Open Access
Table 3
Primers and cycling conditions used for amplification of target regions of Rhadinorhynchus cololabis.
| Primers | Primer sequences (5′–3′) | Target region | Cycling condition | Reference |
|---|---|---|---|---|
| ITS-F forward | 5′–GTCGTAACAAGGTTTCCGTA–3′ | ITS | 94 °C for 2 min | [22] |
| ITS-R reverse | 5′–TATGCTTAAATTCAGCGGGT–3′ | 94 °C for 20 s | ||
| 51 °C for 20 s | ||||
| 65 °C for 50 s (40 cycles) | ||||
| 65 °C for 5 min | ||||
| cox1-F forward | 5′–AGTTCTAATCATAA(R)GATAT(Y)GG–3′ | cox1 | 94 °C for 5 min | [15] |
| cox1-R reverse | 5′–TAAACTTCAGGGTGACCAAAAAATCA–3′ | 94 °C for 1 min | ||
| 40 °C for 1 min | ||||
| 72 °C for 1 min (35 cycles) | ||||
| 72 °C for 5 min | ||||
| cox2-F forward | 5′–GTGTTAAAGTGAGGTAGACTGG–3′ | cox2 | 94 °C for 2 min | Present study |
| cox2-R reverse | 5′–CTATGCATTACCCCACATAACTC–3′ | 94 °C for 30 s | ||
| 52 °C for 30 s | ||||
| 72 °C for 30 s (33 cycles) | ||||
| 72 °C for 2 min | ||||
| 12S-F forward | 5′–CAGATTAAACTTGTGCCAGCGG–3′ | 12S | 94 °C for 2 min | Present study |
| 12S-R reverse | 5′–CCCACGCTTAAAGCTACAACGAC–3′ | 94 °C for 30 s | ||
| 58 °C for 30 s | ||||
| 72 °C for 30 s (33 cycles) | ||||
| 72 °C for 2 min |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
