Open Access
Research Article
Volume 25, 2018
Article Number 62
Number of page(s) 10
Published online 05 December 2018

© C. Liu et al., published by EDP Sciences, 2018

Licence Creative Commons
This is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


Cystic echinococcosis, which is a global health issue that affects humans and animals, is caused by the metacestode larval stage of Echinococcus granulosus [23]. The definitive hosts, intermediate hosts and aberrant intermediate hosts for this parasite are dogs, livestock, and humans, respectively [3, 4]. In livestock and humans, these parasites are mainly located in the liver and lungs [4]. Mebendazole and albendazole, both benzimidazoles (BZs), are drugs for the therapy of echinococcosis [7, 28]. Circumstantial evidence suggests that BZs suppress the polymerization of parasite microtubules (MTs) by binding to the β-tubulin [1, 17], which has made tubulin an attractive target for drug development [27, 39], but studies related to the MTs of E. granulosus have been limited.

Microtubules are highly dynamic structures that perform diverse and critical functions in cell structure, cell division, motility, and signal transduction [5, 8]. MTs are composed of soluble tubulin subunits comprising α- and β-tubulins, which are similar in mass (~55 kDa) and share approximately 40% amino acid identity. The formation of MTs reflects the balance between polymerization and de-polymerization of α/β-tubulin heterodimers. The tubulin polymerization assay has already been a powerful tool in characterizing the interactions between drugs and MTs. To date, most functional analyses of MTs have used native tubulins purified from mammalian brain, eukaryotic organisms, kinetoplastid parasites (Leishmania, Trypanosoma) and Saccharomyces cerevisiae [30]. Although abundant tubulin can be isolated from these sources, the purified proteins are composed of multiple tubulin isoforms and contain only those tubulin subpopulations with assembly competency [35, 37]. Moreover, these results are affected by the other proteins and cofactors that co-purify with native tubulins [27]. In addition, due to the difficulty in collecting enough E. granulosus for tubulin extraction, this simple and rapid purification method is not applicable in E. granulosus or E. multilocularis, which hinders the study of the MTs of this parasite.

Fortunately, there are reports on recombinant human tubulins [37] and helminth tubulins [20, 26] that could polymerize into MTs, indicating that recombinant MTs could be used for high-throughput screening. Hence, based on the previously reported tubulin genes of the parasite and the methods for expressing tubulin and determining the polymerization of the α/β-tubulin heterodimer, we conducted a study on the characteristics of E. granulosus tubulin genes and polymerization.

In this study, α- and β-tubulin of E. granulosus were expressed in Escherichia coli and purified, and these heterodimers were shown to polymerize into microtubule-like structures.

Materials and methods

RNA isolation and cDNA synthesis

Protoscoleces were isolated from cysts in the liver of sheep infected with E. granulosus (G1 strain, Qinghai, China). Then, total RNA was extracted with the RNeasy Mini Kit (Qiagen, USA) according to the manufacturer’s instructions, followed by reverse transcription using a first-strand cDNA synthesis kit (Toyobo, Japan).

Sequence amplification of full length α9- and β4-tubulins

The genes encoding E. granulosus α9- and β4-tubulin were amplified with ExTaq DNA polymerase (Takara, Japan) using gene-specific primers. For α9-tubulin, the forward primer was 5′–CGCGAGCTCATGCGTGAATGTATCAGTAT–3′ with a Sac I restriction site (in bold), and the reverse primer was 5′–AGCGGCCGCTTAGTACTCCTCGCCCTCTT–3′ with a Not I restriction site (in bold). For β4-tubulin, 5′–CGCGGATCCATGCGAGAGATAGTACACGTT–3′ and 5′–CCCAAGCTTTTATGCTTCTTCCTCT–3′ were used as the forward and reverse primers, containing BamH I and Hind III restriction sites (in bold), respectively. The PCR reaction mixture contained 1 μM each primer, 200 μM dNTP mixture, 1× PCR buffer and 0.5 units ExTaq DNA polymerase. PCR conditions were as follows: 5 min at 95 °C for denaturation; 35 cycles of amplification (40 s at 95 °C, 30 s at 60 °C/57 °C for α9-tubulin/β4-tubulin, 90 s at 72 °C); 10 min at 72 °C for extension. PCR products were separated on 1.2% agarose gels and purified with the Gel Extraction Kit (Qiagen, USA).

Expression of recombinant proteins

The purified PCR fragments were directly cloned into the pMD19-T vector (Takara, Japan) for TA cloning using the Mighty TA-Cloning Kit (Takara, Japan) and transformed into competent Escherichia coli DH5α cells (Tiangen, China), which were incubated at 37 °C overnight on a Luria-Bertani (LB) plate containing 100 μg/mL ampicillin (Sigma, USA). A single clone from each construct was selected and sequenced to ensure sequence fidelity. The verified α9- and β4-tubulin sequences were cut from the pMD19-T construct by double enzyme digestion and directionally ligated into the pET30a(+) vector (Novagen, USA), which had previously been digested with the same enzymes. Then, plasmid constructs (pET30a-α9 and pET30a-β4) were confirmed by double enzyme digestion with corresponding enzymes.

The pET30a-α9 and pET30a-β4 were finally transformed into competent BL21 (DE3) cells (Tiangen, China) using the heat shock method. The positive clones were selected and cultured in 2 L LB medium containing 50 μg/mL kanamycin until the mid-log phase. Expression was induced with 1 mM isopropyl-1-thio-β-D-galactopyranoside (IPTG) for 6 h at 37 °C/200 rpm. The cells were harvested at 8000 × g for 15 min, and the pellet was washed with phosphate buffer saline (PBS). The cells were centrifuged again and resuspended in lysis buffer (50 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, 0.5 mM PMSF, 0.1% Triton X-100, pH 7.4), disrupted by sonication. The inclusion bodies were collected by centrifugation at 12,000 × g, 4 °C for 20 min.

Purification of recombinant proteins

The inclusion bodies were dissolved in binding buffer (50 mM Tris-HCl, 300 mM NaCl, 10 mM imidazole, 8 M urea, pH 7.4), collected by centrifugation at 12,000 × g for 20 min at 4 °C and loaded onto an Ni2+ Sepharose column (GE Healthcare, USA) pre-equilibrated with the binding buffer. The column was subsequently washed with five column volumes of binding buffer, followed by washing buffer with a linear gradient of urea ranging from 8 M to 0 M. The refolded fusion protein was eluted with elution buffer (50 mM Tris-HCl, 300 mM NaCl, 500 mM imidazole, pH 7.4) and concentrated in an Amicon Ultra centrifugal filter (Millipore, USA). The concentration of recombinant protein was evaluated using a Bradford Kit (Tiangen, China).

Western blotting

The purified α9- or β4-tubulin protein was analysed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotting using anti-His antibody (CST, USA, #2366), anti-α-tubulin antibody (CST, USA, #3873) and anti-β-tubulin antibody (CST, USA, #2128) as primary antibodies; the PVDF membrane was blocked for 1 h and then incubated with a 1/1000 dilution of primary antibody at 4 °C for 4 h. The membranes were washed and then incubated with a 1/2500 dilution of anti-mouse (CST, USA, #7076) or anti-rabbit IgG antibody conjugated with HRP (CST, USA, #7074) as a secondary antibody at 4 °C overnight and then washed again. The ECL Kit (Tanon, China) was used to detect the proteins on the PVDF membrane.

Tubulin polymerization assay

Known concentrations of α9- and β4-tubulin were diluted with G-PEM buffer (80 mM PIPES, 2 mM MgCl2, 0.5 mM EGTA, 1 mM GTP, pH 6.9) to yield final tubulin concentrations of 0.25, 0.5, 1, 2, 3, and 4 mg/mL in a 40 μL reaction mixture. The reaction was carried out at 37 °C, and the OD value was measured at 350 nm every 30 s in a Synergy2 spectrophotometer (Biotek, USA).

Immunofluorescence and confocal microscopy

The mixture of 2 mg/mL α9- and β4-tubulin was allowed to polymerize for 1 h at 37 °C and centrifuged at 12,000 × g to collect polymerized tubulins. The samples were washed with PBS and centrifuged again. The pellet was fixed in 4% paraformaldehyde at room temperature for 1 h. After washing with PBS five times, the polymerized tubulins were blocked for 1 h at room temperature and incubated with a 1/150 dilution of mouse anti-α-tubulin/Alexa-Fluor 488 antibody (CST, USA, #8058) or anti-β-tubulin/Alexa-Fluor 647 antibody (CST, USA, #3624) at 4 °C overnight. Then, the samples were washed with TBST (1× TBS, 0.1% Tween 20) five times before observation under an A1R-si confocal microscope (Nikon, Japan).

Transmission electron microscopy (TEM)

Polymerized tubulins were collected for TEM analyses according to the method reported by Vulevic and Correia [38]. In brief, samples were suspended in 100 μL of PEM buffer (80 mM PIPES, 2 mM MgCl2, 0.5 mM EGTA, pH 6.9). A total of 30 μL polymerized samples were diluted with 10 μL of 0.4% glutaraldehyde for 1 min at room temperature, and 10 μL of tubulin solution was applied to a 200-mesh, copper/formvar coated grid for 1 min, washed using dH2O and stained for 10 min using 1% uranyl acetate. Finally, samples were air dried and viewed with a Tecnai G2 Spirit transmission electron microscope (FEI, USA).

Sequence analyses and homology modelling

Sequence analyses and alignments were performed using MEGA 6.0 (, BLAST/N ( and Clustal Omega ( Then, the homology model of the hetero α9- and β4-tubulin dimer was generated with HOMCOS (


Amplification of the α9- and β4-tubulin genes and plasmid construction

Echinococcus granulosus full-length α9- and β4-tubulin cDNAs were amplified; the amplicons contained 1356 bp and 1332 bp coding regions for α9- and β4-tubulin, respectively (Supplementary Table S1). The α9- and β4-tubulin genes were predicted to encode proteins with 451 and 443 amino acids, and the theoretical molecular masses were 50.17 kDa and 49.70 kDa (Figs. 13).

thumbnail Figure 1.

The cloning and expression of α9- and β4-tubulin. (a) The expression of α9- and β4-tubulin in E. coli BL21 (DE3). M: standard protein molecular weight marker, lane 1: negative control without induction, lane 2: induced control, lane 3: the supernatant after sonication, lane 4: the pellet after sonication, and lane 5: purified recombinant tubulin. (b) Western blot analysis. M: standard protein molecular weight marker, lane 1: α-tubulin, lane 2: β-tubulin.

Analyses of α9- and β4-tubulin sequences

The sequences of E. granulosus α9- and β4-tubulin were compared with other α- and β-tubulins from different organisms, which showed high degrees of homology (Figs. 2 and 3), especially in some highly conserved domains. As shown in Figure 2, the conserved tubulin acetylation site K40 was also found in E. granulosus α9-tubulin and the α-tubulins of humans, Hymenolepis microstoma, Haemonchus contortus, Schistosoma japonicum, and Toxoplasma gondii. The potential GTP-binding site in E. granulosus α9-tubulin was present at residues 140–146 (Figs. 2 and 4). In addition, the RGD motif, serving as a cell attachment sequence, was located at residues 320–322. A tyrosine is conserved in highly divergent C-terminal sequences and is involved in the post-translation modifications (PTMs) of tyrosination/detyrosination.

thumbnail Figure 2.

Sequence alignment of Echinococcus granulosus α9-tubulin and corresponding sequences from humans and parasites. The symbol “*” denotes the positions of amino acids that have a single, fully conserved amino acid residue; the symbol “:” denotes conservation between groups of amino acids with strongly similar properties; the symbol “.” denotes conservation between groups of amino acids with weakly similar properties; and the symbol “–” denotes gaps inserted to maximize sequence alignment. EgA9, E. granulosus α9; HuA6, human alpha 6 (119578461); HmA5, H. microstoma alpha 5 (674586714); HcA, H. contortus alpha tubulin (159155); SjA1, S. japonicum alpha 1–3 (226478902); and TgA, T. gondii alpha (161937).

thumbnail Figure 3.

The sequence alignment of Echinococcus granulosus β4-tubulin and corresponding sequences from humans and parasites. Symbol meanings are as in Figure 2. EgB4, E. granulosus β4-tubulin; EmB1, E. multilocularis Tub-1 gene (7838198); EmB2, E. multilocularis Tub-2 gene (7838200); EmB3, E. multilocularis Tub-3 gene (7838202); HuB3, human B3 (50592996); HuB4, human B4a (574584803); HmB2C, H. microstoma beta 2C (674589300); HcB1, H. contortus beta tubulin isotype 1 (124244617); SjB2, S. japonicum beta 2 (226467271); PfB, P. falciparum beta (160732).

thumbnail Figure 4.

Modelled structure of the polymerized Echinococcus granulosus α9- and β4-tubulin dimer based on PDB ID 4f6r.

Sequence alignment of E. granulosus β4-tubulin and β tubulins from other organisms indicated that E. granulosus β4-tubulin had conserved His6, Tyr50, Asn165, Ph167, Glu198, Tyr200, and Arg241 (Fig. 3). The potential GDP-binding site in E. granulosus β4-tubulin located at residues 138–146 was highly conserved in all groups (Figs. 3 and 4).

Expression and purification of recombinant α9- and β4-tubulin

Recombinant α94-tubulin was overexpressed mainly in inclusion bodies when E. coli BL21 (DE3) was induced with 1 mM IPTG. The purification yields of α9- and β4-tubulin were 2.0–3.0 mg/L and 3.5–5.0 mg/L of cell culture, respectively. Single protein bands with the expected molecular weight of α9-tubulin or β4-tubulin were found on SDS-PAGE gels (Fig. 1a). Furthermore, the recombinant protein was specifically recognized by commercial anti-His antibody, anti-α-tubulin antibody, and anti-β-tubulin antibody, which confirmed the successful expression of recombinant protein (Fig. 1b). The native α/β-tubulin of the E. granulosus protoscolex, which was in extremely low concentrations, was detected in Western blots by commercial anti-α- and anti-β-tubulin antibodies (Fig. 1b).

Polymerization of recombinant α9- and β4-tubulin

In this study, continuous A350 was recorded during polymerization of tubulin at different concentrations. An increase in absorbance was observed for the first 13–43 min, followed by a short initial lag period and a gradual levelling off (Fig. 5a). The optimum concentration of tubulin for polymerization was 2 mg/mL, and the curve is a typical polymerization curve that contains the nucleation, growth, and steady-state equilibrium phases of MT polymerization. By immunofluorescence, recombinant α9-tubulin and β4-tubulin were detected in polymerized tubulins (Fig. 5b), suggesting that these two tubulin isoforms could polymerize with each other under the proper conditions. In addition, the formation of a microtubule-like structure observed by electron microscopy again proved the polymerization of the tubulins (Fig. 5c).

thumbnail Figure 5.

The polymerization of Echinococcus granulosus α9- and β4-tubulin. (a) Spectrophotometric analysis of polymerization of E. granulosus α9- and β4-tubulin at different concentrations. (b) Confocal scanning laser micrographs of the polymerization product of recombinant tubulin showing immune reactivity to anti-α-tubulin/Alexa-Fluor 488 antibody and anti-β-tubulin/Alexa-Fluor 647 antibody. (I): Phase contrast view, (II): α-tubulin immuno-reactivity, (III): β-tubulin immune-reactivity. (c) The microtubule-like structure resulting from polymerization of pure expressed α9- and β4-tubulin under appropriate conditions in vitro.


MTs, which are built from α/β-tubulin heterodimers, play an important role in nearly all cellular and developmental processes of eukaryotic cells [23]. The E. granulosus α9- and β4-tubulin sequences reported in this study were retrieved from the publicly available E. granulosus genome data in the Sanger Database ( There are 14 proteins denoted as α-tubulin and 10 proteins denoted as β-tubulin in the genome data. We denominated these as E. granulosus α1- to α14-tubulin and β1- to β10-tubulin and analyzed the transcript levels of these sequences by real-time PCR. In both the cyst and protoscolex, α9-tubulin and β4-tubulin were highly expressed (unpublished data). Hence, α9- and β4-tubulins were selected for subsequent studies.

Previous analyses of tubulin sequences indicated that tubulins are generally highly conserved among species, but the C-termini are highly divergent [6]. Unsurprisingly, some conserved sites and domains were also found in E. granulosus α9- and β4-tubulin, such as the acetylation sites [16], GTP-binding sites and the RGD sequence [11]. As the best-characterized acetylation site on tubulin, K40 was also conserved in α9-tubulin. Many studies have shown that MT acetylation is not necessary for cell survival [9] and is considered to be a marker of MT stability [31]. At present, the acetylation of MTs has mainly been studied in protozoans, and it was concluded that K40 acetylation stabilizes MTs and is required for parasite replication [36], but no data are available for E. granulosus or E. multilocularis. Moreover, the highly divergent C-terminal domain of tubulin is related to tubulin polymerization and interactions with other factors and proteins. The C-terminal sequence of E. granulosus α9-tubulin was not fully conserved from other α-tubulins, but the last conserved tyrosine residue indicated that E. granulosus α9-tubulin can undergo enzymatic removal and re-addition as part of a detyrosination/tyrosination cycle [41], which affects microtubule-associated proteins (MAPs) that function in a wide range of biological processes [25]. In this study, E. coli was used to produce sufficient amounts of tubulins for MT polymerization experiments, but the shortcoming of this expression system is the lack of protein modification. Therefore, the subsequent study of tubulin modification will require the use of a eukaryotic expression system.

In addition to the modification site, the drug binding sites of β-tubulin are of interest. Mutations at positions 6, 50, 165, 167, 198, 200 and 241 are related to benzimidazole resistance in parasites, fungi, and plants [2, 15, 29]. The sequence alignment indicated that His6, Tyr50, and Glu198 are conserved in most tubulins, as shown in Figure 3. In H. contortus, the F200Y mutation is most often related to the resistance profile. Specifically, helminths susceptible to benzimidazole present Phe at position 200; thus, replacing Phe with Tyr may confer the resistant phenotype [14]. Until now, no BZ resistance in Echinococcus spp. has been reported, but the reported analyses of E. multilocularis tubulin sequences predicted sensitivity of EmTub-1 and Em Tub-3 and low binding affinity of Em Tub-2 (Tyr200) for BZs. In our study, F200 of E. granulosus β4-tubulin was identical to that found in humans, H. microstoma, H. contortus, and S. japonicum, while this residue was Gln in Plasmodium falciparum. The substitution at position 200 by other amino acids indicated less drug toxicity for humans [18] and the weak effects of BZs on some protozoans [12, 34] and Schistosoma spp. [32]. Furthermore, the multiple isoforms of E. granulosus make the understanding of these key amino acids and domains more complex.

At a threshold concentration, tubulins can assemble into MTs in vivo and in vitro under certain conditions, including warm temperatures, a pH of 6.4–6.7, GTP, EGTA, Mg2+ and glycerol [27]. In recent decades, tubulin has been identified as a key target for antitumour drugs, anthelminthics, and fungicides [19, 42]. The tubulin stabilizers and destabilizers can be distinguished by observing the tubulin polymerization profile [10]. Until now, in vitro functional analyses have been performed using native tubulin purified from the mammalian brain, which is rich in tubulin, metazoan sources, Tetrahymena thermophila, kinetoplastid parasites (Leishmania, Trypanosoma) and S. cerevisiae [30]. However, there are still some drawbacks to the use of native tubulin. For example, the purified native tubulins were contaminated by their counterparts, such as MAPs and MT motor proteins [27]; furthermore, it is difficult to separate different tubulin isoforms, which may be non-uniformly distributed [21, 24]. In addition, the large-scale growth of kinetoplastid parasites makes it possible to harvest samples for purification of assembly competent tubulins, while the large-scale culture of E. granulosus or E. multilocularis free from host cells is difficult. Hence, the expression and purification of recombinant E. granulosus α9- and β4-tubulin was carried out in our study.

Western blotting analysis of total protein extracted from protoscoleces (Fig. 1b) showed that α- and β-tubulin concentrations were very low in parasites, which makes it technically challenging to isolate enough assembly-competent tubulin for in vitro studies. Early studies reported that recombinant tubulin was capable of polymerization into a microtubule-like structure [26, 37], which indicates that the high-yield recombinant tubulin can replace native tubulin for high-throughput experiments. Recombinant tubulins can be individually expressed in either a prokaryotic expression system or a eukaryotic expression system [26, 27, 37]. Recombinant neuronal human tubulin was expressed in SF9 cells, with the final yield of tubulin being 1 mg/L of culture [37], which is lower than that expressed in the prokaryotic expression system [26, 27]. In our study, two tubulin isoforms from the parasitic tapeworm E. granulosus were expressed in a prokaryotic expression system. The average yields of α9- and β4-tubulin were 2.0–3.0 mg/L and 3.5–5.0 mg/L of culture, respectively. SDS-PAGE analyses of induced bacteria cells demonstrated that α9- and β4-tubulins were all overexpressed mainly as inclusion bodies, which was consistent with other reports of parasite tubulins [11, 20, 27]. We previously optimized the induction conditions to maximize the solubility of recombinant proteins (α9- and β4-tubulins) in E. coli [40]. The optimized approaches include a low inducer concentration and a low cell cultivation temperature [33]. However, all these strategies still resulted in poor protein yield. To obtain sufficient amounts of tubulins for in vitro studies, the inclusion bodies should be washed and refolded in an appropriate buffer to harvest the active proteins, which is referred to as the urea-alkaline method [20, 22] and the on-column refolding method [11, 13]. In the present study, the inclusion bodies were collected, purified and refolded using nickel affinity chromatography, which is a modified version of methods developed by Jang and Kalme [11] and Koo et al. [13]. Moreover, it is a much simpler and more efficient way to harvest active proteins than using phosphocellulose [26, 27]. The purified recombinant α9- and β4-tubulins were of high purity (Fig. 1a) and free of other proteins [13]. TEM analysis showed that the purified tubulins were capable of polymerizing into microtubule-like structures using a standard dimerization assay, as previously reported [11, 13, 27]. The TEM results confirmed that purified recombinant tubulins could polymerize with typical long microtubule-like structures, which further implied that the modified techniques developed in our laboratory for purification of recombinant tubulin are effective and efficient. However, although the polymerization profile of α9- and β4-tubulins was demonstrated in our study, MTs were predicted to consist of multiple isoforms that could have distinct MT polymerization dynamics, functions, and interactions with MAPs and compounds. Hence, more research is needed in the future.


In the present study, two tubulin isoforms were successfully cloned and purified and were capable of polymerizing into microtubule-like structures that can be used to screen anti-mitotic drugs, as reported in H. contortus [27]. In the future, these tubulins from E. granulosus can be used as a tool for high-throughput screening of new drugs or lead compounds against E. granulosus. In addition, it will be possible to observe whether the activity of BZs inhibits the polymerization of purified tubulin from E. granulosus to better understand the modes of action of these therapeutic compounds.


This work was supported by grants from the National Natural Science Foundation of China (No. 81401691 & No. 81702030) and the General Program of Shanghai Municipal Health Commission (No. 201540170).

Conflict of interest statement

The authors declare that they have no conflicts of interest in relation to this article.

Author contributions

Conceived and designed the experiments: C.L. and H.Z.; Performed the experiments: J.Y., J.Y. and J.X.; Wrote the paper: C.L. and J. Y.


  1. Brehm K, Koziol U. 2014. On the importance of targeting parasite stem cells in anti-echinococcosis drug development. Parasite, 21, 72. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  2. Brehm K, Kronthaler K, Jura H, Frosch M. 2000. Cloning and characterization of beta-tubulin genes from Echinococcus multilocularis. Molecular and Biochemical Parasitology, 107, 297–302. [CrossRef] [PubMed] [Google Scholar]
  3. Brunetti E. 2017. Cystic echinococcosis. Journal of Clinical Microbiology, 54, 518. [Google Scholar]
  4. Budke CM, Deplazes P, Torgerson PR. 2006. Global socioeconomic impact of cystic echinococcosis. Emerging Infectious Diseases, 12, 296–303. [CrossRef] [PubMed] [Google Scholar]
  5. Desai A, Mitchison TJ. 1997. Microtubule polymerization dynamics. Annual Review of Cell and Developmental Biology, 13, 83–117. [CrossRef] [PubMed] [Google Scholar]
  6. Gadadhar S, Bodakuntla S, Natarajan K, Janke C. 2017. The tubulin code at a glance. Journal of Cell Science, 130, 1347–1353. [CrossRef] [PubMed] [Google Scholar]
  7. Gemmell MA, Roberts MG, Beard TC, Lawson JR, Eckert J, Gemmell MA, Meslin FX, Pawłowski ZS. 2001. WHO/OIE manual on echinococcosis in humans and animals: A public health problem of global concern. International Journal of Parasitology, 31, 1717–1718. [CrossRef] [Google Scholar]
  8. Goodson HV, Jonasson EM. 2018. Microtubules and microtubule-associated proteins. Cold Spring Harbor Perspectives in Biology, 10. pii: a022608. [Google Scholar]
  9. Hammond JW, Cai D, Verhey KJ. 2008. Tubulin modifications and their cellular functions. Current Opinion in Cell Biology, 20, 71–76. [CrossRef] [PubMed] [Google Scholar]
  10. Heard P, Ackerman J, Coffing S, Dobo K, Schuler M. 2017. Fluorescent tubulin polymerization assay to characterize moa of genotoxic compounds – A validation study. Journal of Pharmacological and Toxicological Methods, 85, 89. [Google Scholar]
  11. Jang MH, Kalme JK. 2008. Cloning, purification, and polymerization of Capsicum annuum recombinant alpha and beta tubulin. Bioscience, Biotechnology, and Biochemistry, 72, 1048–1055. [CrossRef] [PubMed] [Google Scholar]
  12. Katiyar SK, Gordon VR, McLaughlin GL, Edlind TD. 1994. Antiprotozoal activities of benzimidazoles and correlations with beta-tubulin sequence. Antimicrobial Agents and Chemotherapy, 38, 2086–2090. [CrossRef] [PubMed] [Google Scholar]
  13. Koo BS, Kalme S, Yeo SH, Lee SJ, Yoon MY. 2009. Molecular cloning and biochemical characterization of alpha- and beta-tubulin from potato plants (Solanum tuberosum L.). Plant Physiology and Biochemistry, 47, 761–768. [CrossRef] [Google Scholar]
  14. Kwa MS, Veenstra JG, Roos MH. 1994. Benzimidazole resistance in Haemonchus contortus is correlated with a conserved mutation at amino acid 200 in beta-tubulin isotype 1. Molecular and Biochemical Parasitology, 63, 299–303. [CrossRef] [PubMed] [Google Scholar]
  15. Kwa MS, Veenstra JG, Van DM, Roos MH. 1995. Beta-tubulin genes from the parasitic nematode Haemonchus contortus modulate drug resistance in Caenorhabditis elegans. Journal of Molecular Biology, 246, 500–510. [CrossRef] [PubMed] [Google Scholar]
  16. L’Hernault SW, Rosenbaum JL. 1985. Chlamydomonas alpha-tubulin is posttranslationally modified by acetylation on the epsilon-amino group of a lysine. Biochemistry, 24, 473–478. [CrossRef] [PubMed] [Google Scholar]
  17. Lacey E. 1990. Mode of action of benzimidazoles. Parasitology Today, 6, 112–115. [CrossRef] [Google Scholar]
  18. Lewis SA, Lee MG, Cowan NJ. 1985. Five mouse tubulin isotypes and their regulated expression during development. Journal of Cell Biology, 101, 852–861. [CrossRef] [Google Scholar]
  19. Li W. 2012. Drugs targeting tubulin polymerization. Pharmaceutical Research, 29, 2939–2942. [CrossRef] [PubMed] [Google Scholar]
  20. Lubega GW, Geary TG, Klein RD, Prichard RK. 1993. Expression of cloned beta-tubulin genes of Haemonchus contortus in Escherichia coli: Interaction of recombinant beta-tubulin with native tubulin and mebendazole. Molecular and Biochemical Parasitology, 62, 281–292. [CrossRef] [PubMed] [Google Scholar]
  21. Ludueña RF. 2013. A hypothesis on the origin and evolution of tubulin. International Review of Cell and Molecular Biology, 302, 41–185. [CrossRef] [PubMed] [Google Scholar]
  22. Marston FA. 1986. The purification of eukaryotic polypeptides synthesized in Escherichia coli. Biochemical Journal, 240, 1–12. [CrossRef] [Google Scholar]
  23. McManus DP, Zhang W, Li J, Bartley PB. 2003. Echinococcosis. Lancet, 362, 1295–1304. [CrossRef] [PubMed] [Google Scholar]
  24. Murphy DB. 1991. Functions of tubulin isoforms. Current Opinion in Cell Biology, 3, 43–51. [CrossRef] [PubMed] [Google Scholar]
  25. Nieuwenhuis J, Brummelkamp TR. 2018. The tubulin detyrosination cycle: Function and enzymes. Trends in Cell Biology. pii: S0962-8924(18)30141-7. doi: 10.1016/j.tcb.2018.08.003. [Google Scholar]
  26. Oxberry ME, Gear TG, Prichard RK. 2001. Assessment of benzimidazole binding to individual recombinant tubulin isotypes from Haemonchus contortus. Parasitology, 122, 683–687. [CrossRef] [PubMed] [Google Scholar]
  27. Oxberry ME, Geary TG, Winterrowd CA, Prichard RK. 2001. Individual expression of recombinant α- and β-tubulin from Haemonchus contortus: Polymerization and drug effects. Protein Expression and Purification, 21, 30–39. [CrossRef] [PubMed] [Google Scholar]
  28. Reuter S, Jensen B, Buttenschoen K, Kratzer W, Kern P. 2000. Benzimidazoles in the treatment of alveolar echinococcosis: A comparative study and review of the literature. Journal of Antimicrobial Chemotherapy, 46, 451–456. [CrossRef] [Google Scholar]
  29. Roos MH, Kwa MSG, Grant WN. 1995. New genetic and practical implications of selection for anthelmintic resistance in parasitic nematodes. Parasitology Today, 11, 148–150. [CrossRef] [Google Scholar]
  30. Sackett DL, Werbovetz KA, Morrissette NS. 2010. Isolating tubulin from nonneural sources. Methods in Cell Biology, 95, 17–32. [CrossRef] [PubMed] [Google Scholar]
  31. Sadoul K, Khochbin S. 2016. The growing landscape of tubulin acetylation: Lysine 40 and many more. Biochemical Journal, 473, 1859–1868. [CrossRef] [PubMed] [Google Scholar]
  32. Schmidt J. 1998. Effects of benzimidazole anthelmintics as microtubule-active drugs on the synthesis and transport of surface glycoconjugates in Hymenolepis microstoma, Echinostoma caproni, and Schistosoma mansoni. Parasitology Research, 84, 362–368. [CrossRef] [PubMed] [Google Scholar]
  33. Singha TK, Gulati P, Mohanty A, Khasa YP, Kapoor RK, Kumar S. 2017. Efficient genetic approaches for improvement of plasmid based expression of recombinant protein in Escherichia coli: A review. Process Biochemistry, 55, 17–31. [CrossRef] [Google Scholar]
  34. Skinner-Adams TS, Davis TM, Manning LS, Johnston WA. 1997. The efficacy of benzimidazole drugs against Plasmodium falciparum in vitro. Transactions of the Royal Society of Tropical Medicine and Hygiene, 91, 580–584. [CrossRef] [PubMed] [Google Scholar]
  35. Sullivan KF, Cleveland DW. 1986. Identification of conserved isotype-defining variable region sequences for four vertebrate beta tubulin polypeptide classes. Proceedings of the National Academy of Sciences of the United States of America, 83, 4327–4331. [CrossRef] [PubMed] [Google Scholar]
  36. Varberg JM, Padgett LR, Arrizabalaga G, Sullivan WJ Jr. 2016. TgATAT-mediated alpha-tubulin acetylation is required for division of the protozoan parasite Toxoplasma gondii. mSphere, 1. pii: e00088–15. [Google Scholar]
  37. Vemu A, Atherton J, Spector JO, Szyk A, Moores CA, Roll-Mecak A. 2016. Structure and dynamics of single-isoform recombinant neuronal human tubulin. Journal of Biological Chemistry, 291, 12907–12915. [CrossRef] [Google Scholar]
  38. Vulevic B, Correia JJ. 1997. Thermodynamic and structural analysis of microtubule assembly: The role of GTP hydrolysis. Biophysical Journal, 72, 1357–1375. [CrossRef] [PubMed] [Google Scholar]
  39. Werbovetz KA. 2002. Tubulin as an antiprotozoal drug target. Mini Reviews in Medicinal Chemistry, 2, 519–529. [CrossRef] [PubMed] [Google Scholar]
  40. Yao JQ, Liu CS, Xue J, Tao Y, Zhang HB. 2018. Soluble expression, purification and bioinformatics analysis of beta4-tubulin of Echinococcus granulosus protoscoleces. Chinese Journal of Parasitology and Parasitic Diseases, 36, 231–237. [Google Scholar]
  41. Yu I, Garnham CP, Rollmecak A. 2015. Writing and reading the tubulin code. Journal of Biology Chemistry, 290, 17163–17172. [CrossRef] [Google Scholar]
  42. Zhou Y, Xu J, Zhu Y, Duan Y, Mingguo Z. 2016. Mechanism of action of the benzimidazole fungicide on Fusarium graminearum: Interfering with polymerization of monomeric tubulin but not polymerized microtubule. Phytopathology, 106, 807. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Liu C, Yao J, Yin J, Xue J & Zhang H. 2018. Recombinant α- and β-tubulin from Echinococcus granulosus: expression, purification and polymerization. Parasite 25, 62.

Availability of data and materials

Supplementary Table S1

All data generated or analysed during this study are included in this published article and in the Supplemental file 1. (Access here)

All Figures

thumbnail Figure 1.

The cloning and expression of α9- and β4-tubulin. (a) The expression of α9- and β4-tubulin in E. coli BL21 (DE3). M: standard protein molecular weight marker, lane 1: negative control without induction, lane 2: induced control, lane 3: the supernatant after sonication, lane 4: the pellet after sonication, and lane 5: purified recombinant tubulin. (b) Western blot analysis. M: standard protein molecular weight marker, lane 1: α-tubulin, lane 2: β-tubulin.

In the text
thumbnail Figure 2.

Sequence alignment of Echinococcus granulosus α9-tubulin and corresponding sequences from humans and parasites. The symbol “*” denotes the positions of amino acids that have a single, fully conserved amino acid residue; the symbol “:” denotes conservation between groups of amino acids with strongly similar properties; the symbol “.” denotes conservation between groups of amino acids with weakly similar properties; and the symbol “–” denotes gaps inserted to maximize sequence alignment. EgA9, E. granulosus α9; HuA6, human alpha 6 (119578461); HmA5, H. microstoma alpha 5 (674586714); HcA, H. contortus alpha tubulin (159155); SjA1, S. japonicum alpha 1–3 (226478902); and TgA, T. gondii alpha (161937).

In the text
thumbnail Figure 3.

The sequence alignment of Echinococcus granulosus β4-tubulin and corresponding sequences from humans and parasites. Symbol meanings are as in Figure 2. EgB4, E. granulosus β4-tubulin; EmB1, E. multilocularis Tub-1 gene (7838198); EmB2, E. multilocularis Tub-2 gene (7838200); EmB3, E. multilocularis Tub-3 gene (7838202); HuB3, human B3 (50592996); HuB4, human B4a (574584803); HmB2C, H. microstoma beta 2C (674589300); HcB1, H. contortus beta tubulin isotype 1 (124244617); SjB2, S. japonicum beta 2 (226467271); PfB, P. falciparum beta (160732).

In the text
thumbnail Figure 4.

Modelled structure of the polymerized Echinococcus granulosus α9- and β4-tubulin dimer based on PDB ID 4f6r.

In the text
thumbnail Figure 5.

The polymerization of Echinococcus granulosus α9- and β4-tubulin. (a) Spectrophotometric analysis of polymerization of E. granulosus α9- and β4-tubulin at different concentrations. (b) Confocal scanning laser micrographs of the polymerization product of recombinant tubulin showing immune reactivity to anti-α-tubulin/Alexa-Fluor 488 antibody and anti-β-tubulin/Alexa-Fluor 647 antibody. (I): Phase contrast view, (II): α-tubulin immuno-reactivity, (III): β-tubulin immune-reactivity. (c) The microtubule-like structure resulting from polymerization of pure expressed α9- and β4-tubulin under appropriate conditions in vitro.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.