Open Access

Table 1

Primers used for nested PCR in this study.

Primer Sequence (5’→3’) Gene Product size Reference
Primary FF: GCGCCTGAGAGATAGCGACTA 18S rRNA 919 bp Li et al. [15, 18]
RR: GGACCTGTTATTGCTACCCTCTTC
Secondary HF: TGTAAACGATGCCGACAGAG 18S rRNA 339 bp Li et al. [15, 18]
HR: CAACACTGAAGCCAATGCGAGG

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.