EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 27 (2020) Parasite, 27 (2020) 54 Full HTML
Open Access
Issue
Parasite
Volume 27, 2020
Article Number 54
Number of page(s) 8
DOI https://doi.org/10.1051/parasite/2020052
Published online 02 November 2020

© K. Thiévent et al., published by EDP Sciences, 2020

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Chlamydiae are obligate intracellular bacteria known to cause medically and economically important infectious diseases. There are nine recognized families of Chlamydiae within the Chlamydiales order: Parachlamydiaceae, Criblamydiaceae, Rhabdochlamydiaceae, Waddliaceae, Simkaniaceae, Piscichlamydiaceae, Clavichlamydiaceae, Parilichlamydiaceae and Chlamydiaceae [16, 21, 57]. Chlamydiaceae includes two well-known human pathogens, Chlamydia trachomatis and C. pneumoniae, but also includes other animal pathogens responsible for zoonotic infections such as C. psittaci and C. abortus [5, 30], the causative agents of psittacosis and sheep abortion, respectively. Chlamydia trachomatis is responsible for sexually transmitted infections worldwide but also causes trachoma, a blinding disease in developing countries [2, 35, 54], while Chlamydia pneumoniae is an agent responsible for respiratory infections [37]. While members of the Chlamydiaceae family are known to be human and/or animal pathogens and are thus highly studied, the role of bacteria belonging to the eight other family-level lineages (also called Chlamydia-like organisms (CLOs)) requires further investigations. Waddlia chondrophila, a member of the Waddliaceae family, has recently been associated with miscarriage and tubal infertility [3, 4, 60], while Simkania negevensis, Rhabdochlamydia spp. and Parachlamydia spp. have been associated with respiratory infections [15, 24, 27, 36, 39].

Chlamydiae have been found in a wide variety of environmental samples such as water and soil, but also in different organisms such as mammals, reptiles and birds, as well as in arthropods and protozoans [30, 40, 43, 55]. Recently, CLOs and other members of the Chlamydiaceae family have been discovered in bats. Two fruit bat species were found to harbor bacteria from the Waddliaceae family, with Waddlia malaysiensis found in the urine of Eonycteris spelaea (Chiroptera: Pteropodidae) in Peninsular Malaysia [13] and Waddlia cocoyoc found in skin biopsies of Artibeus intermedius (Chiroptera: Phyllostomidae) in Mexico [41]. A recent study found that more than 50% of the feces samples of the bat Myotis daubentonii (Chiroptera: Vespertilionidae) carried members of the Chlamydiae phylum in Finland, with most of the positive samples belonging to two main families, the Rhabdochlamydiaceae and the Chlamydiaceae [29]. These studies suggested that bats may act as reservoirs for Chlamydia and CLOs, in addition to other pathogens such as Bartonella [59], Ebola or SARS [10, 26]. Indeed, colonial habits of bats, in particular during the reproductive season when females aggregate in huge numbers to form nursery colonies, make them particularly susceptible to pathogens and parasites [11]. Although bats seem to be colonized by various members of the Chlamydiae phylum, whether these strict intracellular bacteria are transmitted between bats is yet unknown. However, ectoparasites of bats may be suitable vector candidates for Chlamydiae bacteria.

Spinturnix mites are obligate hematophagous ectoparasites of bats and are found on the membranous regions of their host’s body, mainly the wing membranes [47]. Spinturnix mites are not able to survive away from their host more than a few hours [23] and are viviparous, a life history strategy that has been proposed to facilitate vertical pathogen transmission [11]. Thus, their ecology and feeding biology makes them good candidates to transmit and maintain Chlamydiae within and between bat populations.

The aim of this study was to evaluate the distribution and diversity of Chlamydiae in Spinturnix mites and to reveal their reservoir or vectorial potential for Chlamydiae in bats. To do so, we first screened Spinturnix myoti, a species that is specialized on mouse-eared bats (Myotis spp.), for the presence of Chlamydiae. We then compared the Chlamydiae prevalence between three different Myotis bat species on which mites were collected, and between the six different countries where they were collected. Finally, some of the 16S rRNA genes of positive results were sequenced and submitted to a BLAST analysis.

Methods

Spinturnix sampling and DNA purification

Bats were captured and Spinturnix ectoparasites were collected in 1998, 2005 and 2006 before the Nagoya convention (2010), and thus no specific authorizations were needed. Ectoparasites were placed in 98% ethanol and kept at −20 °C until further processing. Collection sites were located in North Africa, such as Tunisia and Morocco, as well as in Europe, including France, Italy, Spain and Switzerland. Spinturnix mites were identified using different morphological keys [18, 19, 49]. Spinturnix myoti specimens were retrieved from the lesser and the greater mouse-eared bats, respectively M. blythii (Italy (Piemonte), Switzerland (Valais)) and M. myotis (Italy (Piemonte), Spain (Andalousia, La Fajara), Switzerland (Jura, Valais, Vaud)) and from the Maghreb mouse-eared bat Myotis punicus (France (Corsica), Italy (Sardinia), Morocco, Tunisia). Myotis myotis and M. blythii live in sympatry throughout Europe and frequently form mixed species colonies (here, Piemonte and Valais). These two species have never been found in sympatry with M. punicus. DNA extraction from each sample was performed using a standard proteinase K-phenol chloroform method [48].

Pan-Chlamydiales real-time PCR and sequencing

A real-time quantitative PCR specific to Chlamydiales performed with a StepOne Plus real-time PCR system (Applied Biosystems, Zug, Switzerland) was used to detect Chlamydiales DNA [37]. Specific forward primer panChl16F2, 5′–CCGCCAACACTGGGACT–3′ (the underlined nucleotides represent locked nucleic acids) and reverse primer panChl16R2, 5′–GGAGTTAGCCGGTGCTTCTTTAC–3′, amplified a DNA fragment of about 200 bp (size is species-dependent) belonging to the Chlamydiales 16S ribosomal RNA-encoding gene, and these fragments were detected using a pan-Chlamydiales specific probe, 5′–FAM [6-carboxfluorescein]-CTACGGGAGGCTGCAGTCGAGAATC-BHQ1 [black hole quencher 1]–3′. Amplifications were performed in a final volume of 20 μL with iTaq Universal Probes Supermix with ROX (Bio-Rad, Reinach, Switzerland), 0.1 μM of each primer and of the probe, and with 5 μL of sample DNA. DNA was amplified after initial denaturation and activation of 3 min at 95 °C for 40 cycles with denaturation, annealing and extension occurring at 95 °C, 67 °C and 72 °C, respectively and each step lasting 15 s. Standard curves were built using a serial dilution of positive control plasmids (ten-fold diluted from 105 to 5 copies). Each Spinturnix DNA sample was tested in duplicate in 96-well plates, along with standard dilutions in duplicate, two negative controls and two extraction controls. Only samples with a threshold cycle value (Ct) smaller than 35 were sent to Microsynth (Balgach, Switzerland) for Sanger sequencing, since a Ct of 35 is the observed threshold for amplicon sequencing we documented in our laboratory. Although they were not sent for sequence analysis, the samples with Ct higher than 35 were also considered positive since the PCR used in this study was highly specific [37].

Phylogeny

The partial 16S rRNA regions sequenced here in addition to referenced sequences of the 16S rRNA genes of different Chlamydiales and an outgroup taxa (Opitutus terrae, a member of the order Verrucomicrobiales, which has previously been used as an outgroup of all Chlamydiales [50]) were aligned using the MUSCLE plug-in [20] with Geneious software [34]. Using this alignment and the MrBayes plug-in [32], we built a Bayesian posterior-probability consensus tree with a total chain length of 1,100,000 and a burn-in length of 11,000, as previously described [29].

GenBank accession numbers

Assigned accession number for the partial 16S rRNA sequences amplified from S. myoti deposited in GenBank are MT844007–MT844018.

Statistical analysis

Using a general linear model (GLM) with a binomial distribution, prevalence of Chlamydiae within Spinturnix was first compared between S. myoti males and females. In this analysis, the proportion of positive samples was set as the response variable, S. myoti sex was set as fixed factors and the model was weighted by the total number of samples per group (N).

Using another GLM with a binomial distribution, prevalence of Chlamydiae within Spinturnix was then compared between the bat species on which they were collected. In this analysis, the proportion of positive samples was set as the response variable, the host species were set as fixed factors and the model was weighted by the total number of samples per group (N).

As bats were not always found in sympatry, we compared in a second step the Chlamydiae prevalence between the collection sites (i.e. the country where bats were collected) within each bat species independently. To do this, we ran for each bat species a GLM with a binomial distribution and with the proportion of positive Spinturnix samples set as the response variable, and the country as a fixed factor.

Third, using a GLM with a binomial distribution, we compared the prevalence between Spinturnix mites collected on M. myotis and M. blythii when these later were found in sympatry (in Piemonte (Italy) and Valais (Switzerland)). The host bat species and the collection site were set as a fixed factor with the proportion of positive results set as response variable.

Finally, in order to get a better idea of the role of Spinturnix mites in the transmission of Chlamydiae between bats, we tested whether the fact of living or not in sympatry affected the Chlamydiae prevalence in the Spinturnix mites. To do so, we selected the data from the Spinturnix collected on M. myotis since this was the only bat species found to live both alone or in sympatry. Prevalences of Spinturnix between M. myotis living in sympatry or not were compared using a GLM with a binomial distribution.

All analyses and graphs of prevalence were performed with R software, version 3.5.2 [44] and its interface Rstudio, version 1.1.463 [46]. Significance of the effects were evaluated using the ANOVA function of the R package “car” [22].

Results

Chlamydiae prevalence in Spinturnix mites

Of the 88 Spinturnix myoti, 57.95% were positive for the presence of Chlamydiae. Spinturnix myoti males and females were equally infected by Chlamydiae with 53.33% positive females and 57.97% positive males (χ2 = 0.002, df = 1, p = 0.97, Table 1). The Chlamydiae prevalence in S. myoti significantly varied between the host bat species with 20% (95% confidence intervals (CI); 8.1–41.6%) Myotis blythii, 64.5% (95% CI; 46.9–78.9%) M. myotis, and 73% (95% CI; 57–84.6%) M. punicus being positive for Chlamydiae (χ2 = 16.2, df = 2, p < 0.001) (Fig. 1).

thumbnail Figure 1

Prevalence of Chlamydiae in Spinturnix myoti as a function of their host species. Bars represent the 95% confidence intervals.

Table 1

Summary of Chlamydiae prevalence results as a function of sex and life stage of S. myoti and of bat host species and collection sites.

The results of Chlamydiae prevalence are summarized in Table 1. The Chlamydiae prevalence in S. myoti found on M. punicus did not vary significantly between the different countries where the mites were collected (χ2 = 3.98, df = 3, p = 0.26). Similar results were found for the S. myoti collected on M. blythii, with no difference in prevalence between mites collected in Switzerland and in Italy (χ2 = 0.48, df = 1, p = 0.49). In contrast, the Chlamydiae prevalence in S. myoti collected on M. myotis significantly varied between the different collection sites (χ2 = 11.41, df = 2, p = 0.03), with a prevalence ranging from 40% (Italy) to 100% (Spain).

The Chlamydiae prevalence in S. myoti mites was not significantly different between the host bat M. myotis and M. blythii when these latter were living in sympatry (χ2 = 0.21, df = 1, p = 0.64). In fact, 30% (95% CI; 10.8–60.3%) of the S. myoti collected on M. myotis harbored Chlamydiae, while the prevalence was 20% (95% CI; 8.1–41.6%) for the mites collected on M. blythii. In addition, there was no effect of the collection site (χ2 = 0.95, df = 1, p = 0.33), nor from the interaction between the host species and the collection sites (χ2 = 0.01, df = 1, p = 0.92).

Finally, Chlamydiae prevalence was significantly different between S. myoti mites collected on M. myotis bats living in sympatry and mites collected on M. myotis living in allopatry (χ2 = 7.66, df = 1, p = 0.006). In fact, while 80.95% (95% CI; 59.9–92.3%) of the S. myoti harbored Chlamydiae when M. myotis were found alone, only 30% harbored Chlamydiae when M. myoti were living in sympatry with M. blythii.

BLAST and phylogenetic analysis

Of the 51 positive samples, 28 showed Ct values lower than 35 and were thus sequenced. Of these, 16 gave uninterpretable sequences (due to low DNA content or to mixed sequences), and 8 showed best BLAST hit identities smaller than 92.5% and thus correspond to new family-level lineages according to the established taxonomy cut-off [42]. Following this taxonomy cut-off, the 4 remaining samples with best BLAST hits ranging from 94.2% to 97.4% were taxonomically assigned at the family-level lineages with two sequences belonging to the Parachlamydiaceae (GenBank accession numbers MT844011 and MT844016) one to the Simkaniaceae (GenBank accession number MT844014) and one to the Chlamydiaceae (GenBank accession number MT844008).

In accordance with the BLAST analysis, the Bayesian phylogenetic tree revealed that most of the sequences that showed BLAST hit identities smaller than 92.5% were grouped together with a high posterior probability score and seem to form a previously unknown family of Chlamydiales (Fig. 2).

thumbnail Figure 2

Phylogenetic Bayesian consensus tree of the Spinturnix sequences of this study (in bold) along with Chlamydiales-reference and outgroup sequences (all with their GenBank accession numbers) with the posterior probabilities of clades and the branch length for 16S rRNA. Only posterior probabilities of more than 50% are shown in the tree. In addition to their reference code, we also added the collection site and the bat host species of each S. myoti sequence.

Discussion

Chlamydia and Chlamydia-like organisms have recently been found in bat samples suggesting that bats may play a role as reservoirs for members of the Chlamydiae phylum [13, 29, 41]. However, the way bats become infected by these Chlamydiae is unclear. Here we found a high prevalence (57.95%) of Chlamydiae in Spinturnix myoti, an obligate, ectoparasitic mite species of mouse-eared bats (Myotis spp.), suggesting that mites may play a role as reservoirs or vectors. In addition, sequencing and phylogenetic analysis revealed that S. myoti mites harbor Chlamydiales from several families including a new family-level lineage, suggesting that the diversity of the Chlamydiales order is underestimated.

Although our knowledge of the epidemiology of the Chlamydiaceae family has increased rapidly due to their zoonotic potential, our understanding is still scarce concerning the ecology, diversity and epidemiology of Chlamydia-like organisms. CLOs are able to infect several organisms including humans [24, 25, 55], but transmission routes remain unknown. Previous studies have highlighted that amoebae may be reservoirs and dispersal vectors of different CLOs species, especially Parachlamydiaceae and Criblamydiaceae [30, 56]. Here, in addition to previous work done on ticks and fleas [9, 17, 28, 43], we confirmed that ectoparasites such as Spinturnix mites may play a role in the transmission of Chlamydiae. However, whether ectoparasites can effectively transmit Chlamydiae is not known and further studies are needed. A previous study showed that Bartonella infection found in humans was closely related to infections found in our target species S. myoti, suggesting that bat-associated bacterial pathogens can infect humans [53]. Additionally, other bacterial pathogens or possibly symbionts have been detected from mites, including Spinturnix spp., such as Anaplasma spp., Bartonella spp., Rickettsia spp. and Spiroplasma sp. [31, 45, 53].

Vector feeding preference is one of the most important components determining the distribution of diseases. Vectors that are specialized to take their blood meal from closely related hosts limit the distribution of the microbes they host to regions where they are present. On the other hand, vectors that are more generalists, i.e. feeding on distantly related host species, may favor the spread of pathogenic microbes they can transmit, possibly extending them to new host species. Spinturnix mites are known to display different levels of host specificity, ranging from one to several usually closely related bat species [1, 7, 8, 12]. Thus, they may play a major role in the distribution and/or maintenance of Chlamydiae bacteria within and between bat populations. In particular, S. myoti is rather specific to mouse-eared bats [57] but can disperse between closely-related species or by accidental transfer when these are in close contact. Importantly, while M. punicus are geographically localized in North Africa, Sardinia, Corsica and Malta [33], M. blythii and M. myotis are mainly found in continental Europe, sometimes forming mixed nursery colonies [12]. Despite the potential close contact between M. blythii and M. myotis, the Chlamydiae prevalence was significantly lower in the Spinturnix mites found on M. blythii, which might suggest that M. blythii is less vulnerable to Chlamydiae infection than M. myotis, and thus that M. blythii may have a lower reservoir potential for Chlamydiae. In addition, the prevalence in Spinturnix was significantly higher when M. myotis were living without any other bat species rather than when living in sympatry with M. blythii. This difference in prevalence between allopatric and sympatric M. myotis may reflect a dilution effect with M. blythii playing a role as an incompetent host. However, our results revealed that 20% of S. myoti collected on M. blythii were harboring Chlamydiae. A possibility may be that these infected S. myoti collected on M. blythii acquired their infection on M. myotis first before switching host. Spinturnicid mites are known to often switch between their hosts [23] and may thus carry their Chlamydiae from one host to another. However, since in this study S. myoti were collected on M. blythii only found in sympatry with M. myotis, this hypothesis cannot be confirmed. Further studies are thus needed to better understand the reservoir potential of bats for Chlamydiae, since it seems to be species-dependent, with M. blythii exhibiting at least a lower competence for Chlamydiae than M. myotis.

Altogether, these results indicate that S. myoti may contribute to the transmission and maintenance of Chlamydiae between bat species. The prevalence in S. myoti decreased when there is more than one host bat species, which indicates that the Chlamydiae may be distributed between the different bat species by these mites. In addition, our novel study showed that Chlamydiae infection in Spinturnix might be geographically variable depending of the bat species. While no difference between collection sites was found for M. punicus and M. blythii, there was a significant effect of the collection sites for M. myotis. However, these results may reflect the fact that the Spinturnix were collected on M. myotis living both in sympatry or allopatry and therefore deserve further investigations.

Although Chlamydia and Chlamydia-like bacteria have been detected in many different environmental samples and organisms, the diversity of the Chlamydiae phylum is highly underestimated. Most studies have shown that both environmental and organismal samples contain Chlamydiae that certainly represent new family-level lineages, thus new Chlamydiae species [28, 29, 42, 43, 55, 58], which our study also confirmed. While S. myoti harbored Chlamydiae from several families, the BLAST analysis revealed that more than half of the sequences were not attributable to a known family-level lineage, suggesting they belong to a new Chlamydiales family that may be specific to S. myoti or to bats. Of note, an S. myoti DNA sample was also documented positive for a Chlamydiaceae, which appeared to be closely related to C. muridarum found in small mammals, including rodents (Rodentia: Muridae). To our knowledge, this is only the second time that a member of the Chlamydiaceae family has been discovered in an arthropod. Additionally, Chlamydia psittaci has previously been isolated in Dermanyssus gallinae, a mite of canaries [14].

In conclusion, our results suggest that the ectoparasite S. myoti may play a role as a vector of Chlamydiae, since we found a high prevalence of these strict intracellular bacteria. Our findings highlight the limited knowledge about the ecology and epidemiology of Chlamydiae and the need for further investigations. Hence, as Chlamydiae may potentially impact human and animal health, future studies should focus on the understanding of the maintenance and transmission of this bacteria in bats. Furthermore, other obligate ectoparasites, such as bat fleas (Siphonaptera: Ischnopsyllidae), bat bugs (Hemiptera: Cimicidae and Polyctenidae) and bat flies (Diptera: Nycteribiidae and Streblidae) may also potentially act as reservoirs or vectors of a wide range of bacteria [6, 38, 51, 52], including Chlamydiae.

Acknowledgments

We thank R. Arlettaz, F. Biollaz, G. Beuneux, P. Debernardi, L. Faouzi, C. Ibanes, A. Ighous, J. Juste, M. Muccedda, E. Patriarca, A. Popa-Lisseanu, J. Quetglas and above all Nadia Bruyndonckx for their intensive field work to collect Spinturnix samples.

Conflicts of interest

The authors declare that they have no conflicts of interests.

References

  1. Baker AS, Craven JC. 2003. Checklist of the mites (Arachnida: Acari) associated with bats (Mammalia: Chiroptera) in the British Isles. Systematic and Applied Acarology Special Publications, 14, 1–20. [Google Scholar]
  2. Baud D, Greub G. 2011. Intracellular bacteria and adverse pregnancy outcomes. Clinical Microbiology and Infection, 17, 1312–1322. [CrossRef] [Google Scholar]
  3. Baud D, Regan L, Greub G. 2008. Emerging role of Chlamydia and Chlamydia-like organisms in adverse pregnancy outcomes. Current Opinion in Infectious Diseases, 21, 70–76. [CrossRef] [PubMed] [Google Scholar]
  4. Baud D, Goy G, Osterheld M-C, Borel N, Vial Y, Pospischil A, Greub G. 2011. Waddlia chondrophila: from bovine abortion to human miscarriage. Clinical Infectious Diseases, 52, 1469–1471. [CrossRef] [Google Scholar]
  5. Bayramova F, Jacquier N, Greub G. 2018. Insight in the biology of Chlamydia-related bacteria. Microbes and Infection, 20, 432–440. [CrossRef] [PubMed] [Google Scholar]
  6. Brook CE, Bai Y, Dobson AP, Osikowicz LM, Ranaivoson HC, Zhu Q, Kosoy MY, Dittmar K. 2015. Bartonella spp. in fruit bats and blood-feeding ectoparasites in Madagascar. PLoS Neglected Tropical Diseases, 9, e0003532. [CrossRef] [PubMed] [Google Scholar]
  7. Bruyndonckx N, Dubey S, Ruedi M, Christe P. 2009. Molecular cophylogenetic relationships between European bats and their ectoparasitic mites (Acari, Spinturnicidae). Molecular Phylogenetics and Evolution, 51, 227–237. [CrossRef] [PubMed] [Google Scholar]
  8. Bruyndonckx N, Biollaz F, Dubey S, Goudet J, Christe P. 2010. Mites as biological tags of their hosts. Molecular Ecology, 19, 2770–2778. [CrossRef] [PubMed] [Google Scholar]
  9. Burnard D, Weaver H, Gillett A, Loader J, Flanagan C, Polkinghorne A. 2017. Novel Chlamydiales genotypes identified in ticks from Australian wildlife. Parasites & Vectors, 10, 46. [CrossRef] [PubMed] [Google Scholar]
  10. Calisher CH, Childs JE, Field HE, Holmes KV, Schountz T. 2006. Bats: important reservoir hosts of emerging viruses. Clinical Microbiology Reviews, 19, 531–545. [CrossRef] [PubMed] [Google Scholar]
  11. Christe P, Arlettaz R, Vogel P. 2000. Variation in intensity of a parasitic mite (Spinturnix myoti) in relation to the reproductive cycle and immunocompetence of its bat host (Myotis myotis). Ecology Letters, 3, 207–212. [Google Scholar]
  12. Christe P, Giorgi MS, Vogel P, Arlettaz R. 2003. Differential species-specific ectoparasitic mite intensities in two intimately coexisting sibling bat species: resource-mediated host attractiveness or parasite specialization? Journal of Animal Ecology, 72, 866–872. [CrossRef] [Google Scholar]
  13. Chua PKB, Corkill JE, Hooi PS, Cheng SC, Winstanley C, Hart CA. 2005. Isolation of Waddlia malaysiensis, a novel intracellular bacterium, from fruit bat (Eonycteris spelaea). Emerging Infectious Diseases, 11, 271–277. [CrossRef] [PubMed] [Google Scholar]
  14. Circella E, Pugliese N, Todisco G, Cafiero MA, Sparagano OAE, Camarda A. 2011. Chlamydia psittaci infection in canaries heavily infested by Dermanyssus gallinae. Experimental and Applied Acarology, 55, 329. [CrossRef] [Google Scholar]
  15. Corsaro D, Greub G. 2006. Pathogenic potential of novel Chlamydiae and diagnostic approaches to infections due to these obligate intracellular bacteria. Clinical Microbiology Reviews, 19, 283–297. [CrossRef] [PubMed] [Google Scholar]
  16. Corsaro D, Valassina M, Venditti D. 2003. Increasing diversity within chlamydiae. Critical Reviews in Microbiology, 29, 37–78. [CrossRef] [PubMed] [Google Scholar]
  17. Croxatto A, Rieille N, Kernif T, Bitam I, Aeby S, Péter O, Greub G. 2014. Presence of Chlamydiales DNA in ticks and fleas suggests that ticks are carriers of Chlamydiae. Ticks and Tick-Borne Diseases, 5, 359–365. [CrossRef] [PubMed] [Google Scholar]
  18. Deunff J. 1977. Observations on Spinturnicidae of occidental paleartic region (Acarina, Mesostigmata) – specificity, distribution and repartition. Acarologia, 18, 602–617. [Google Scholar]
  19. Deunff J, Walter G, Bellido A, Volleth M. 2009. Description of a cryptic species, Spinturnix bechsteini n. sp. (Acari, Mesostigmata, Spinturnicidae), parasite of Myotis bechsteinii (Kuhl, 1817) (Chiroptera, Vespertilionidae) by using ecoethology of host bats and statistical methods. Journal of Medical Entomology, 41, 826–832. [Google Scholar]
  20. Edgar RC. 2004. MUSCLE: multiple sequence alignment with high accuracy and high throughput. Nucleic Acids Research, 32, 1792–1797. [CrossRef] [PubMed] [Google Scholar]
  21. Everett KDE, Bush RM, Andersen AA. 1999. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. International Journal of Systematic and Evolutionary Microbiology, 49, 415–440. [Google Scholar]
  22. Fox J, Weisberg S. 2010. An R companion to applied regression. Newbury Park, California, USA: SAGE. [Google Scholar]
  23. Giorgi MS, Arlettaz R, Guillaume F, Nusslé S, Ossola C, Vogel P, Christe P. 2004. Causal mechanisms underlying host specificity in bat ectoparasites. Oecologia, 138, 648–654. [CrossRef] [PubMed] [Google Scholar]
  24. Greub G. 2009. Parachlamydia acanthamoebae, an emerging agent of pneumonia. Clinical Microbiology and Infection, 15, 18–28. [CrossRef] [Google Scholar]
  25. Greub G, Raoult D. 2004. Microorganisms resistant to free-living Amoebae. Clinical Microbiology Reviews, 17, 413–433. [CrossRef] [PubMed] [Google Scholar]
  26. Han H-J, Wen H, Zhou C-M, Chen F-F, Luo L-M, Liu J, Yu X-J. 2015. Bats as reservoirs of severe emerging infectious diseases. Virus Research, 205, 1–6. [CrossRef] [PubMed] [Google Scholar]
  27. Heiskanen-Kosma T, Paldanius M, Korppi M. 2008. Simkania negevensis may be a true cause of community acquired pneumonia in children. Scandinavian Journal of Infectious Diseases, 40, 127–130. [CrossRef] [PubMed] [Google Scholar]
  28. Hokynar K, Sormunen JJ, Vesterinen EJ, Partio EK, Lilley T, Timonen V, Panelius J, Ranki A, Puolakkainen M. 2016. Chlamydia-like organisms (CLOs) in Finnish Ixodes ricinus ticks and human skin. Microorganisms, 4, Article no.: 28. [Google Scholar]
  29. Hokynar K, Vesterinen EJ, Lilley TM, Pulliainen AT, Korhonen SJ, Paavonen J, Puolakkainen M. 2017. Molecular evidence of Chlamydia-Like organisms in the feces of Myotis daubentonii bats. Applied and Environmental Microbiology, 83, e02951-16. [CrossRef] [PubMed] [Google Scholar]
  30. Horn M. 2008. Chlamydiae as symbionts in eukaryotes. Annual Review of Microbiology, 62, 113–131. [CrossRef] [PubMed] [Google Scholar]
  31. Hornok S, Kovács R, Meli ML, Gönczi E, Hofmann-Lehmann R, Kontschán J, Gyuranecz M, Dán Á, Molnár V. 2012. First detection of bartonellae in a broad range of bat ectoparasites. Veterinary Microbiology, 159, 541–543. [CrossRef] [PubMed] [Google Scholar]
  32. Huelsenbeck JP, Ronquist F. 2001. MRBAYES: Bayesian inference of phylogenetic trees. Bioinformatics, 17, 754–755. [CrossRef] [PubMed] [Google Scholar]
  33. Juste J, Paunović M. 2016. Myotis punicus. The IUCN Red List of Threatened Species, 2016, E.T44864A22073410. [Google Scholar]
  34. Kearse M, Moir R, Wilson A, Stones-Havas S, Cheung M, Sturrock S, Buxton S, Cooper A, Markowitz S, Duran C, Thierer T, Ashton B, Meintjes P, Drummond A. 2012. Geneious basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data. Bioinformatics, 28, 1647–1649. [CrossRef] [PubMed] [Google Scholar]
  35. Kuo CC, Jackson LA, Campbell LA, Grayston JT. 1995. Chlamydia pneumoniae (TWAR). Clinical Microbiology Reviews, 8, 451–461. [CrossRef] [PubMed] [Google Scholar]
  36. Lamoth F, Jaton K, Vaudaux B, Greub G. 2011. Parachlamydia and Rhabdochlamydia: emerging agents of community-acquired respiratory infections in children. Clinical Infectious Diseases, 53, 500–501. [CrossRef] [Google Scholar]
  37. Lienard J, Croxatto A, Aeby S, Jaton K, Posfay-Barbe K, Gervaix A, Greub G. 2011. Development of a new Chlamydiales-specific real-time PCR and its application to respiratory clinical samples. Journal of Clinical Microbiology, 49, 2637–2642. [CrossRef] [PubMed] [Google Scholar]
  38. Mühldorfer K. 2013. Bats and bacterial pathogens: a review. Zoonoses and Public Health, 60, 93–103. [CrossRef] [PubMed] [Google Scholar]
  39. Niemi S, Greub G, Puolakkainen M. 2011. Chlamydia-related bacteria in respiratory samples in Finland. Microbes and Infection, 13, 824–827. [CrossRef] [PubMed] [Google Scholar]
  40. Omsland A, Sixt BS, Horn M, Hackstadt T. 2014. Chlamydial metabolism revisited: interspecies metabolic variability and developmental stage-specific physiologic activities. FEMS Microbiology Reviews, 38, 779–801. [CrossRef] [PubMed] [Google Scholar]
  41. Pierlé SA, Morales CO, Martínez LP, Ceballos NA, Rivero JJP, Díaz OL, Brayton KA, Setién AA. 2015. Novel Waddlia intracellular bacterium in Artibeus intermedius Fruit Bats, Mexico. Emerging Infectious Diseases, 21, 2161–2163. [CrossRef] [PubMed] [Google Scholar]
  42. Pillonel T, Bertelli C, Salamin N, Greub G. 2015. Taxogenomics of the order Chlamydiales. International Journal of Systematic and Evolutionary Microbiology, 65, 1381–1393. [CrossRef] [PubMed] [Google Scholar]
  43. Pilloux L, Aeby S, Gaümann R, Burri C, Beuret C, Greub G. 2015. The high prevalence and diversity of Chlamydiales DNA within Ixodes ricinus ticks suggest a role for ticks as reservoirs and vectors of Chlamydia-related bacteria. Applied and Environmental Microbiology, 81, 8177–8182. [CrossRef] [PubMed] [Google Scholar]
  44. R Core Team. 2013. R: A language and environment for statistical computing. [Google Scholar]
  45. Reeves WK, Dowling APG, Dasch GA. 2006. Rickettsial agents from parasitic Dermanyssoidea (Acari: Mesostigmata). Experimental & Applied Acarology, 38, 181–188. [CrossRef] [PubMed] [Google Scholar]
  46. RStudio Team. 2016. RStudio: Integrated development environment for R. [Google Scholar]
  47. Rudnick A. 1960. A revision of mites of the Family Spinturnicidae (Acarina). University of California Publications in Entomology, 17, 157–284. [Google Scholar]
  48. Sambrook JE, Fritsch F, Manitatis T. 1989. Molecular cloning: a laboratory manual. New York: Second Edi Cold Spring Harbor Laboratory Press. [Google Scholar]
  49. Stanyukovich MK. 1997. Keys to the gamasid mites (Acari, Parasitiformes, Mesostigmata, Macronyssoidea et Laelaptoidea) parasitizing bats (Mammalia, Chiroptera) from Russia and adjacent countries. Rudolstädter Naturhistorische Schriften, 7, 13–46. [Google Scholar]
  50. Stride MC, Polkinghorne A, Miller TL, Groff JM, LaPatra SE, Nowak BF. 2013. Molecular characterization of “Candidatus Parilichlamydia carangidicola”, a novel Chlamydia-Like epitheliocystis agent in yellowtail kingfish, Seriola lalandi (Valenciennes), and the proposal of a new Family, “Candidatus Parilichlamydiaceae” fam. nov. (Order Chlamydiales). Applied and Environmental Microbiology, 79, 1590–1597. [CrossRef] [PubMed] [Google Scholar]
  51. Stuckey MJ, Chomel BB, de Fleurieu EC, Aguilar-Setién A, Boulouis H-J, Chang C. 2017. Bartonella, bats and bugs: a review. Comparative Immunology, Microbiology and Infectious Diseases, 55, 20–29. [CrossRef] [PubMed] [Google Scholar]
  52. Szentiványi T, Christe P, Glaizot O. 2019. Bat flies and their microparasites: current knowledge and distribution. Frontiers in Veterinary Science, 6, Article no.: 115. [Google Scholar]
  53. Szubert-Kruszyńska A, Stańczak J, Cieniuch S, Podsiadły E, Postawa T, Michalik J. 2019. Bartonella and Rickettsia infections in haematophagous Spinturnix myoti mites (Acari: Mesostigmata) and their bat host, Myotis myotis (Yangochiroptera: Vespertilionidae), from Poland. Microbial Ecology, 77, 759–768. [CrossRef] [PubMed] [Google Scholar]
  54. Taylor HR, Burton MJ, Haddad D, West S, Wright H. 2014. Trachoma. Lancet, 384, 2142–2152. [CrossRef] [PubMed] [Google Scholar]
  55. Taylor-Brown A, Polkinghorne A. 2017. New and emerging chlamydial infections of creatures great and small. New Microbes and New Infections, 18, 28–33. [CrossRef] [PubMed] [Google Scholar]
  56. Taylor-Brown A, Vaughan L, Greub G, Timms P, Polkinghorne A. 2015. Twenty years of research into Chlamydia-like organisms: a revolution in our understanding of the biology and pathogenicity of members of the phylum Chlamydiae. Pathogens and Disease, 73, 1–15. [Google Scholar]
  57. Uchikawa K, Zhang M-Y, O’Connor BM, Klompen BMH. 1994. Contribution to the taxonomy of the genus Spinturnix (Acari: Spinturnicidae), with the erection of a new genus, Emballonuria. Folia Parasitologica, 41, 287–304. [Google Scholar]
  58. Vajana E, Widmer I, Rochat E, Duruz S, Selmoni O, Vuilleumier S, Aeby S, Greub G, Joost S. 2018. Indication of spatially random occurrence of Chlamydia-like organisms in Bufo bufo tadpoles from ponds located in the Geneva metropolitan area. New Microbes and New Infections, 27, 54–63. [CrossRef] [PubMed] [Google Scholar]
  59. Veikkolainen V, Vesterinen EJ, Lilley TM, Pulliainen AT. 2014. Bats as reservoir hosts of human bacterial pathogen, Bartonella mayotimonensis. Emerging infectious diseases, 20(6), 960. [CrossRef] [PubMed] [Google Scholar]
  60. Verweij SP, Kebbi-Beghdadi C, Land JA, Ouburg S, Morré SA, Greub G. 2015. Waddlia chondrophila and Chlamydia trachomatis antibodies in screening infertile women for tubal pathology. Microbes and Infection, 17, 745–748. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Thiévent K, Szentiványi T, Aeby S, Glaizot O, Christe P & Greub G. 2020. Presence and diversity of Chlamydiae bacteria in Spinturnix myoti, an ectoparasite of bats. Parasite 27, 54.

All Tables

Table 1

Summary of Chlamydiae prevalence results as a function of sex and life stage of S. myoti and of bat host species and collection sites.

In the text

All Figures

thumbnail Figure 1

Prevalence of Chlamydiae in Spinturnix myoti as a function of their host species. Bars represent the 95% confidence intervals.
In the text
thumbnail Figure 2

Phylogenetic Bayesian consensus tree of the Spinturnix sequences of this study (in bold) along with Chlamydiales-reference and outgroup sequences (all with their GenBank accession numbers) with the posterior probabilities of clades and the branch length for 16S rRNA. Only posterior probabilities of more than 50% are shown in the tree. In addition to their reference code, we also added the collection site and the bat host species of each S. myoti sequence.
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.