and EtRON2 were distributed to the apical end of sporozoites (Figs. 2a and 2b), indicating that the three proteins function in the same location.
![]() |
Figure 2 Colocalization of EtAMA1, EtESP, and EtRON2 in sporozoites by indirect immunofluorescence. Parasites were immunostained with anti-rEtAMA1, and anti-rEtESP or anti-rEtRON2 antibodies, visualized with FITC (green) and counter-stained with DAPI (blue). Scale bar, 10 μm. |
In vitro invasion inhibition assay
To study the ability of antibodies to block sporozoite invasion in DF-1 cells, anti-rEtAMA1, anti-rEtESP and anti-rEtRON2 IgGs with different concentrations were added to sporozoites and incubated at 37 °C for 2 h. All three antibodies demonstrated high concentration-dependent inhibitory effects on sporozoite invasion into DF-1 cells compared to non-immunized IgGs where minimal changes in invasion were observed. When the antibody concentration was 600 g/mL, the inhibition of invasion rates in the EtAMA1, EtESP, and EtRON2 antibody-treatment groups were 40.9%, 33.1%, and 41.1%, respectively, which were significantly higher than that of non-immunized IgGs (p < 0.001) (Fig. 3a). When combinations of anti-rEtAMA1 and anti-rEtESP, or anti-rEtAMA1 and anti-rEtRON2 were used, an inhibitory effect was also observed, but the level of inhibition was lower than that of the individual antibodies at the same concentration. When the antibody concentration was 600 μg/mL, the inhibition of invasion rates of the anti-rEtAMA1 and anti-rEtESP, or anti-rEtAMA1 and anti-rEtRON2-treatment groups were 21% and 21.3%, respectively, which were higher than those of non-immunized IgGs (p < 0.05) (Fig. 3b).
![]() |
Figure 3 Inhibition of sporozoite invasion in vitro by antibodies against rEtAMA1, rEtESP, and rEtRON2. (a) Invasion-inhibition activities of single antibodies. Anti-rEtAMA1, rEtESP, and rEtRON2 rabbit anti-serum against recombinant EtAMA1, EtESP and EtRON2 protein, respectively; IgG, normal rabbit serum. (b) Invasion-inhibition activities of antibody combinations. Combinations of anti-rEtAMA1 and anti-rEtESP or anti-rEtRON2 were added at a ratio of 1:1 to generate a gradient concentration of IgG. All assays were performed in triplicate. *p < 0.05, **p < 0.01 and ***p < 0.001, as determined by the Student’s t-test versus the non-immunized IgG groups at the same concentration. |
In vitro sporozoite invasion of DF-1 cells transiently transfected with EtAMA1
To evaluate the effect of EtAMA1 up-regulation on sporozoite invasion, the recombinant plasmid, pcDNA3.1-(+)-EtAMA1 was transiently transfected into the DF-1 cells and its expression was confirmed by IFA. Intense green fluorescence was detected in DF-1 cells transfected with pcDNA3.1(+)-EtAMA1 and none was detected in cells transfected with pcDNA3.1(+) (Fig. 4a); thus, demonstrating that pcDNA3.1(+)-EtAMA1 was expressed in DF-1 cells. The proliferation of cells expressing the recombinant pcDNA3.1-(+)-EtAMA1 plasmid was similar to that of the control groups (Fig. 4b). Sporozoite invasion assays showed that the sporozoite invasion rate of cells expressing the recombinant pcDNA3.1-(+)-EtAMA1 plasmid was significantly higher than that of cells expressing the pcDNA3.1-(+) plasmid (p < 0.05), and extremely significantly higher than that of the normal (un-treated) cells (p < 0.01) (Fig. 4c).
![]() |
Figure 4 In vitro sporozoite invasion of DF-1 cells transiently transfected with EtAMA1. (a) Verification of pcDNA3.1-(+)-EtAMA1 expression in DF-1 cells by IFA. (b) The proliferation of DF-1 cells transfected with pcDNA3.1-(+)-EtAMA1 or pcDNA3.1-(+). (c) Sporozoite invasion rate in DF-1 cells transfected with pcDNA3.1-(+)-EtAMA1 or pcDNA3.1-(+). *p < 0.05 and **p < 0.01, as determined by the Student’s t-test versus the untreated group. |
Profiling of differentially expressed proteins in DF-1 cells transiently transfected with EtAMA1
After processing the MS/MS spectra using Mascot software, 16,385 unique peptides were mapped to 3953 proteins from DF-1 cells. A total of 163 proteins were found to be significantly differentially expressed in DF-1 cells in response to transient transfection with EtAMA1 (Supplementary Table S1). This included 91 upregulated proteins and 72 downregulated proteins. The top five upregulated proteins were the glucagon like peptide 2 receptor, the protein transport protein Sec61 subunit beta, keratin (type II cytoskeletal cochleal), Wnt-11, and heat shock protein 25. The top five downregulated proteins were the coiled-coil domain-containing protein 186, the pleckstrin homology domain-containing family O member 1, the 40S ribosomal protein S24, the signal transducer and activator of transcription, and an uncharacterized protein. Collectively, these results indicated that EtAMA1-transfection induced a distinct proteomic profile in DF-1 cells, which caused the host cells to sharply alter their related proteins in response.
GO analyses were used to identify the function of DEPs. The 163 DEPs were categorized into several main biological processes, including cellular component organization or biogenesis (40%), the negative regulation of biological processes (13%), and single organism cellular processes (12%) (Fig. 5a). Additionally, some of the proteins were predicted to be cytoplasmic (64%) or intracellular (14%) (Fig. 5b). Moreover, proteins were assigned to protein binding (34%), binding (20%), and poly(A)-RNA binding (15%) categories (Fig. 5c). KEGG pathway analyses of the DEPs showed that they were involved in melanogenesis, the spliceosome, tight junctions, and the FoxO and MAPK signaling pathways (Fig. 6).
![]() |
Figure 5 Gene ontology analysis of 163 proteins differentially expressed in DF-1 cells transiently transfected with EtAMA1. Proteins were annotated based on biological process, cellular component, and molecular function. |
![]() |
Figure 6 KEGG pathway classification of differentially expressed proteins in DF-1 cells transiently transfected with EtAMA1. |
Discussion
The full-length cDNA of EtAMA1 was 2349 bp, with a 1608 bp open reading frame encoding a protein of 535 amino acids. Analysis of the amino acid sequences revealed that EtAMA1 is a type I integral membrane protein with a transmembrane domain, a signal peptide, an ectodomain, a cytoplasmic C terminal domain, and an AMA1 superfamily domain [18]. EtAMA1 also contained the 16 invariant Cys residues that are encoded in the ectoplasmic region of all characterized apicomplexan AMA1 proteins [11, 30] and contribute to disulfide binding. The pattern of these 16 Cys residues prompted the suggestion that the mature ectodomain folds as an N-terminal pro-sequence and three domains (DI, DII, and DIII) [30]. In the present study, secretion assays showed that EtAMA1 was secreted when sporozoites were incubated at 41 °C in the presence of FCS. Additionally, secretion was inhibited by staurosporine, a protein kinase inhibitor known to specifically inhibit microneme secretion in Toxoplasma gondii and the secretion of EtMIC3 [9, 19]. These results indicate that EtAMA1 is a microneme protein secreted by sporozoites, and its secretion is regulated by FCS and temperature. Our findings are also consistent with a prior study [29].
Comparison of RNAseq datasets from unsporulated oocysts, sporulated oocysts, sporozoites, 2nd-generation merozoites, and the gametocyte lifecycle stages of E. tenella had shown that EtAMA1 transcription was stage-specific [31, 39]. The polyclonal mouse serum raised against rEtAMA1 detected native EtAMA1 in sporulated oocysts and sporozoites, but not in merozoites, thus indicating that EtAMA1 is a sporozoite-specific protein [29]. Immunofluorescent antibody staining of sporozoites with mouse anti-rEtAMA1 showed an apical localization within sporozoites [18, 29]. Blocking EtAMA1 by antibodies, recombinant proteins, or small peptides can significantly inhibit E. tenella sporozoite invasion in host cells [18, 23, 29]. To examine whether E. tenella sporozoite invasion was also regulated by the overexpression of EtAMA1, invasion experiments were performed with EtAMA1-transfected DF-1 cells. The results showed that the sporozoite invasion of EtAMA1-transfected DF-1 cells was significantly higher than that of the control group, thus indicating that the overexpression of EtAMA1 could promote sporozoite invasion.
Previous studies showed that in T. gondii and Plasmodium, AMA1 interacts directly with rhoptry neck protein 2 (RON2), which is secreted from the parasite rhoptries and specifically localizes to the MJ. The RON2-AMA1 interaction is a critical step in MJ-dependent invasion of host cells by apicomplexan parasites [8, 37]. To understand the precise functions of EtAMA1 during host-cell invasion, Han et al. screened EtAMA1-interacting proteins in E. tenella sporozoites, and a total of 14 putative interaction proteins were obtained [16]. Some putative EtAMA1-interacting proteins were selected to confirm their interaction with EtAMA1 using BiFC and GST pull-down assays, and it was found that E. tenella rhoptry neck protein 2 (EtRON2), microneme protein 2 (EtMIC2), and Eimeria-specific protein (EtESP) interacted with EtAMA1 [41, 44]. In the present study, IFAs showed that the distribution of EtAMA1, EtESP, and EtRON2 in sporozoites was similar (at the apical end of sporozoites), further verifying their interaction. When anti-rEtAMA1, anti-rEtESP or anti-rEtRON2 IgGs were incubated with sporozoites, their invasion decreased significantly, indicating that these three proteins were involved in sporozoite invasion. However, combinations of anti-rEtAMA1 with anti-rEtESP, anti-rEtAMA1 and anti-rEtRON2 at a ratio of 1:1 exhibited less inhibition than that of the individual antibodies at the same concentration. These data suggested that the combination of different functional antibodies could not provide a more potent reduction in invasion than single antibodies. Our findings are inconsistent with the previous study [26].
EtAMA1 plays an important role in sporozoite invasion, but its molecular mechanism remains unknown. To investigate the effect of EtAMA1 on host cells, the proteomic changes of transfected DF-1 cells were investigated using iTRAQ. iTRAQ has become a powerful quantitative proteomic method with advantages over traditional proteomic techniques. Such advantages include higher throughput, increased sensitivity, and greater accuracy. iTRAQ has been used successfully to explore host-pathogen interactions for viruses [15, 40], bacteria [48], and parasites [46]. The results of proteomic analyses showed that a total of 163 proteins were significantly differentially expressed in DF-1 cells after being transiently transfected with EtAMA1. GO analyses showed that 73% of DEPs were involved in binding, including protein binding, RNA binding, and poly (A)-RNA binding. Thus, the data indicated that host binding was strongly affected by transient transfection with EtAMA1.
Previous reports showed that transiently-expressed heterologous proteins could significantly change cell proteomes, and in particular, proteins involved in different pathways [12, 36]. In the present study, KEGG analyses showed that multiple DEPs were involved in MAPK, FoxO, Wnt, Adipocytokine, ErbB GnRH, and AGE-RAGE signaling pathways. These networks included eight DEPs, including four up- and four downregulated proteins. Tropomyosin alpha-1 chain (TPM1), heat shock protein 70 (HSP70), dual specificity protein phosphatase 4 (DUSP4), and Wnt-11 (WNT11) were upregulated in DF-1 cells transfected with EtAMA1. Such upregulations may impact actin cytoskeleton organization, cellular responses, and dephosphorylation. Signal transducer and activator of transcription (STAT2), calcium/calmodulin dependent protein kinase II alpha (CAMK2A), muscle RAS oncogene homolog (MRAS), and TANK binding kinase 1(TBK1) were downregulated. Such downregulations may impact cell signal transducer activity, regulation of metabolic processes, cytoskeletal reorganization, and cell survival. Hence, we predicted that the transfection of EtAMA1 could activate specific signaling pathways in host cells, which is critical for parasite invasion and development.
The cytoskeleton is a cellular scaffolding contained within the cytoplasm. It maintains cell shape, provides mechanical strength, directs locomotion, regulates chromosome separation during mitosis and meiosis, and regulates the intracellular transport of organelles in cells [14]. In the context of Eimeria infections, changes in the cytoskeleton of the host cells affect cell adhesion and migration, and may play an important role in the invasion and development of Eimeria spp. In the present study, several cytoskeleton-related proteins, including TPM1, alpha-actinin-1 (ACTN1), myosin regulatory light chain interacting protein, septin-2, and keratin were significantly upregulated by the transfection of EtAMA1. Such upregulations may impact cytoskeletal organization, and cell migration and movement tendency. These observations clearly indicated that changes in the cytoskeleton of cells affect cell adhesion and migration, which may play an important role in the invasion and development of Eimeria spp.
In conclusion, the present study revealed that EtAMA1 was secreted by micronemes. Both rEtAMA1-specific antibodies and its interacting proteins, EtESP, EtRON2, inhibited parasite invasion, and the overexpression of EtAMA1 in cells promoted sporozoite invasion, thus suggesting that EtAMA1 was involved in host-cell sporozoite invasion. The proteomic changes in EtAMA1-trancfected DF-1 cells were analyzed using an iTRAQ-based proteomic method. Our analyses of the DEPs were comprehensive, but further studies are necessary to understand the functions of the identified proteins regulated by EtAMA1 in DF-1 cells. Such studies will be important to understand the precise functions and molecular mechanisms of EtAMA1 during Eimeria host-cell invasion.
Supplementary Material
Table S1. Detailed list of proteins of DF-1 cells transfected transiently with EtAMA1.
Detailed list of 163 proteins differentially expressed in DF-1 cells transfected transiently with EtAMA1.
Access hereFunding
This work was supported by grants from the National Science Foundation of China (Nos. 31672551 and 31572266), the National Key R&D program of China (No. 2017YFD0500400), and the National Parasitic Resources Center (No. NPRC-2019-194-30).
Conflicts of interest
The authors declare that they have no competing interests.
Acknowledgments
We thank all organizations that funded this work. We also thank International Science Editing (https://www.internationalscienceediting.com/) for editing the manuscript.
References
- Aikawa M, Miller LH, Johnson J, Rabbege J. 1978. Erythrocyte entry by malarial parasites. A moving junction between erythrocyte and parasite. Journal of Cell Biology, 77, 72–82. [CrossRef] [PubMed] [Google Scholar]
- Alexander DL, Mital J, Ward GE, Bradley P, Boothroyd JC. 2005. Identification of the moving junction complex of Toxoplasma gondii: a collaboration between distinct secretory organelles. PLoS Pathogens, 1(2), e17. [CrossRef] [PubMed] [Google Scholar]
- Alexander DL, Arastu-Kapur S, Dubremetz JF, Boothroyd JC. 2006. Plasmodium falciparum AMA1 binds a rhoptry neck protein homologous to TgRON4, a component of the moving junction in Toxoplasma gondii. Eukaryotic Cell, 5, 1169–1173. [CrossRef] [PubMed] [Google Scholar]
- An Z, Hu T, Lv Y, Li P, Liu L. 2020. Targeted amino acid and related amines analysis based on iTRAQ®-LC-MS/MS for discovering potential hepatotoxicity biomarkers. Journal of Pharmaceutical and Biomedical Analysis, 178, 112812. [CrossRef] [PubMed] [Google Scholar]
- Bargieri D, Lagal V, Andenmatten N, Tardieux I, Meissner M, Ménard R. 2014. Host cell invasion by apicomplexan parasites: the junction conundrum. PLoS Pathogens, 10(9), e1004273. [CrossRef] [PubMed] [Google Scholar]
- Bargieri DY, Andenmatten N, Lagal V, Thiberge S, Whitelaw JA, Tardieux I, Meissner M, Ménard R. 2013. Apical membrane antigen 1 mediates apicomplexan parasite attachment but is dispensable for host cell invasion. Nature Communications, 4, 2552. [CrossRef] [PubMed] [Google Scholar]
- Besteiro S, Michelin A, Poncet J, Dubremetz JF, Lebrun M. 2009. Export of a Toxoplasma gondii rhoptry neck protein complex at the host cell membrane to form the moving junction during invasion. PLoS Pathogens, 5, e1000309. [CrossRef] [PubMed] [Google Scholar]
- Besteiro S, Dubremetz JF, Lebrun M. 2011. The moving junction of apicomplexan parasites: a key structure for invasion. Cellular Microbiology, 13(6), 797–805. [CrossRef] [PubMed] [Google Scholar]
- Carruthers VB, Giddings OK, Sibley LD. 1999. Secretion of micronemal proteins is associated with Toxoplasma invasion of host cells. Cellular Microbiology, 1, 225–235. [CrossRef] [PubMed] [Google Scholar]
- Chapman HD, Shirley MW. 2003. The Houghton strain of Eimeria tenella: a review of the type strain selected for genome sequencing. Avian Pathology, 32, 115–127. [CrossRef] [Google Scholar]
- Chesne-Seck ML, Pizarro JC, Vulliez-Le Normand B, Collins CR, Blackman MJ, Faber BW, Remarque EJ, Kocken CH, Thomas AW, Bentley GA. 2005. Structural comparison of apical membrane antigen 1 orthologues and paralogues in apicomplexan parasites. Molecular Biochemical Parasitology, 144, 55–67. [CrossRef] [Google Scholar]
- Cunha C, Coelho AV. 2012. Comparative proteome analysis of a human liver cell line stably transfected with hepatitis D virus full-length cDNA. Methods in Molecular Biology, 909, 205–225. [Google Scholar]
- Deans JA, Alderson T, Thomas AW, Mitchell GH, Lennox ES, Cohen S. 1982. Rat monoclonal antibodies which inhibit the in vitro multiplication of Plasmodium knowlesi. Clinical and Experiment Immunology, 49(2), 297–309. [Google Scholar]
- Doherty GJ, McMahon HT. 2008. Mediation, modulation, and consequences of membrane-cytoskeleton interactions. Annual Review of Biophysics, 37, 65–95. [CrossRef] [PubMed] [Google Scholar]
- Dong WT, Xiao LF, Hu JJ, Zhao XX, Liu JX, Zhang Y. 2017. iTRAQ proteomic analysis of the interactions between Bombyx mori nuclear polyhedrosis virus and silkworm. Journal of Proteomics, 166, 138–145. [CrossRef] [PubMed] [Google Scholar]
- Han H, Xue P, Dong H, Zhu S, Zhao Q, Huang B. 2016. Screening and characterization of apical membrane antigen 1 interacting proteins in Eimeria tenella. Experimental Parasitology, 170, 116–124. [CrossRef] [PubMed] [Google Scholar]
- Jahn D, Matros A, Bakulina AY, Tiedemann J, Schubert U, Giersberg M, Haehnel S, Zoufal K, Mock HP, Kipriyanov SM. 2009. Model structure of the immunodominant surface antigen of Eimeria tenella identified as a target for sporozoite-neutralizing monoclonal antibody. Parasitology Research, 105, 655–668. [CrossRef] [PubMed] [Google Scholar]
- Jiang LL, Lin JJ, Han HY, Dong H, Zhao QP, Zhu SH, Huang B. 2012. Identification and characterization of Eimeria tenella apical membrane antigen-1 (AMA1). PLoS One, 7, e41115. [CrossRef] [PubMed] [Google Scholar]
- Labbé M, de Venevelles P, Girard-Misguich F, Bourdieu C, Guillaume A, Péry P. 2005. Eimeria tenella microneme protein EtMIC3: identification, localization and role in host cell infection. Molecular & Biochemical Parasitology, 140, 43–53. [CrossRef] [PubMed] [Google Scholar]
- Lal K, Bromley E, Oakes R, Prieto JH, Sanderson SJ, Kurian D, Hunt L, Yates JR 3rd, Wastling JM, Sinden RE, Tomley FM. 2009. Proteomic comparison of four Eimeria tenella life-cycle stages: unsporulated oocyst, sporulated oocyst, sporozoite and second-generation merozoite. Proteomics, 9, 4566–4576. [CrossRef] [PubMed] [Google Scholar]
- Lillehoj HS, Trout JM. 1993. Coccidia: a review of recent advances on immunity and vaccine development. Avian Patholology, 22(1), 3–31. [CrossRef] [Google Scholar]
- Long PL, Millard BJ, Joyner LP, Norton CC. 1976. A guide to laboratory techniques used in the study and diagnosis of avian coccidiosis. Folia Veterinaria Latina, 6, 201–217. [PubMed] [Google Scholar]
- Ma D, Huang Y, Ma C, Zhang L, Wang J, Wang D, Li J, Dalloul RA. 2019. Eimeria tenella: specific EtAMA1-binding peptides inhibit sporozoite entry into host cells. Poultry Science, 98(10), 4480–4491. [CrossRef] [PubMed] [Google Scholar]
- Mital J, Meissner M, Soldati D, Ward GE. 2005. Conditional expression of Toxoplasma gondii apical membrane antigen-1 (TgAMA1) demonstrates that TgAMA1 plays a critical role in host cell invasion. Molecular Biology of the Cell, 16, 4341–4349. [CrossRef] [PubMed] [Google Scholar]
- Mitchell GH, Thomas AW, Margos G, Dluzewski AR, Bannister LH. 2004. Apical membrane antigen 1, a major malaria vaccine candidate, mediates the close attachment of invasive merozoites to host red blood cells. Infection and Immunity, 72, 154–158. [CrossRef] [PubMed] [Google Scholar]
- Muh F, Lee SK, Hoque MR, Han JH, Park JH, Firdaus ER, Moon RW, Lau YL, Han ET. 2018. In vitro invasion inhibition assay using antibodies against Plasmodium knowlesi Duffy binding protein alpha and apical membrane antigen protein 1 in human erythrocyte-adapted P. knowlesi A1-H.1 strain. Malaria Journal, 17, 272. [CrossRef] [PubMed] [Google Scholar]
- Ng ST, Sanusi Jangi M, Shirley MW, Tomley FM, Wan KL. 2002. Comparative EST analyses provide insights into gene expression in two asexual developmental stages of Eimeria tenella. Experimental Parasitology, 101(2–3), 168–173. [CrossRef] [PubMed] [Google Scholar]
- Parker ML, Boulanger MJ. 2015. An extended surface loop on Toxoplasma gondii Apical Membrane Antigen 1 (AMA1) governs ligand binding selectivity. PLoS One, 10(5), e0126206. [CrossRef] [Google Scholar]
- Pastor-Fernández I, Kim S, Billington K, Bumstead J, Marugán-Hernández V, Küster T, Ferguson DJP, Vervelde L, Blake DP, Tomley FM. 2018. Development of cross-protective Eimeria-vectored vaccines based on apical membrane antigens. International Journal for Parasitology, 48, 505–518. [CrossRef] [PubMed] [Google Scholar]
- Pizarro JC, Vulliez-Le Normand B, Chesne-Seck ML, Collins CR, Withers-Martinez C, Hackett F, Blackman MJ, Faber BW, Remarque EJ, Kocken CH, Thomas AW, Bentley GA. 2005. Crystal structure of the malaria vaccine candidate apical membrane antigen 1. Science, 308, 408–411. [CrossRef] [Google Scholar]
- Reid AJ, Blake DP, Ansari HR, Billington K, Browne HP, Bryant J, Dunn M, Hung SS, Kawahara F, Miranda-Saavedra D, Malas TB, Mourier T, Naghra H, Nair M, Otto TD, Rawlings ND, Rivailler P, Sanchez-Flores A, Sanders M, Subramaniam C, Tay YL, Woo Y, Wu X, Barrell B, Dear PH, Doerig C, Gruber A, Ivens AC, Parkinson J, Rajandream MA, Shirley MW, Wan KL, Berriman M, Tomley FM, Pain A. 2014. Genomic analysis of the causative agents of coccidiosis in domestic chickens. Genome Research, 24(10), 1676–1685. [CrossRef] [PubMed] [Google Scholar]
- Ren Y, Hao P, Dutta B, Cheow ES, Sim KH, Gan CS, Lim SK, Sze SK. 2013. Hypoxia modulates A431 cellular pathways association to tumor radioresistance and enhanced migration revealed by comprehensive proteomic and functional studies. Molecular & Cellular Proteomics, 12, 485–498. [CrossRef] [Google Scholar]
- Salama AA, Terkawi MA, Kawai S, Aboulaila M, Nayel M, Mousa A, Zaghawa A, Yokoyama N, Igarashi I. 2013. Specific antibody to a conserved region of Babesia apical membrane antigen-1 inhibited the invasion of B. bovis into the erythrocyte. Experimental Parasitology, 135(3), 623–628. [CrossRef] [PubMed] [Google Scholar]
- Shirley MW. 1995. Eimeria species and strains of chickens, in Biotechnology Guidelines on Techniques in Coccidiosis Research. The European Commission DGXII, Luxembourg City, Luxembourg. p. 24. [Google Scholar]
- Tomley FM, Bumstead JM, Billington KJ, Dunn PP. 1996. Molecular cloning and characterization of a novel acidic microneme protein (Etmic-2) from the apicomplexan protozoan parasite, Eimeria tenella. Molecular Biochemical Parasitology, 79(2), 195–206. [CrossRef] [PubMed] [Google Scholar]
- Tong A, Gou L, Lau QC, Chen B, Zhao X, Li J, Tang H, Chen L, Tang M, Huang C, Wei Y. 2009. Proteomic profiling identifies aberrant epigenetic modifications induced by hepatitis B virus X protein. Journal of Proteome Research, 8(2), 1037–1046. [CrossRef] [PubMed] [Google Scholar]
- Tonkin ML, Roques M, Lamarque MH, Pugnière M, Douguet D, Crawford J, Lebrun M, Boulanger MJ. 2011. Host cell invasion by apicomplexan parasites: insights from the co-structure of AMA1 with a RON2 peptide. Science, 333(6041), 463–467. [CrossRef] [PubMed] [Google Scholar]
- Tyler JS, Treeck M, Boothroyd JC. 2011. Focus on the ringleader: the role of AMA1 in apicomplexan invasion and replication. Trends in Parasitology, 27(9), 410–420. [CrossRef] [PubMed] [Google Scholar]
- Walker RA, Sharman PA, Miller CM, Lippuner C, Okoniewski M, Eichenberger RM, Ramakrishnan C, Brossier F, Deplazes P, Hehl AB, Smith NC. 2015. RNA Seq analysis of the Eimeria tenella gametocyte transcriptome reveals clues about the molecular basis for sexual reproduction and oocyst biogenesis. BMC Genomics, 16, 94. [CrossRef] [PubMed] [Google Scholar]
- Wang B, Hajano JU, Ren Y, Lu C, Wang X. 2015. iTRAQ-based quantitative proteomics analysis of rice leaves infected by Rice stripe virus reveals several proteins involved in symptom formation. Virology Journal, 12, 99. [CrossRef] [PubMed] [Google Scholar]
- Wang X, Gong PT, Li JH, Yang X, Zhang XC. 2018. Identification of interaction between Eimeria tenella apical membrane antigen-1 and microneme protein-2. Journal of Pathogen Biology, 13(3), 267–273 (in Chinese). [Google Scholar]
- Wiśniewski JR, Zougman A, Nagaraj N, Mann M. 2009. Universal sample preparation method for proteome analysis. Nature Methods, 6(5), 359–362. [CrossRef] [PubMed] [Google Scholar]
- Yan M, Cui X, Zhao Q, Zhu S, Huang B, Wang L, Zhao H, Liu G, Li Z, Han H, Dong H. 2018. Molecular characterization and protective efficacy of the microneme 2 protein from Eimeria tenella. Parasite, 25, 60. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
- Yan M, Huang B, Zhao QP, Han HY, Zhu SH, Zhao ZP, Chen T, Lv L, Dong H. 2019. Demonstration of interaction between domain of apical membrane antigen 1 and rhoptry neck protein 2 of Eimeria tenella by BiFC technology. Chinese Journal of Animal Infectious Disease, 27(4), 32–38 (in Chinese). [Google Scholar]
- Zhang H, Compaore MK, Lee EG, Liao M, Zhang G, Sugimoto C, Fujisaki K, Nishikawa Y, Xuan X. 2007. Apical membrane antigen 1 is a cross-reactive antigen between Neospora caninum and Toxoplasma gondii, and the anti-NcAMA1 antibody inhibits host cell invasion by both parasites. Molecular & Biochemical Parasitology, 151(2), 205–212. [CrossRef] [Google Scholar]
- Zhao Z, Zhao Q, Zhu S, Huang B, Lv L, Chen T, Yan M, Han H, Dong H. 2019. iTRAQ-based comparative proteomic analysis of cells infected with Eimeria tenella sporozoites. Parasite, 26, 7. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
- Zhu M, Dai S, McClung S, Yan X, Chen S. 2009. Functional differentiation of Brassica napus guard cells and mesophyll cells revealed by comparative proteomics. Molecular & Cellular Proteomics, 8(4), 752–766. [CrossRef] [Google Scholar]
- Zhu C, Zhao Y, Huang X, Pang Y, Zhao Y, He X. 2013. Quantitative proteomic analysis of streptomycin-resistant and sensitive clinical isolates of Mycobacterium tuberculosis. Wei Sheng Wu Xue Bao, 53(2), 154–163 (in Chinese). [PubMed] [Google Scholar]
Cite this article as: Wang Q, Zhao Q, Zhu S, Huang B, Yu S, Liang S, Wang H, Zhao H, Han H & Dong H. 2020. Further investigation of the characteristics and biological function of Eimeria tenella apical membrane antigen 1. Parasite 27, 70.
All Figures
![]() |
Figure 1 EtAMA1 is secreted by micronemes. (a) EtAMA1 secretion is FCS- and temperature-dependent. Fresh sporozoites were incubated in PBS or complete medium (CM) at 4 °C or 41 °C for 2 h. Supernatants containing excretory-secretory antigens (ESAs) were harvested and analyzed by western blotting to detect EtAMA1 and EtMIC2. (b) EtAMA1 secretion is inhibited by staurosporine. Sporozoites were incubated in CM with various concentrations of staurosporine or DMSO at 41 °C for 2 h. Supernatants containing ESAs was harvested and analyzed by western blotting to detect EtAMA1 and EtMIC2. |
| In the text | |
![]() |
Figure 2 Colocalization of EtAMA1, EtESP, and EtRON2 in sporozoites by indirect immunofluorescence. Parasites were immunostained with anti-rEtAMA1, and anti-rEtESP or anti-rEtRON2 antibodies, visualized with FITC (green) and counter-stained with DAPI (blue). Scale bar, 10 μm. |
| In the text | |
![]() |
Figure 3 Inhibition of sporozoite invasion in vitro by antibodies against rEtAMA1, rEtESP, and rEtRON2. (a) Invasion-inhibition activities of single antibodies. Anti-rEtAMA1, rEtESP, and rEtRON2 rabbit anti-serum against recombinant EtAMA1, EtESP and EtRON2 protein, respectively; IgG, normal rabbit serum. (b) Invasion-inhibition activities of antibody combinations. Combinations of anti-rEtAMA1 and anti-rEtESP or anti-rEtRON2 were added at a ratio of 1:1 to generate a gradient concentration of IgG. All assays were performed in triplicate. *p < 0.05, **p < 0.01 and ***p < 0.001, as determined by the Student’s t-test versus the non-immunized IgG groups at the same concentration. |
| In the text | |
![]() |
Figure 4 In vitro sporozoite invasion of DF-1 cells transiently transfected with EtAMA1. (a) Verification of pcDNA3.1-(+)-EtAMA1 expression in DF-1 cells by IFA. (b) The proliferation of DF-1 cells transfected with pcDNA3.1-(+)-EtAMA1 or pcDNA3.1-(+). (c) Sporozoite invasion rate in DF-1 cells transfected with pcDNA3.1-(+)-EtAMA1 or pcDNA3.1-(+). *p < 0.05 and **p < 0.01, as determined by the Student’s t-test versus the untreated group. |
| In the text | |
![]() |
Figure 5 Gene ontology analysis of 163 proteins differentially expressed in DF-1 cells transiently transfected with EtAMA1. Proteins were annotated based on biological process, cellular component, and molecular function. |
| In the text | |
![]() |
Figure 6 KEGG pathway classification of differentially expressed proteins in DF-1 cells transiently transfected with EtAMA1. |
| In the text | |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.






