Open Access
Table 1
Parasites, GenBank accession numbers of sequences and primer sets used for PCR amplification of the COI gene region.
Species | Accession number | Primers | Primers reference |
---|---|---|---|
Moniliformis saudi | OQ078755 | LCO1490 (5′–GGTCAACAAATCATAAAGATATTGG–3’) | [28] |
Crenosoma striatum | OQ078756a | HCO2198 (5’–TAAACTTCAGGGTGACCAAAAAATCA–3’) | |
Gongylonema sp. | OQ078757–OQ078758 | ||
Mathevotaenia sp. | OQ078759 | JB4.5 (5’–TAAAGAAAGAACATAATGAAAATG–3’) | [11] |
Eucoleus sp. | OQ078760 | JB3 (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’) | |
Aonchotheca erinacei | OQ078761 | ||
Physaloptera immerpani | OQ078762 | ||
Spirura rytipleurites seurati | OQ078763–OQ078764 | ||
Plagiorhynchus cylindraceus | OQ078765 | LCO1490 (5’–GGTCAACAAATCATAAAGATATTGG–3’) | [11, 28] |
JB4.5 (5’–TAAAGAAAGAACATAATGAAAATG–3’) | |||
Brachylaima sp. | OQ078766 | JB3 (5’–TTTTTTGGGCATCCTGAGGTTTAT–3’) | [11, 58] |
CO1-R trema (5’–CAACAAATCATGATGCAAAAGG–3’) |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.