Open Access
Original contribution
Volume 19, Number 4, November 2012
Page(s) 381 - 387
Published online 15 November 2012

© PRINCEPS Editions, Paris, 2012, transferred to Société Française de Parasitologie

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.


Bed bugs (Cimex lectularius L.) are cosmopolite hematophagous insects responsible for a challenging and re-emerging indoor pest in many countries around the world (Hwang et al., 2005; Gangloff-Kaufmann et al., 2006; Doggett & Russell, 2009; Levy Bencheton et al., 2010; Tawatsin et al., 2011). The present resurgence can probably be attributed to factors such as increased international travel and development of resistance against pesticides (Reinhardt & Siva-Jothy, 2007; Mouchtouri et al., 2008; Dogget & Russell, 2009). Bed bugs infestations may have health consequences including nuisance biting, which can provoke discomfort and anxiety, and cutaneous and systemic reactions (Delaunay et al., 2009; 2011; Goddard & de Shazo, 2009). Although bed bugs can harbor over 45 pathogens, there is no scientific evidence that they are involved in disease transmission (Delaunay et al., 2011). Recently, bed bugs were reported carrying drug-resistant bacteria (Lowe & Romney, 2011).

Reactions to insect bites, inconvenience, and psychological distress have been the basis for lawsuits against landlords and lodging industry. Bed bugs impact tourism and means of transportation, this latter being a factor that contributes to the spread of infestations. Economic implications are also substantial for the residents and the management office of infested buildings. Due to their ability to hide in cracks and crevices and to survive without feeding over several months, bed bugs are hard to control, and often require more than one intervention. Although physical control measures such as heat, steam, vacuuming are important in integrated pest management programs for bed bugs, control of this pest mostly relies on the application of insecticides in their environment. The most widely used insecticides are the pyrethroids and the organophosphates. Nevertheless, insecticide resistance in bed bugs appears to increase dramatically in the USA and other parts of the world (Boase & Naylor, 2006; Moore & Miller, 2006; Romero et al., 2007; Yoon et al., 2008; Kilpinen et al., 2011). Reports of pyrethroids resistance remain rare in Europe (Boase et al., 2006; Kilpinen et al., 2011). The determination of resistance status of bed bugs is usually performed by topical application tests or tarsal exposure tests. V419L and L925I mutations in a voltage-gated sodium channel a-subunit gene of Cimex lectularius, have also been used as molecular marker of resistance to pyrethroids in a few studies (Yoon et al., 2008; Seong et al., 2010; Zhu et al., 2010).

In France, there is limited information on the status of resistance of bed bugs to pyrethroids. Private pest control practitioners and municipalities report soaring number of calls from individuals or institutions. We evaluated the infestation by bed bugs in a complex of two buildings in the suburb of Paris and assessed their susceptibility to pyrethroid insecticides, using mortality bioassay and molecular methods. The study aimed to contribute to the management of the infestation in these buildings.

Materials and Methods

Study Site

The study took place from February to June 2011 in Saint-Ouen, a city bordering the north of Paris. Various ethnic communities are represented among the 45,600 inhabitants of this city. The rate of social housing in the city reaches 45 %. The study site was two 16-story apartment buildings, separated by 30 meters, located in the south of Saint-Ouen. The buildings have 198 apartments (102 in building A and 96 in building B), ranging from one to six rooms. At time of the study, the buildings harboured 473 residents (288 in building A and 185 in building B).

The residents of the building complex complained vigorously to the management office due to heavy and long lasting infestations (for several years according to the management office) of their housing by bed bugs. The owner of the place called the Regional Health Agency to find out an answer to the problem. Our laboratory was contacted by the Regional Health Agency to evaluate the level of infestation and the inconvenience for residents, and to test the susceptibility to pyrethroid insecticides that were occasionally used in the site.

Survey of the Bed Bugs Infestation

A newsletter about the study has been sent to all residents of both towers. Visual inspection by trained staff and resident interviews were performed about the history of the infestation, past control efforts, and resident awareness of bed bugs in their apartments. The duration of inspection of the apartments varied from around 30 min for the smallest to more than two hours for the largest. The beds, sofas, other upholstered furniture, wheelchairs, perimeter of the doors, curtains, and boxes stored under the beds or in the closets were closely inspected. Beds were disassembled if possible for inspection.

Collection of Insects

All bed bugs (except the egg stage) were handremoved with flexible forceps (to not harm them) during inspections, and placed in 5 mL haemolysis vial together with a piece of folded bound paper, representing an artificial shelter to avoid excessive mortality of bed bugs in the following hours.

Mortality Bioassay

The number of bed bugs tested varied according to the level of infestation of the apartments. When less than ten insects were collected from an apartment, all bed bugs were submitted to the effects of a pyrethroid insecticide. When more than ten insects were collected from an apartment, the sample was divided in two halves; one half of bed bugs was submitted to the effects of a pyrethroid insecticide and the other half was placed in contact with isotonic sodium chloride solution as a control. A standardized method for ex vivo assessment of efficacy of insecticide products was used as previously described (Chosidow et al., 1994). Briefly, Whatman grade n°1 filter papers of 8.5 cm diameter were impregnated with 0.5 mL of a lotion containing a combination of two pyrethroids, Neopynamine and Sumithrin, at a concentration of 2.69 g.L-1 for each compound (commercially available as A-PAR®, Omega Pharma, Châtillon, France). Impregnated papers, containing 474 mg of both active ingredients/m2, were placed in Petri dishes of the same diameter and non-injured alive bed bugs were placed onto impregnated paper and trapped within the closed Petri dishes. The impregnated papers were not allowed to dry out before the test. Isotonic sodium chloride solution was used to impregnate Whatman filter paper as control group. Bed bugs were maintained in an incubator at 24 ± 2 °C and 55-65 % relative humidity. Bed bugs were examined for activity under a binocular loupe one hour and 24 h after insecticide or isotonic sodium chloride solution exposure. Bed bugs were judged as «dead» if there were no vital signs or minor vital signs present (merely internal gut movements, movements of antennae, minimal leg movements with or without stimulation by a forceps).

DNA Extraction

Adult bed bugs were individually processed for DNA extraction according to the following procedure. Each bed bug was cut in four pieces using a sterile scalpel. One of these pieces was placed in a sterile microfuge tube, incubated at 65 °C for 15 min and crushed using Tissue Lyser π(Qiagen, Germany) for 8 min at 30 Hz frequency. The sample was homogenized in 180 μL of buffer ATL and 20 μL of proteinase K (QIAamp DNA Mini Kit, Qiagen, Courtaboeuf, Germany), vortexed for 20 s and then incubated for three hours at 56 °C. Further steps were done according to the manufacturer’s instructions.

Genotyping of KDR-Like Gene

The amplification of 474-bp and 744-bp portions of the voltage sensitive sodium channel-subunit gene (kdr-like gene) spanning the codon 419 (fragment 1) and 925 (fragment 2) respectively was performed on 2 μL of DNA solution under the following conditions. In a 25 μL reaction mixture containing 0.3 μmol/L of each primer: 5’AACCTGGATATACATGCCTTCAAGG3’ (forward) and 5_TGATGGAGATTTTGCCACTGATG3_ (reverse) for fragment 1; 5_GGAATTGAAGCTGCCATGAAGTTG3_ (forward) and 5_TGCCTATTCTGTCGAAAGCCTCAG3_ (reverse) for fragment 2, 200 μmol/L dNTPs, buffer (50 mmol/L KCl, 10 mmol/L Tris-HCl, pH 8.3, and 1 mmol/L MgCl2), and 2.5 U of Thermus aquaticus DNA polymerase (AmpliTaq Gold; PerkinElmer Life and Analytical Sciences, Boston, MA). The sample was incubated for 10 min at 95 °C for denaturation before cycles (94 °C × 40 s, 52 °C × 40 s (fragment 1) / 55 °C × 40 (fragment 2), and 72 °C × 40 s). After 40 cycles, primer extension was continued for 10 min at 72 °C. PCR products purification and DNA sequencing were performed by the Qiagen laboratory (Qiagen, Courtaboeuf, Germany). Electrophoregrams were visualized and analyzed with the Auto assembler program (Applied Biosystem). The obtained sequences were compared with wild-type sequences (GenBank accession numbers, GU123927 and GU123928). The presence of single nucleotide polymorphisms (V419K and L925I) was confirmed by reading both forward and reverse strands.

Ethics Statement

The agreement and the authorization of the owner of the place were obtained for the study. No consent from the residents was required for this study. The residents of this social housing had a legal obligation to participate in the program of bed bugs eradication.


Survey of the Bed Bug Infestations

In all, 99 out of 102 apartments have been visited in building A and 93 out of 96 in building B (Table I). In building A, 24 apartments had live bed bugs (Fig. 1). Obvious clues of a current or past presence of bed bugs (excreta of bed bugs on a mattress for example) were found in 35 other apartments in which no bed bug have been found during the inspection (Fig. 2). 90 residents lived in infested apartments. Among them, 49 (54.4 %) reported bed bugs bites (Fig. 3). 38 residents (42.2 %) lived in infested apartments but did not notice bites. Three other subjects (3.4 %) lived alone in an infested apartment and thus were considered as being “insensitive” to bites. In building B, only two apartments had live bed bugs. Obvious clues of a current or past presence of bed bugs were found in 15 other apartments in which no bed bug have been found during the inspection. Only seven residents lived in infested apartments: four (57 %) complained about bed bugs biting and three (43 %) did not notice bites. In summary, the complex of buildings was heavily infested: 39.6 % of apartments (59.6 % of inspected apartments in building A and 18.3 % in building B) harbored bed bugs during inspection or in a recent past.

thumbnail Fig. 1.

Adult bed bugs and excreta in a flat.

thumbnail Fig. 2.

Bed bugs excreta on a mattress.

thumbnail Fig. 3.

Lesions on a human arm caused by bed bugs bites.

Table 1.

Infestation of the two buildings by bed bugs.

Collection of Insects

A total of 548 and 16 bed bugs of all stages (except eggs) were collected in infested units of building A and B, respectively. The number of insects collected varied according to apartments from only one to more than 30. Despite our precautions, 294 bed bugs were dead before their inclusion in insecticide resistance tests, which were performed within 12 hours after collection.

Mortality Bioassay

Only adult bed bugs were selected for the test. In all, 215 bed bugs were submitted individually to the test. Seventy-two bed bugs were used as controls, of which only one was dead at the end of the test. Among the 143 bed bugs exposed to insecticide, 54 (37.8 %) were reported as resistant (95 % confidence interval: 29.9-45.7 %) and 89 (62.2 %) were susceptible (95 % confidence interval: 54.3-70.1 %). Most resistant bed bugs (37 out 54) were collected in two highly infested apartments. Eight apartments harbored at least one resistant bed bug.

Genotyping of KDR-Like Gene

The DNA of all 143 bed bugs that have been exposed to insecticide during the mortality bioassay was extracted. Both parts of kdr-like gene encompassing codons 419 and 925 were successfully amplified and sequenced for 124 bed bugs (Fig. 4), corresponding to 75 susceptible and 49 resistant bed bugs according to the bioassays. All sequenced bed bugs had homozygous wild-type V419 codon and homozygous mutated L925I codon of kdr-like gene.

thumbnail Fig. 4.

A: alignment of a part of the sequence of the voltage-gated sodium channel a-subunit gene, encompassing codon 419 (highlighted in yellow), from a pyrethroid-susceptible bed bug [Genbank access number: GU123927] and 124 adult bed bugs collected in the study. Nucleotides identical to those of the GU123927 sequence are indicated by periods; B: alignment of a part of the sequence of the voltagegated sodium channel a-subunit gene, encompassing codon 925 (highlighted in yellow), from a pyrethroid-susceptible bed bug [Genbank access number: GU123928] and 124 adult bed bugs collected in the study. Nucleotides identical to those of the GU123928 sequence are indicated by periods.


The complex of buildings appeared heavily infested with about 40 % of infested apartments in mean. This prevalence did not necessarily reflect the situation in the whole city of Saint-Ouen or other cities around Paris. This prevalence was comparable to that found (45 %) in a recently published study which was performed in a 15-story tower of Indianapolis, USA, including 223 one-bedroom apartments (Wang et al., 2010). Building A was much more infested than building B, though both buildings were located in a very similar environment. We can hypothesize that building A was infested earlier than building B, which could explain the larger spreading of bed bugs in the first tower. Other factors may also intervene as both towers were not identical in terms of distribution of apartments. Thus, building A harboured a great number of large families with relatively low income in vast apartments. Building B had more small apartments, harboring couples or families of less than five persons. The apartments of building B had also a better aspect (maintenance, cleanness, tidying up). We can only assume the origin of the infestation. It seemed that many residents bought second-hand furniture in the flea market of Saint-Ouen, a globally renowned market including second-hand furniture stores, located at only two hundred meters of the complex building. Those furnitures are suspected to frequently carry over bed bugs in new housings.

During the study, we have inspected 192 apartments out of 198 (97 %) of the complex building and interviewed their residents. There was no empty flat in the complex building but a few residents were repeatedly absent or could not be reached. Others refused obstinately to participate despite a notification of legal obligation. Residents have been interviewed in almost all apartments. Among residents living in infested apartments, more than a half complained about bed bugs bites. Some residents developed more important reactions than others (Fig. 3) but there was no report of severe clinical signs to our knowledge. Bed bugs bite at night when their hosts are sleeping. The usual response to a bed bug bite appears to be no reaction with a barely visible punctum at the location of the bite (Delaunay et al., 2011). Otherwise, cutaneous reactions may vary from none to bullous rashes but the common dermatological presentations are 2- to 5-mm itchy maculopapular, erythematous lesions. Lesions usually resolve spontaneously within two-six weeks. Thus, bed bug bites may have been unnoticed by residents and the number of individuals living in infested apartments and who were considered as not bited was probably overestimated. Conversely, bites of other origin (mosquitoes or fleas for example) could have been misleading in some occasions.

Bioassays showed that pyrethroids resistant bed bugs were present in many apartments. Pest control operators rarely use pyrethroid insecticides in Paris and its suburb. They use mostly carbamate compounds as bendiocarb (Ficam W®, Bayer Environmental Science, Lyon, France). These products are sold only to professional pest control operators. Four applications of bendiocarb were done by pest control operators in the buildings within two years before we collected bed bugs. Those applications were single treatment, separated by six months in mean. Conversely, private individuals frequently use pyrethroid insecticides, which are easily available in stores. As a result, pyrethroid insecticides are often improperly used in terms of concentrations and number of applications, which may induce unnecessary insecticide pressure to bed bugs and other pests.

Contrary to other studies, we have performed bioassays directly on bed bugs collected on the field, and not in adapted colonies fed several weeks or months in the laboratory. Thus, the experiments on insecticide resistance were performed in a quasi real-world setting that approximates what residents and bedbugs would experience. The spontaneous mortality of bed bugs observed within 12 hours after their capture was high (52.1 %). This could be due to unnoticed injuries or stresses done during the capture and/or transportation to our laboratory. Previous aggressions of bed bugs may have also be done before their capture (insecticides or other means of control). This relative fragility of bed bugs may have led to an overestimation of the activity of pyrethroids. Using tarsal exposure test to commercial formulations of permethrin and deltamethrin, Kilpinen et al. reported recently high resistance rates in bed bugs populations collected in private homes in Denmark and fed on a human volunteer 1-2 weeks before testing (Kilpinen et al., 2011). These data and ours showed that resistance to pyrethroids is present in at least two distant countries in Europe. As pyrethroids are among the most widely used insecticides by people against bed bugs in France and other countries, these results are worrying.

An identical kdr-like gene haplotype, homozygous mutated L925I codon and homozygous wild-type V419 codon, was found in all bed bugs. This haplotype corresponded to bed bugs reported as resistant according to previous studies (Yoon et al., 2008; Seong et al., 2010; Zhu et al., 2010). To our knowledge, our data are the only results of genotyping of Cimex lectularius kdr-like gene in Europe. This haplotype was already found by Zhu et al. in bed bug populations collected in 2006 and 2007 in various cities of USA (haplotype B) (Zhu et al., 2010). Using bioassays, those authors evaluated the susceptibility to deltamethrin of three bed bugs populations having this haplotype, which revealed a resistant status. Our data showed less clear-cut association with bioassays results with 38 % of resistant bed bugs. Contrary to previous studies, we exposed bed bugs to an association of two pyrethroids, which may have enhanced the apparent insecticide activity. In addition, the proportion of susceptible bed bugs may have been overestimated due to the poor general condition of some of the collected insects, though bed bugs exposed to isotonic sodium chloride solution as control groups did not reveal such spontaneous mortality during the test. The V419L mutation could play a role in pyrethroid resistance, but less than the L925I mutation which has been selected more intensively than the V419L mutation and which probably plays a central role in resistance to pyrethroids (Seong et al., 2010). Resistance to pyrethroids was not always associated with the V419L mutation in populations from the USA and this mutation was not always associated with the L925I mutation to form a resistant haplotype (Yoon et al., 2008; Seong et al., 2010). The bed bugs tested in our series presented a genomic resistance to pyrethroids by possessing the L925I mutation at a fixation rate. Further studies are required to know whether bed bugs having both mutations are more resistant or not than those having only the L925I mutation. Nevertheless, our results advocated to not recommend the use of pyrethroids as insecticide for the control and eradication of bed bugs in this site. Results of the present study showed the presence of pyrethroids resistance in the site and warrant to monitor the susceptibility to insecticides of bed bugs in the future.


We thank Catherine Netter and staff, ville de Saint- Ouen, for valuable assistance


  1. Boase C.S.G. & Naylor R. Interim report on insecticide susceptibility status of UK bedbugs. Prof Pest Control Summer, 2006, 12–13. [Google Scholar]
  2. Chosidow O., Chastang C., Brue C., Bouvet E., Izri M., Monteny N., Bastuji-Garin S., Rousset J.J. & Revuz J. Controlled study of malathion and d-phenothrin lotions for Pediculus humanus var capitis-infested schoolchildren. Lancet, 1994, 344, 1724–1727. [CrossRef] [PubMed] [Google Scholar]
  3. Delaunay P., Blanc V., Dandine M., Del Giudice P., Franc M., Pomares-Estran C., Marty P. & Chosidow O. Bedbugs and healthcare-associated dermatitis, France. Emerging Infectious Diseases, 2009, 15, 989–990. [CrossRef] [PubMed] [Google Scholar]
  4. Delaunay P., Blanc V., Del Giudice P., Levy-Bencheton A., Chosidow O., Marty P. & Brouqui P. Bedbugs and infectious diseases. Clinical Infectious Diseases, 2011, 52, 200–210. [CrossRef] [Google Scholar]
  5. Doggett S.L. & Russell R. Bed bugs. What the GP needs to know. Australian Family Physician, 2009, 38, 880–884. [PubMed] [Google Scholar]
  6. Gangloff-Kaufmann J., Hollingworth C., Hahn J., Hansen L., Kard B. & Waldvogel M. Bed bugs in America: a pest management industry survey. American Entomologist, 2006, 52, 105–106. [Google Scholar]
  7. Goddard J. & De Shazo R. Bed bugs (Cimex lectularius) and clinical consequences of their bites. Journal of the American Medical Association, 2009, 301, 1358–1366. [CrossRef] [PubMed] [Google Scholar]
  8. Hwang S.W., Svoboda T.J., De Jong I.J., Kabasele K.J. & Gogosis E. Bed bug infestations in an urban environment. Emerging Infectious Diseases, 2005, 11, 533–538. [CrossRef] [PubMed] [Google Scholar]
  9. Kilpinen O., Kristensen M. & Vagnjensen KM. 2011 Resistance differences between chlorpyrifos and synthetic pyrethroids in Cimex lectularius population from Denmark. Parasitology Research 2011, 109, 1461−1464, DOI: 10.1007/s00436-011-2423-3. [CrossRef] [Google Scholar]
  10. Levy bencheton A., Berenger J.M., Del Giudice P., Delaunay P. & Morand J.J. Resurgence of bedbugs in southern France: a local problem or the tip of the iceberg? Journal of the European Academy of Dermatology and Venereology, 2010, 25, 599−602, DOI: 10.1111/j.1468- 3083.2010.03804.x. [CrossRef] [Google Scholar]
  11. Lowe C.F. & Romney M.G. Bedbugs as vectors for drugresistant bacteria. Emerging Infectious Diseases, 2011, 17, 1132–1134. [CrossRef] [PubMed] [Google Scholar]
  12. Moore D.J. & Miller D.M. Laboratory evaluations of insecticide product efficacy for control of Cimex lectularius. Journal of Economic Entomology, 2006, 99, 2080–2086. [CrossRef] [PubMed] [Google Scholar]
  13. Mouchtouri V.A., Anagnostopoulou R., Samanidou-Voyadjoglou A., Theodoridou K., Hatzoglou C., Kremastinou J. & Hadjichristodoulou C. Surveillance study of vector species on board passenger ships, risk factors related to infestations. BMC Public Health, 2008, 8, 100. [CrossRef] [PubMed] [Google Scholar]
  14. Reinhardt K. & Siva-Jothy M.T. Biology of the bed bugs (Cimicidae). Annual Review of Entomology, 2007, 52, 351–374. [CrossRef] [PubMed] [Google Scholar]
  15. Romero A., Potter M.F., Potter D.A. & Haynes K.F. Insecticide resistance in the bed bug: a factor in the pest’s sudden resurgence? Journal of Medical Entomology, 2007, 44, 175–178. [CrossRef] [PubMed] [Google Scholar]
  16. Seong K.M., Lee D.Y., Yoon K.S., Kwon D.H., Kim H.C., Klein T.A., Clark J.M. & Lee S.H. Establishment of quantitative sequencing and filter contact vial bioassay for monitoring pyrethroid resistance in the common bed bug, Cimex lectularius. Journal of Medical Entomology, 2010, 47, 592–599. [CrossRef] [Google Scholar]
  17. Tawatsin A., Thavara U., Chompoosri J., Phusup Y., Jonjang N., Khumsawads C., Bhakdeenuan P., Sawanpanyalert P., Asavadachanukorn P., Mulla M.S., Siriyasatien P. & Debboun M. Insecticide resistance in bedbugs in Thailand and laboratory evaluation of insecticides for the control of Cimex hemipterus and Cimex lectularius (Hemiptera: Cimicidae). Journal of Medical Entomology, 2011, 48, 1023–1030. [CrossRef] [PubMed] [Google Scholar]
  18. Wang C., Saltzmann K., Chin E., Bennett G.W. & Gibb T. Characteristics of Cimex lectularius (Hemiptera: Cimicidae), infestation and dispersal in a high-rise apartment building. Journal of Economic Entomology, 2010, 103, 172–177. [CrossRef] [PubMed] [Google Scholar]
  19. Yoon K.S., Kwon D.H., Strycharz J.P., Hollingsworth C.S., Lee S.H. & Clark J.M. Biochemical and molecular analysis of deltamethrin resistance in the common bed bug (Hemiptera: Cimicidae). Journal of Medical Entomolology, 2008, 45, 1092–1101. [CrossRef] [Google Scholar]
  20. Zhu F., Wigginton J., Romero A., Moore A., Ferguson K., Palli R., Potter M.F., Haynes K.F. & Palli S.R. Widespread distribution of knockdown resistance mutations in the bed bug, Cimex lectularius (Hemiptera: Cimicidae), populations in the United States. Archives of Insect Biochemistry and Physiology, 2010, 73, 245–257. [PubMed] [Google Scholar]

All Tables

Table 1.

Infestation of the two buildings by bed bugs.

All Figures

thumbnail Fig. 1.

Adult bed bugs and excreta in a flat.

In the text
thumbnail Fig. 2.

Bed bugs excreta on a mattress.

In the text
thumbnail Fig. 3.

Lesions on a human arm caused by bed bugs bites.

In the text
thumbnail Fig. 4.

A: alignment of a part of the sequence of the voltage-gated sodium channel a-subunit gene, encompassing codon 419 (highlighted in yellow), from a pyrethroid-susceptible bed bug [Genbank access number: GU123927] and 124 adult bed bugs collected in the study. Nucleotides identical to those of the GU123927 sequence are indicated by periods; B: alignment of a part of the sequence of the voltagegated sodium channel a-subunit gene, encompassing codon 925 (highlighted in yellow), from a pyrethroid-susceptible bed bug [Genbank access number: GU123928] and 124 adult bed bugs collected in the study. Nucleotides identical to those of the GU123928 sequence are indicated by periods.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.