EDP Sciences logo
Submit your paper
Search
Menu
All issues Volume 30 (2023) Parasite, 30 (2023) 31 Full HTML
Open Access
Issue
Parasite
Volume 30, 2023
Article Number 31
Number of page(s) 11
DOI https://doi.org/10.1051/parasite/2023033
Published online 21 August 2023

© M. Lefebvre et al., published by EDP Sciences, 2023

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Cryptosporidium is an intracellular protozoan parasite responsible for cryptosporidiosis disease in animals and humans. The associated global disease burden is high and there is currently no effective therapy. Cryptosporidiosis causes gastroenteritis characterized primarily by watery diarrhea, nausea, vomiting and abdominal pain [3]. In immunocompetent individuals, cryptosporidiosis is often self-limited but can evolve chronically, sometimes leading to post-infection irritable bowel syndrome or sometimes it is implicated in colon cancer [6, 24, 49, 50]. Regarding the most vulnerable patients, such as children and the immunocompromized, symptoms are more severe and could lead to death mainly due to dehydration [4]. According to the Global Enteric Multicenter Study (GEMS), Cryptosporidium is the second leading cause (5–15%) of moderate-to-severe diarrhea in infants in countries of sub-Saharan Africa and South Asia [34, 48]. Currently, a total of 42 species of Cryptosporidium have been described, infecting a wide variety of hosts. Among them, 20 species can infect humans. However, only two species clearly dominate human epidemiology: C. parvum and C. hominis [65]. These two species are responsible for more than 90% of human cases of cryptosporidiosis [9]. Species distribution is dependent on geography and socioeconomic conditions. Cryptosporidium parvum and C. hominis are equally distributed in industrialized nations such as in European countries, the United States, and Australia [27]. However, in France, C. parvum has a higher prevalence (72%) than C. hominis (24%). Conversely, C. hominis has been reported as the dominant species in developing countries, mainly due to direct contamination and poor hygiene conditions [46]. Contamination occurs by oocyst ingestion and transmission may be direct (person-to-person and animal-to-person) or indirect (ingestion of contaminated water or food) [16, 23]. The main difference is observed with direct transmission where C. hominis is mainly transmitted by interhuman contact (adults or children), whereas C. parvum is mainly transmitted by animal contact [3]. For immunocompetent individuals, the infectious dose 50% (ID50) was estimated at 132 oocysts for C. parvum [48, 65].

Regarding indirect transmission, water is often described as a vehicle for Cryptosporidium oocysts. For example, in a meta-analysis, the global prevalence of Cryptosporidium oocysts in investigated water was 36% with 25.7% in treated water, 40.1% in untreated water, 25.5% in drinking water and 7.5% in swimming pool water [9]. Oocysts are very resistant in the environment. Oocyst survival has been described for up to 18 months at +4 °C and up to 7 months at +15 °C in water [25]. To inactivate Cryptosporidium oocysts, the temperature must exceed +72.4 °C for at least one minute or +64.2 °C for 5 min, or drop below −70 °C for at least one hour [13]. In addition, oocysts are resistant to water disinfection treatment, especially chlorine [33]. It has been shown that to inactivate 99% of oocysts they had to be exposed to 80 mg/L of free chlorine for 2 h, and to inactivate 100% of them, they needed to be exposed to 8 to 16 g/L of free chlorine for 24 h [33, 53]. This could at least partially explain why Cryptosporidium has frequently been reported as responsible for waterborne outbreaks. Between 2011 and 2016, Cryptosporidium was responsible for 63% of reported outbreaks due to protozoan waterborne transmission and was reported as the second leading cause of diarrheal disease and death in children in developing countries [12, 15, 47]. The most cited outbreak of cryptosporidiosis occurred in Milwaukee in 1993. More than 400,000 people were infected after contamination of the drinking water system, leading to 4,000 hospitalizations and 69 deaths [39]. Between 2009 and 2017, in the United States, 444 cryptosporidiosis outbreaks were reported and 183 (41.2%) were of water origin. Contaminated recreational water was also involved in cryptosporidiosis outbreaks in England and Wales (46%) [5]. In summary, water is undeniably a favorable environment for oocyst dissemination and survival, as for many microorganisms. This could lead to interesting interactions between microorganisms. Among them, free-living amebae (FLA) must be considered. FLA are protozoan parasites, ubiquitous in hydric and telluric environment [1, 35]. They have been found in 20–30% of domestic tap water samples [52] and in 68.9% of hospital samples [37]. Two FLA species are predominant in the environment: Acanthamoeba castellanii (A. castellanii) and Vermamoeba vermiformis (V. vermiformis). Acanthamoeba castellanii has been extensively studied in the literature; however, it has been shown that the density of V. vermiformis in water and in biofilm was higher than that of A. castellanii and in particular in hot water systems [11, 43, 45, 57, 60]. Their prevalence in water networks is associated with biofilms. Biofilms serve as feeding grounds for FLA, which play a role in the reduction of bacterial biomass thanks to phagocytosis [1, 58].

Free-living amebae present two developmental stages, a vegetative feeding stage (trophozoite), and a resistant stage (cyst) that provides protection from harsh environmental conditions, such as changes in temperature, pH or even biocides and disinfectant exposure [17]. Encysted FLA can survive at least 24 years at +4 °C in water [41, 58] or over 20 years in a completely dry environment [54, 58]. In addition, FLA are very resistant to halogenated treatments (chlorine, bromine, iodine) widely used for water and surface disinfection [29, 55]. For example, a concentration of 15 mg/L of free chlorine was necessary to eliminate more than 4 log10 cysts of V. vermiformis and 2,500 mg/L to eliminate between 2 and 6 log10 cysts of Acanthamoeba sp. [7, 14]. Only four species of FLA have been described as direct human pathogens: Acanthamoeba spp., Naegleria fowleri, Balamuthia mandrillaris and Sappinia diploidea [35, 59]. FLA are responsible for severe infections mainly due to treatment resistance. For example, FLA keratitis frequently leads to blindness [38] and granulomatous amebic encephalitis to hemorrhagic necrosis of the central nervous system [1]. Another example is Naegleria fowleri, which is responsible for primary amebic meningoencephalitis in immunocompetent individuals [1], resulting in a rare acute fulminant infection of the central nervous system with fatal outcome. These organisms are also indirectly implicated in human disease due to their ability to serve as hosts for other pathogens [10]. Indeed, FLA are able to phagocytize a large variety of microorganisms, but some microorganisms, known as Amoeba-Resisting Bacteria (ARB) are able to resist phagocytosis. By serving as host for ARB, FLA play a protective role and facilitate the dissemination of ARB in the environment. Bacteria such as Legionella sp. or Listeria monocytogenes multiply inside the amoeba before being disseminated in the environment [19]. Out of 539 reported bacterial pathogenic species in humans and/or animals, 18.9% (102) were described as ARB [58]. Interactions with FLA were also reported with viruses (Adenoviridae, Pithovirus, etc.), fungi (Cryptococcus neoformans, Candida sp., etc.) or protozoa (Toxoplasma gondii) [1, 22, 62].

The aim of this study was to investigate the potential interactions between C. parvum oocysts and two common species of FLA: A. castellanii and V. vermiformis in water. Studied conditions were selected to be both unfavorable and favorable for phagocytosis to facilitate observation of potential interaction due to phagocytosis. Hypotheses were: (i) FLA phagocytise Cryptosporidium oocysts and consequently could be used as predators to manage Cryptosporidium contamination in the environment, or (ii) oocysts resist FLA phagocytosis. To the best of our knowledge, such interactions have never been investigated in water in such conditions, using both microscopy and infectivity evaluation.

Materials and Methods

Strains

Cryptosporidium parvum strains were obtained from successive batches of feces from infected calves (from the National Institute of Agricultural Research, Nouzilly, France). More precisely, oocysts were isolated by ImmunoMagnetic Separation (IMS) using the Isolate for IMS of Cryptosporidium oocysts kit (TCS Biosciences, Buckingham, UK), according to the manufacturer’s recommendations. Purified oocysts were stored at +4 °C in sterile phosphate-buffered saline (PBS) solution (GibcoTM, Thermo Fisher Scientific, Courtaboeuf, France) until use.

Acanthamoeba castellanii (ATCC 30234) and V. vermiformis (ATCC 50803) strains were cultured axenically in 25 cm2 flasks (Falcon®, Dutscher, Issy-les-Moulineaux, France) in sterile Peptone-Yeast extract-Glucose medium (PYG) and incubated at +28 °C. The PYG medium contained for 1 L of distilled water: 20 g proteose-peptone (BD Difco, Temse, Belgium), 1 g yeast extract (BD Difco), 0.98 g MgSO4,7H2O, 1 g sodium citrate, 2H2O, 0.02 g Fe(NH4)2(SO4)2, 6H2O, 0.34 g KH2PO4, 0.394 g NA2HPO4, 7H2O, 9 g glucose and 0.059 g CaCl2 according to the protocol described by Coulon et al. [8]. After 5 days of incubation at +28 °C, suspensions of FLA were obtained by scraping the flasks using a cell scraper (NuncTM Thermo Fisher Scientific). After centrifugation (1000G for 5 min), the pellet was washed once and suspended in 3 mL of sterile water before counting on a kova-slide (Dutsher).

The ATCC 27853 strain of Pseudomonas aeruginosa and a clinical strain of Escherichia coli were used. The bacterial strains were cultured on blood agar (Bio-Rad, Marnes-la-Coquette, France) and incubated at room temperature before use. Every 7 days, the P. aeruginosa and E. coli strains were subcultured.

Unfavorable phagocytosis condition interactions

Acanthamoeba castellanii or V. vermiformis and C. parvum were co-incubated in sterile water for several days. We used sterile water to avoid any other potential interaction of microorganisms. Suspensions were incubated at +8 °C (±4 °C) for 28 days in a falcon tube (Falcon®, Dutscher). Each of the strains were incubated at the concentration of 106 cells/mL (v/v) with a Multiplicity Of Infection (MOI) = 1. Interactions were evaluated overtime (0 (3 h), 3, 7, 14, 21 and 28 days). Observations were done at each sampling point after resuspension of solutions by vortex agitation (for one minute). Observations were done: (i) microscopically for numeration and viability assays of FLA (using trypan blue 0.4% (v/v) (GibcoTM, Thermo Fisher Scientific); only viable cells were considered for figure representations (trophozoites + cysts)); ii) microscopically for numeration of C. parvum oocysts, and iii) by cell culture coupled with qPCR (CC-qPCR) to evaluate infectivity of C. parvum oocysts, as described below. Three replicates per condition were done with at least six observations per replicate.

Favorable phagocytosis condition interactions (biofilm condition)

One mL of a suspension of optical density at 0.5 McFarland of P. aeruginosa was inoculated in 24-well plates (Thermo Fischer Scientific, Roskilde, Denmark). After 24 h of incubation at room temperature, supernatant was removed and each well was washed three times using sterile water. Presence of biofilm was confirmed in reverse microscopy for each well constituting a support to both Cryptosporidium and FLA and theoretically to promote phagocytosis. Suspensions of FLA and/or C. parvum oocysts were inoculated in biofilm coated wells at a quantity of 5 × 105 cells and incubated at room temperature for a maximum of 7 days. For each sampling point (3 h, day 1, day 3 and day 7), wells were rinsed three times with sterile water; then, biofilms were scraped in 500 μL of sterile water and transferred to 1.5 mL Eppendorf tubes (Eppendorf™, Thermo Fisher Scientific). Microbial interactions were evaluated as described above. The biofilm control condition corresponded to observations done immediately (<15 min) after microorganism inoculation. Three replicates per condition were done with at least six observations per replicate.

Imagery used to observe potential phagocytosis

Confocal microscopy

On MatTek’s 35 mm glass bottom plates (MatTek corporation, Ashland, MA, USA), a biofilm of Pseudomonas aeruginosa DO: 0.5 was formed over 24 h. Then, the biofilm was inoculated with A. castellanii/V. vermiformis and C. parvum at the same concentration (5 × 105 cells) for 1 and 3 h (most favorable times of interactions, see Results section) at room temperature. For each sampling point, the microorganisms were labelled according to the following protocol: (i) air drying of plates, (ii) addition of methanol, (iii) air drying, (iv) PBS washing, (v) DAPI (4′,6-diamidino-2-phenylindole) (Thermo Fisher Scientific) labelling at 1:500 dilution to mark amebae as well as sporozoites contained in C. parvum oocysts (10 min at +37 °C), (vi) PBS washing, (vii) labelling with 1/3 diluted Crypto-Cell-FITC (TCS Biosciences) to mark the outer wall of oocysts (15-minute incubation at +37 °C in humid atmosphere), (viii) PBS washing, (ix) storing at +4 °C in 2 mL of PBS. Samples were then observed using a Leica TCS SP8 confocal laser-scanning microscope (Leica Microsystems, Wetzlar, Germany). Images were acquired with an oil immersion objective (×63) with a numerical aperture of 1.4. Sequential acquisition was performed to avoid the overlapping emission spectra of the fluorescent markers and to increase the quality of these images. DAPI and Crypto-Cel-FITC were excited at 405 and 488 nm, respectively and their fluorescence emissions were collected between 425 and 475 nm for DAPI and between 490 and 530 nm for Crypto-cel-FITC on a photon counting detector (HyD, Leica Microsystems). A z-stack acquisition was performed to obtain a 3D volume of samples. We used a 250 nm z-step-size to avoid photobleaching and to optimize the acquisition of samples. Image processing (Maximum Intensity Projection, Merging channels, Brightness and Contrast adjustment) was performed with ImageJ.

Video

The interactions between C. parvum and A. castellanii were observed on video. Microorganisms were incubated at a concentration of 105 cells/mL (MOI = 1) in MatTek dishes and observed on the CellDiscoverer 7, Zeiss video microscope. Videos were obtained with a water immersion objective (x 50).

Transmission electronic microscopy (TEM)

A control condition was done via suspensions containing exclusively 2 × 106 oocysts/mL or 106 amebae/mL. Then, to evaluate the potential phagocytosis, observations were done in the favorable phagocytosis condition where 4 × 106 cells/mL of Cryptosporidium oocysts and FLA (MOI = 1) were co-incubated for 3 h in the bacterial biofilm. The biofilm was previously formed in 24-well plates, as described above. After 3 h of incubation, samples were fixed with glutaraldehyde in 0.1 M phosphate buffer pH 7.4 (±0.2) and post-fixed in osmium tetroxide. Samples were then subjected to a dehydration step with ethanol baths, followed by an impregnation step with Epoxy resin and then an inclusion and polymerization step leading to the formation of resin blocks. These resins blocks were then cut into semi-fine (0.8–1 μm) and ultra-fine (65–90 μm) sections, which were collected on copper grids and contrasted by uranyl acetate and lead citrate. The copper grids were observed in TEM (CM 10 microscope, Philips).

Cell culture (used for evaluation of oocyst infectivity)

Human ileocecal adenocarcinoma HCT-8 cell lines (ATCC CCL-224) were used for cell culture investigations. HCT-8 cells were maintained in Rosewell Park Memorial Institute « RPMI » 1640 medium with glutamine (Lonza, Verviers, Belgium) supplemented with 5% of heat-inactivated fetal bovine serum (Eurobio, Les Ulis, France), 100 IU/mL of penicillin (Corning™; Thermo Fisher Scientific) and 100 pg/mL of streptomycin (Corning™; Thermo Fisher Scientific). Cultures were grown in Falcon flasks (75 cm2) (Falcon®, Dutscher) at +37 °C and 5% CO2 atmosphere. HCT-8 cells were resuspended twice a week until use.

Infectivity evaluation of C. parvum oocysts

To evaluate the infectivity of oocysts, we adapted a qPCR method combined with HCT-8 cell culture (CC-qPCR) previously published by Kubina et al. [36]. Briefly, HCT-8 cells were cultured in 96-well plates (Thermo Fischer Scientific, Roskilde, Denmark) (2 × 104 cells per well) at +37 °C with 5% CO2 to obtain about 90% confluence after 72 h of culture. Confluent HCT-8 cells were then infected with a co-culture medium containing C. parvum oocysts (103 oocysts per well) for 48 h. In parallel, wells without HCT-8 cells were inoculated with C. parvum oocysts in the same conditions. DNA was extracted using a QIAamp DNA mini kit (QIAGEN, Hilden, Germany), according to the manufacturer’s recommendations. DNA was then quantified by qPCR (primers: Crypto-F: 5′–CGCTTCTCTAGCCTTTTCATGA–3′, CRYPTO-R: 5′–CTTCACGTGTGTTTGCCAAT–3′ and probe CRYPTO P: FAM 5′–CCAATCACAGAATCATCAGAATCGACTGGTATC–3′ BQH1), according to the following PCR program: 95 °C for 3 min; 95 °C for 15 s, and 60 °C for 60 s, repeated 45 times. Differences of obtained cycle threshold (Ct) values (named DeltaCt) were calculated subtracting Ct values obtained from infected wells without HCT-8 cells from Ct values obtained from infected wells with HCT-8 cells. Due to viable oocyst replication on HCT-8 infected cells, higher DeltaCt values were associated with higher proliferation of oocysts. Three replicates per condition were done with at least six observations per replicate.

Evaluation of potential chemical interactions on infectivity of oocysts

Results showed decreased infectivity of oocysts in 3 h of contact between A. castellanii and C. parvum (see below). To study the effect of exclusive chemical contact between C. parvum and A. castellanii, we used a 5 μm of porosity cell insert (Merck Millipore 051715B, Molsheim, France). Suspensions of sterile water loaded with 105 C. parvum oocysts were inoculated in a 24-well plate. Additionally, inserts were loaded with A. castellanii sterile water suspensions at the same concentration. Loaded inserts were dropped in wells previously inoculated with oocysts to block physical contact between C. parvum oocysts and A. castellanii while allowing chemical interactions. After 3 h of incubation at room temperature, inserts were removed and suspensions of oocysts were recovered from wells. A CC-qPCR was performed to evaluate oocyst infectivity, as previously described.

Statistical analysis

Student’s test was used to compare the data. For a p-value < 0.05, the data were considered significantly different.

Results

Numeration of C. parvum oocysts and free-living amebae

In the unfavorable phagocytosis condition, the concentration of A. castellanii decreased from 5.58 ± 0.11 log10/mL at D0 (Day 0) to 5.12 ± 0.18 log10/mL at D28 in the presence of C. parvum oocysts (p-value < 0.001). In the absence of C. parvum oocysts, A. castellanii decreased from 5.56 ± 0.13 log10/mL at D0 to 5.27 × 0.06 log10/mL at D28 (p-value < 0.001) (Fig. 1A). Regarding each sampling point, no significant differences were observed according to the presence or absence of C. parvum oocysts. Similar results were obtained with V. vermiformis (data not shown). The concentration of C. parvum oocysts remained constant over time and was not significantly affected by the presence of A. castellanii or V. vermiformis (Fig. 1B).

thumbnail Figure 1

Enumeration of Acanthamoeba castellanii in the presence or absence of Cryptosporidium parvum oocysts over time in the unfavorable phagocytosis condition (1A) and in the favorable phagocytosis condition (1C) and enumeration of C. parvum oocysts in the presence or absence of A. castellanii over time in the unfavorable phagocytosis condition (1B) and in the favorable phagocytosis condition (1D). p-value: *** < 0.001. (magnification ×200 for A. castellanii and ×400 for C. parvum).

In the favorable phagocytosis condition, the concentration of A. castellanii decreased over time from 4.22 ± 0.08 log10 to 3.41 ± 0.21 log10 in the absence of C. parvum oocysts (p-value < 0.001). In the presence of C. parvum oocysts, the concentration of A. castellanii remained stable over time in the studied conditions (Fig. 1C). Significant differences were observed according to the presence or absence of C. parvum oocysts at each studied sampling point. For V. vermiformis the results were similar (data not shown). In the presence of A. castellanii, the concentration of C. parvum remained stable over time but, in the absence of A. castellanii, the concentration of oocysts increased significantly (but slightly) from 5.02 ± 0.04 log10 to 5.34 ± 0.06 log10 (a global two-fold increase) (p-value < 0.001) (Fig. 1D). Similar results were observed with V. vermiformis.

Encystment of free-living amebae

Regarding encystment of A. castellanii in the presence of C. parvum oocysts (Fig. 2): in the unfavorable phagocytosis condition, the percentage of cysts tended to increase over time from 16.61% ± 5.47% to 37.16% ± 11.72% (p-value < 0.001). In the absence of C. parvum oocysts, encystment increased to a lesser extent, ranging from 11.43% ± 5.66% to 18.68% ± 8.41% (p-value < 0.05). Results were similar in the favorable phagocytosis condition (Fig. 2B). Similarly, the percentage of V. vermiformis cysts in the favorable phagocytosis condition, increased significantly over time (p-value < 0.001). Co-incubation with oocysts did not change encystment at the different sampling points (Fig. 2D). Regarding the unfavorable phagocytosis condition, in the presence of oocysts, the proportion of cysts increased from 4.53% ± 0.58% to 14.92% ± 2.92% (p-value < 0.001) and in the absence of oocysts from 5.4% ± 0.98% to 9.78% ± 1.86% at D28 (p-value < 0.001) (Fig. 2C).

thumbnail Figure 2

Percentage of Acanthamoeba castellanii cysts in the unfavorable phagocytosis condition (2A) and in the favorable phagocytosis condition (2B) and Vermamoeba vermiformis cysts in the unfavorable phagocytosis condition (2C) and in the favorable phagocytosis condition (2D) over time in the presence or absence of Cryptosporidium parvum oocysts. p-value: ** < 0.01; *** < 0.001.

Infectivity of C. parvum oocysts

Results showed a significant decrease of Delta Ct in the early stages of co-incubation (Fig. 3) in comparison with the control condition (in the absence of A. castellanii). This suggests an early loss of infectivity in the presence of A. castellanii. Additional results showed a maximum decrease of oocyst infectivity at 3 h of co-incubation in the presence of A. castellanii (data not shown).

thumbnail Figure 3

Evaluation of the infectivity of Cryptosporidium parvum oocysts over time in the presence of Acanthamoeba castellanii. p-value: *** < 0.01.

Results also showed that when A. castellanii and C. parvum oocysts were not in physical contact (separated by the insert), the infectivity of oocysts did not change in the presence of A. castellanii.

Phagocytosis evaluation

A video was made to evaluate interactions between C. parvum oocysts and A. castellanii (Supplemental file 1). In the video, we can see favorable tropism of A. castellanii in the direction of C. parvum oocysts. Oocysts seemed sometimes to be incorporated into FLA, but were always released over time. Confocal imaging and 3D projection showed C. parvum oocysts occasionally inside A. castellanii or V. vermiformis (Figs. 4A and 4B). Interestingly, confocal imaging also showed C. parvum oocysts frequently clustered around FLA.

thumbnail Figure 4

Confocal imaging (A) and 3D projection (B) of co-incubated free-living amebae and Cryptosporidium parvum oocysts (green). Red arrows point to oocysts internalized in FLA.

To complete the investigation, TEM was performed. First, each microorganism was observed from the monomicrobial condition (Fig. 5). Sporozoites and oocysts of Cryptosporidium parvum are shown in Figures 5A and 5B, respectively. Vegetative forms of A. castellanii are shown in Figures 5C and 5D.

thumbnail Figure 5

Images obtained from transmission electronic microscopy (TEM) of Cryptosporidium parvum sporozoites (5A), C. parvum oocysts (5B) and vegetative forms of Acanthamoeba castellanii (5C and 5D).

In co-incubation condition, sporozoites were observed inside A. castellanii (Figs. 6A and 6B). In addition, “digestive-like vacuoles” (5–8 μm) were sometimes observed inside A. castellanii trophozoites (data not shown).

thumbnail Figure 6

Transmission electron microscopy (TEM) observations of vegetative forms of Acanthamoeba castellanii co-incubated with Cryptosporidium parvum. Red arrows show sporozoites inside trophozoites of A. castellanii (6A and 6B).

Discussion

This study evaluated potential interactions between FLA and Cryptosporidium oocysts using both microscopy (optical, confocal, fluorescent, and TEM) and qPCR (for infectivity evaluation) approaches. Until now, very few data have been published on interactions between FLA and Cryptosporidium oocysts [18, 51, 56]. De Moraes et al. studied growth, encystment, and survival of Acanthamoeba castellanii in the presence of various bacterial species (E. coli, P. aeruginosa, Enterobacter cloacae, Bacillus megaterium, Micrococcus luteus and Staphylococcus aureus) in non-nutrient saline solution. They demonstrated a dose-dependent proliferative response of A. castellanii according to bacterial concentration. Proliferation of A. castellanii (6–8 fold increase) was observed after addition of 109 bacteria/mL corresponding to an MOI (bacteria: FLA) of 10 000:1 [42]. In the absence of bacteria, A. castellanii cells stopped dividing but remained viable and retained their typical trophozoite morphology for 4 to 7 days and thereafter began to encyst [42]. In our study, FLA did not proliferate in the presence of oocysts, with an MOI of 1:1. A higher MOI, with a higher ratio of oocysts to FLA could potentially lead to FLA proliferation over time. However, a higher MOI could not be easily reached due to the impossibility to culture oocysts in vitro, in contrary to bacteria or yeast for example. One possibility to obtain more oocysts is to work in animal models (requiring many animals), with all corresponding ethical aspects. In addition, lowering the concentration of FLA to obtain a higher MOI would strongly limit observations by microscopy. However, it has also been shown that for an MOI of 1:1 (106/mL bacteria and A. castellanii), bacteria (P. aeruginosa, E. coli, Serratia marescens and Stenotrophomonas maltophilia) favored the growth and survival of A. castellanii and that for a higher MOI of 100:1 (bacteria: FLA), bacteria and especially P. aeruginosa inhibited the growth of A. castellanii [40, 61]. Indeed, FLA proliferation occurs in the presence of various bacteria and FLA have preferences for certain bacterial species and in particular gram-negative bacteria such as E. coli or Klebsiella aerogenes [28]. In addition, it has been reported that FLA cultured in axenic conditions could not predate bacteria such as Acinetobacter baumanii. Axenic growing conditions could thus favor pinocytosis rather than phagocytosis and consequently minimize bacterial interactions [2, 31]. In our study, the FLA used were axenically cultured for years, which may affect their phagocytosis ability and potentially limit oocyst interactions.

Interestingly, it has been shown that temperature influences the phagocytosis ability of FLA. After ingestion at +20 °C, Legionella pneumophila was fully digested by A. castellanii but at +37 °C, Legionella pneumophila could lyse A. castellanii [40]. Parachlamydia acanthamoebae was lytic for Acanthamoeba polyphaga between +32 and +37 °C and endosymbiotic between +25 °C and +30 °C [19]. In our study, interactions were first studied in an unfavorable phagocytosis condition, in a suspension at +8 °C (±4°C). And then, we evaluated interactions in a most favorable phagocytosis condition at room temperature (+20 °C to +25 °C) in biofilm. Since A. castellanii rapidly decreased in the favorable phagocytosis condition in the absence of C. parvum oocysts and encystment increased over time in the presence of oocysts, results seem to demonstrate that oocysts could delay the decline of A. castellanii. This phenomenon was described with bacteria, which delayed the encystment of A. castellanii (7–8 days in absence of bacteria vs. 9–16 days) and improved the encystation yield (0.5 in absence of bacteria versus 4–44 depending on the bacterial strain) [42]. In addition, encystment is dependent on the FLA strains studied and probably on their resistance. Both temperature and desiccation could, at least partially, explain such differences. Vermamoeba vermiformis seemed more sensitive to desiccation than A. castellanii. In the literature, it has been shown that FLA encyst to fight against desiccation and that Acanthamoeba spp. cysts can survive for up to 20 years in a completely dry environment [54]. Interestingly, in our studied conditions, macroscopic desiccation was observed after 7 days of incubation, corresponding to the highest observed encystment rate.

In our studied biofilm condition, very surprisingly, the number of C. parvum oocysts increased progressively over time (factor 2) in the absence of FLA. In the presence of FLA, such proliferation of oocysts was not observed. Some hypotheses could explain the observed differences: in the absence of FLA, C. parvum oocysts could possibly interact with the bacteria supporting the biofilm (i.e., P. aeruginosa). In the literature, a 2–3 fold multiplication of oocysts was shown in a mature biofilm of P. aeruginosa in 6 days, together with an observation of different developmental stages of Cryptosporidium (sporozoites, trophozoites, and type I and II meronts) [32]. Conversely, other studies showed that the number of oocysts remained constant in biofilm conditions [63, 64]. These discrepancies are possibly related to the difference in biofilm type. The first study used an artificial biofilm of P. aeruginosa, and the second used a natural biofilm sampled from runoff water. As artificial and natural biofilms have different communities, structures, and nutrient levels, oocysts may interact differently. Furthermore, several studies have reported the possible multiplication of Cryptosporidium extracellularly in cell-free cultures showing that encapsulation in a host cell was not essential for oocyst multiplication [20, 21, 26, 66].

Finally, regarding infectivity of oocysts, a temporary decrease of infectivity was observed in the presence of A. castellanii. Investigations revealed that physical interactions between oocysts and A. castellanii seemed mandatory for such effect. Thus, the decrease of Cryptosporidium infectivity could be linked to FLA attempted phagocytosis. At the beginning of the co-incubation, Cryptosporidium could develop escape mechanisms against FLA predation leading to a reduction in its infectivity. Although no proof of oocyst phagocytosis was observed with TEM (even though we observed potential digestive vacuoles similar in size to oocyst vacuoles), TEM observations demonstrated sporozoite phagocytosis by FLA. Consequently, phagocytosis could preferentially occur in “free” forms of C. parvum, explaining why oocyst numeration does not decrease over time in the presence of FLA and why no increase of oocysts was observed in the biofilm condition in the presence of FLA. In addition, SP8 microscopy showed clusters of oocysts attached to FLA membranes (probably not observed by conventional light microscopy because the microorganisms in solution were vortexed before microscopic study). This could be due to the traction effect of FLA on oocysts; however, groups of oocysts were also observed away from FLA. In the literature, agglutination of Cryptosporidium oocysts has been observed in raw water, whereas in sterile water, no agglutination was observed. This phenomenon may be a response to predation [30]. This defense mechanism has already been reported for P. aeruginosa. Pickup et al. observed the formation of bacteria microcolonies, leading to a reduction in the rate of bacteria ingestion by FLA [44]. Other mechanisms of resistance to FLA predation have been described in the literature, such as the presence of a polysaccharide capsule (i.e., C. neoformans). Cryptosporidium parvum oocyst walls could similarly limit FLA phagocytosis.

This study provides new data on interactions between FLA and C. parvum oocysts, including both microscopy and infectivity data. FLA survival was increased in the presence of C. parvum. Various microscopic observations demonstrated the ability of FLA to occasionally phagocytize C. parvum. Interestingly, C. parvum was able to resist phagocytosis, but its infectivity was temporarily modified. Physical interactions between A. castellanii and oocysts appeared essential in the corresponding mechanism of modified infectivity. These results open new perspectives based on Cryptosporidium microbial interactions and the possibility to modify oocyst infectivity. Identifying the mechanisms involved in the virulence of C. parvum or its resistance to phagocytosis could facilitate the development of new therapeutic approaches in cryptosporidiosis disease.

Acknowledgments

We are grateful to Christine Imbert and Vincent Delafont, Laboratory of Ecology and Biology of interactions, University of Poitiers, France for providing ATCC strains of free-living amebae and the National Institute of Agricultural Research, Nouzilly, France for providing the strain of C. parvum used in this study. We thank Léonie Gricourt for her implication in TEM investigations. We also thank Magalie Benard for video acquisition. Thanks are also due to Nikki Sabourin-Gibbs (CHU Rouen), an English native speaker, for her help in editing the manuscript.

Supplementary material

Video of interactions between C. parvum oocysts and Acanthamoeba castellanii. A favorable tropism of A. castellanii in the direction of C. parvum oocysts is visible. Oocysts seemed sometimes to be incorporated into free-living amebae but were always released over time. Access here

References

  1. Balczun C, Scheid PL. 2017. Free-Living amoebae as hosts for and vectors of intracellular microorganisms with public health significance. Viruses, 9, E65. [CrossRef] [PubMed] [Google Scholar]
  2. Bornier F, Zas E, Potheret D, Laaberki M-H, Coupat-Goutaland B, Charpentier X. 2021. Environmental free-living amoebae can predate on diverse antibiotic-resistant human pathogens. Applied and Environmental Microbiology, 87, e00747–21. [CrossRef] [PubMed] [Google Scholar]
  3. Cacciò SM, Chalmers RM. 2016. Human cryptosporidiosis in Europe. Clinical Microbiology and Infection, 22, 471–480. [CrossRef] [PubMed] [Google Scholar]
  4. Chalmers RM, Davies AP. 2010. Minireview: clinical cryptosporidiosis. Experimental Parasitology, 124, 138–146. [CrossRef] [PubMed] [Google Scholar]
  5. Chalmers RM, Robinson G, Elwin K, Elson R. 2019. Analysis of the Cryptosporidium spp. and gp60 subtypes linked to human outbreaks of cryptosporidiosis in England and Wales, 2009 to 2017. Parasites & Vectors, 12, 95. [CrossRef] [PubMed] [Google Scholar]
  6. Costa D, Razakandrainibe R, Valot S, Vannier M, Sautour M, Basmaciyan L, Gargala G, Viller V, Lemeteil D, Ballet J-J, Dalle F, Favennec L. 2020. Epidemiology of Cryptosporidiosis in France from 2017 to 2019. Microorganisms, 8, 1358. [CrossRef] [Google Scholar]
  7. Coulon C, Collignon A, McDonnell G, Thomas V. 2010. Resistance of Acanthamoeba cysts to disinfection treatments used in health care settings. Journal of Clinical Microbiology, 48, 2689–2697. [CrossRef] [PubMed] [Google Scholar]
  8. Coulon C, Dechamps N, Meylheuc T, Collignon A, McDonnell G, Thomas V. 2012. The effect of in vitro growth conditions on the resistance of Acanthamoeba cysts. Journal of Eukaryotic Microbiology, 59, 198–205. [CrossRef] [Google Scholar]
  9. Daraei H, Oliveri Conti G, Sahlabadi F, Thai VN, Gholipour S, Turki H, Fakhri Y, Ferrante M, Moradi A, Mousavi Khaneghah A. 2020. Prevalence of Cryptosporidium spp. in water: a global systematic review and meta-analysis. Environmental Science and Pollution Research, 28, 9498–9507. [Google Scholar]
  10. Declerck P, Behets J, van Hoef V, Ollevier F. 2007. Detection of Legionella spp. and some of their amoeba hosts in floating biofilms from anthropogenic and natural aquatic environments. Water Research, 41, 3159–3167. [CrossRef] [PubMed] [Google Scholar]
  11. Delafont V, Rodier M-H, Maisonneuve E, Cateau E. 2018. Vermamoeba vermiformis: a free-living amoeba of interest. Microbial Ecology, 76, 991–1001. [CrossRef] [PubMed] [Google Scholar]
  12. Efstratiou A, Ongerth J, Karanis P. 2017. Evolution of monitoring for Giardia and Cryptosporidium in water. Water Research, 123, 96–112. [CrossRef] [PubMed] [Google Scholar]
  13. Fayer R, Trout JM, Jenkins MC. 1998. Infectivity of Cryptosporidium parvum oocysts stored in water at environmental temperatures. Journal of Parasitology, 84, 1165–1169. [CrossRef] [Google Scholar]
  14. Fouque E, Héchard Y, Hartemann P, Humeau P, Trouilhé M-C. 2014. Sensitivity of Vermamoeba (Hartmannella) vermiformis cysts to conventional disinfectants and protease. Journal of Water and Health, 13, 302–310. [Google Scholar]
  15. GBD 2016 Diarrhoeal Disease Collaborators. 2018. Estimates of the global, regional, and national morbidity, mortality, and aetiologies of diarrhoea in 195 countries: a systematic analysis for the Global Burden of Disease Study 2016. Lancet Infectious Diseases, 18, 1211–1228. [CrossRef] [Google Scholar]
  16. Gerace E, Presti VDML, Biondo C. 2019. Cryptosporidium infection: epidemiology, pathogenesis, and differential diagnosis. European Journal of Microbiology and Immunology, 9, 119–123. [CrossRef] [Google Scholar]
  17. Gomes TS, Vaccaro L, Magnet A, Izquierdo F, Ollero D, Martínez-Fernández C, Mayo L, Moran M, Pozuelo MJ, Fenoy S, Hurtado C, del Águila C. 2020. Presence and interaction of free-living amoebae and amoeba-resisting bacteria in water from drinking water treatment plants. Science of The Total Environment, 719, 137080. [CrossRef] [Google Scholar]
  18. Gómez-Couso H, Paniagua-Crespo E, Ares-Mazás E. 2007. Acanthamoeba as a temporal vehicle of Cryptosporidium. Parasitology Research, 100, 1151–1154. [CrossRef] [PubMed] [Google Scholar]
  19. Greub G, Raoult D. 2004. Microorganisms resistant to free-living amoebae. Clinical Microbiology Reviews, 17, 413–433. [CrossRef] [PubMed] [Google Scholar]
  20. Hijjawi NS, Meloni BP, Ng’anzo M, Ryan UM, Olson ME, Cox PT, Monis PT, Thompson RCA. 2004. Complete development of Cryptosporidium parvum in host cell-free culture. International Journal for Parasitology, 34, 769–777. [CrossRef] [PubMed] [Google Scholar]
  21. Hijjawi N, Estcourt A, Yang R, Monis P, Ryan U. 2010. Complete development and multiplication of Cryptosporidium hominis in cell-free culture. Veterinary Parasitology, 169, 29–36. [CrossRef] [PubMed] [Google Scholar]
  22. Hubert F, Rodier M-H, Minoza A, Portet-Sulla V, Cateau E, Brunet K. 2021. Free-living amoebae promote Candida auris survival and proliferation in water. Letters in Applied Microbiology, 72, 82–89. [CrossRef] [PubMed] [Google Scholar]
  23. Innes EA, Chalmers RM, Wells B, Pawlowic MC. 2020. A one health approach to tackle cryptosporidiosis. Trends in Parasitology, 36, 290–303. [CrossRef] [PubMed] [Google Scholar]
  24. Jadallah K, Nimri L, Ghanem R. 2017. Protozoan parasites in irritable bowel syndrome: A case-control study. World Journal of Gastrointestinal Pharmacology and Therapeutics, 8, 201–207. [CrossRef] [PubMed] [Google Scholar]
  25. Jenkins M, Trout JM, Higgins J, Dorsch M, Veal D, Fayer R. 2003. Comparison of tests for viable and infectious Cryptosporidium parvum oocysts. Parasitology Research, 89, 1–5. [PubMed] [Google Scholar]
  26. Karanis P, Kimura A, Nagasawa H, Igarashi I, Suzuki N. 2008. Observations on Cryptosporidium life cycle stages during excystation. Journal of Parasitology, 94, 298–300. [CrossRef] [PubMed] [Google Scholar]
  27. Khan A, Shaik JS, Grigg ME. 2018. Genomics and molecular epidemiology of Cryptosporidium species. Acta Tropica, 184, 1–14. [CrossRef] [PubMed] [Google Scholar]
  28. Khan NA. 2006. Acanthamoeba: biology and increasing importance in human health. FEMS Microbiology Reviews, 30, 564–595. [PubMed] [Google Scholar]
  29. Kilvington S, Price J. 1990. Survival of Legionella pneumophila within cysts of Acanthamoeba polyphaga following chlorine exposure. Journal of Applied Bacteriology, 68, 519–525. [CrossRef] [Google Scholar]
  30. King BJ, Keegan AR, Monis PT, Saint CP. 2005. Environmental temperature controls Cryptosporidium oocyst metabolic rate and associated retention of infectivity. Applied and Environmental Microbiology, 71, 3848–3857. [CrossRef] [PubMed] [Google Scholar]
  31. King JS, Kay RR. 2019. The origins and evolution of macropinocytosis. Philosophical Transactions of the Royal Society of London. Series B, Biological Sciences, 374, 20180158. [CrossRef] [PubMed] [Google Scholar]
  32. Koh W, Clode PL, Monis P, Thompson RCA. 2013. Multiplication of the waterborne pathogen Cryptosporidium parvum in an aquatic biofilm system. Parasites & Vectors, 6, 270. [CrossRef] [PubMed] [Google Scholar]
  33. Korich DG, Mead JR, Madore MS, Sinclair NA, Sterling CR. 1990. Effects of ozone, chlorine dioxide, chlorine, and monochloramine on Cryptosporidium parvum oocyst viability. Applied and Environmental Microbiology, 56, 1423–1428. [CrossRef] [PubMed] [Google Scholar]
  34. Kotloff KL, Nataro JP, Blackwelder WC, Nasrin D, Farag TH, Panchalingam S, Wu Y, Sow SO, Sur D, Breiman RF, Faruque AS, Zaidi AK, Saha D, Alonso PL, Tamboura B, Sanogo D, Onwuchekwa U, Manna B, Ramamurthy T, Kanungo S, Ochieng JB, Omore R, Oundo JO, Hossain A, Das SK, Ahmed S, Qureshi S, Quadri F, Adegbola RA, Antonio M, Hossain MJ, Akinsola A, Mandomando I, Nhampossa T, Acácio S, Biswas K, O’Reilly CE, Mintz ED, Berkeley LY, Muhsen K, Sommerfelt H, Robins-Browne RM, Levine MM. 2013. Burden and aetiology of diarrhoeal disease in infants and young children in developing countries (the Global Enteric Multicenter Study, GEMS): a prospective, case-control study. The Lancet, 382, 209–222. [CrossRef] [Google Scholar]
  35. Król-Turmińska K, Olender A. 2017. Human infections caused by free-living amoebae. Annals of Agricultural and Environmental Medicine, 24, 254–260. [Google Scholar]
  36. Kubina S, Costa D, Favennec L, Gargala G, Rousseau A, Villena I, La Carbona S, Razakandrainibe R. 2021. Detection of infectious Cryptosporidium parvum oocysts from lamb’s lettuce: CC–qPCR’s intake. Microorganisms, 9, 215. [CrossRef] [PubMed] [Google Scholar]
  37. Lasheras A, Boulestreau H, Rogues A-M, Ohayon-Courtes C, Labadie J-C, Gachie J-P. 2006. Influence of amoebae and physical and chemical characteristics of water on presence and proliferation of Legionella species in hospital water systems. American Journal of Infection Control, 34, 520–525. [CrossRef] [PubMed] [Google Scholar]
  38. Lorenzo-Morales J, Khan NA, Walochnik J. 2015. An update on Acanthamoeba keratitis: diagnosis, pathogenesis and treatment. Parasite, 22, 10. [CrossRef] [EDP Sciences] [PubMed] [Google Scholar]
  39. Mac Kenzie WR, Hoxie NJ, Proctor ME, Gradus MS, Blair KA, Peterson DE, Kazmierczak JJ, Addiss DG, Fox KR, Rose JB. 1994. A massive outbreak in Milwaukee of Cryptosporidium infection transmitted through the public water supply. New England Journal of Medicine, 331, 161–167. [CrossRef] [PubMed] [Google Scholar]
  40. Marciano-Cabral F, Cabral G. 2003. Acanthamoeba spp. as agents of disease in humans. Clinical Microbiology Reviews, 16, 273–307. [CrossRef] [PubMed] [Google Scholar]
  41. Mazur T, Hadaś E, Iwanicka I. 1995. The duration of the cyst stage and the viability and virulence of Acanthamoeba isolates. Tropical Medicine and Parasitology, 46, 106–108. [PubMed] [Google Scholar]
  42. de Moraes J, Alfieri SC. 2008. Growth, encystment and survival of Acanthamoeba castellanii grazing on different bacteria. FEMS Microbiology Ecology, 66, 221–229. [CrossRef] [PubMed] [Google Scholar]
  43. Ovrutsky AR, Chan ED, Kartalija M, Bai X, Jackson M, Gibbs S, Falkinham JO, Iseman MD, Reynolds PR, McDonnell G, Thomas V. 2013. Cooccurrence of free-living amoebae and nontuberculous Mycobacteria in hospital water networks, and preferential growth of Mycobacterium avium in Acanthamoeba lenticulata. Applied and Environmental Microbiology, 79, 3185–3192. [CrossRef] [PubMed] [Google Scholar]
  44. Pickup ZL, Pickup R, Parry JD. 2007. Growth of Acanthamoeba castellanii and Hartmannella vermiformis on live, heat-killed and DTAF-stained bacterial prey. FEMS Microbiology Ecology, 61, 264–272. [CrossRef] [PubMed] [Google Scholar]
  45. Rohr U, Weber S, Michel R, Selenka F, Wilhelm M. 1998. Comparison of free-living amoebae in hot water systems of hospitals with isolates from moist sanitary areas by identifying genera and determining temperature tolerance. Applied and Environmental Microbiology, 64, 1822–1824. [CrossRef] [PubMed] [Google Scholar]
  46. Ryan U, Fayer R, Xiao L. 2014. Cryptosporidium species in humans and animals: current understanding and research needs. Parasitology, 141, 1667–1685. [CrossRef] [PubMed] [Google Scholar]
  47. Ryan U, Hijjawi N, Xiao L. 2018. Foodborne cryptosporidiosis. International Journal for Parasitology, 48, 1–12. [CrossRef] [PubMed] [Google Scholar]
  48. Ryan U, Paparini A, Monis P, Hijjawi N. 2016. It’s official – Cryptosporidium is a gregarine: What are the implications for the water industry? Water Research, 105, 305–313. [CrossRef] [PubMed] [Google Scholar]
  49. Salem AI, El-Taweel HA, Madkour MA, Abd El-Latif NF, Abd-Elrazeq ES. 2019. Irritable bowel syndrome in Egyptian patients: plausible risk factors and association with intestinal protozoa. Tropical Doctor, 49, 184–188. [CrossRef] [PubMed] [Google Scholar]
  50. Sawant M, Baydoun M, Creusy C, Chabé M, Viscogliosi E, Certad G, Benamrouz-Vanneste S. 2020. Cryptosporidium and colon cancer: cause or consequence? Microorganisms, 8, 1665. [CrossRef] [PubMed] [Google Scholar]
  51. Scheid PL, Schwarzenberger R. 2011. Free-living amoebae as vectors of cryptosporidia. Parasitology Research, 109, 499–504. [CrossRef] [PubMed] [Google Scholar]
  52. Shoff ME, Rogerson A, Kessler K, Schatz S, Seal DV. 2008. Prevalence of Acanthamoeba and other naked amoebae in South Florida domestic water. Journal of Water and Health, 6, 99–104. [CrossRef] [PubMed] [Google Scholar]
  53. Smith HV, McDiarmid A, Smith AL, Hinson AR, Gilmour RA. 1989. An analysis of staining methods for the detection of Cryptosporidium spp. oocysts in water-related samples. Parasitology, 99 Pt 3, 323–327. [CrossRef] [PubMed] [Google Scholar]
  54. Sriram R, Shoff M, Booton G, Fuerst P, Visvesvara GS. 2008. Survival of Acanthamoeba cysts after desiccation for more than 20 years. Journal of Clinical Microbiology, 46, 4045–4048. [CrossRef] [PubMed] [Google Scholar]
  55. Storey MV, Winiecka-Krusnell J, Ashbolt NJ, Stenström T-A. 2004. The efficacy of heat and chlorine treatment against thermotolerant Acanthamoebae and Legionellae. Scandinavian Journal of Infectious Diseases, 36, 656–662. [CrossRef] [PubMed] [Google Scholar]
  56. Stott R, May E, Ramirez E, Warren A. 2003. Predation of Cryptosporidium oocysts by protozoa and rotifers: Implications for water quality and public health. Water Science and Technology: A Journal of the International Association on Water Pollution Research, 47, 77–83. [CrossRef] [PubMed] [Google Scholar]
  57. Thomas V, Herrera-Rimann K, Blanc DS, Greub G. 2006. Biodiversity of amoebae and amoeba-resisting bacteria in a hospital water network. Applied and Environmental Microbiology, 72, 2428–2438. [CrossRef] [PubMed] [Google Scholar]
  58. Thomas V, McDonnell G, Denyer SP, Maillard J-Y. 2010. Free-living amoebae and their intracellular pathogenic microorganisms: risks for water quality. FEMS Microbiology Reviews, 34, 231–259. [CrossRef] [PubMed] [Google Scholar]
  59. Trabelsi H, Dendana F, Sellami A, Sellami H, Cheikhrouhou F, Neji S, Makni F, Ayadi A. 2012. Pathogenic free-living amoebae: Epidemiology and clinical review. Pathologie Biologie, 60, 399–405. [CrossRef] [PubMed] [Google Scholar]
  60. Wang H, Edwards M, Falkinham JO, Pruden A. 2012. Molecular survey of the occurrence of Legionella spp., Mycobacterium spp., Pseudomonas aeruginosa, and amoeba hosts in two chloraminated drinking water distribution systems. Applied and Environmental Microbiology, 78, 6285–6294. [CrossRef] [PubMed] [Google Scholar]
  61. Wang X, Ahearn DG. 1997. Effect of bacteria on survival and growth of Acanthamoeba castellanii. Current Microbiology, 34, 212–215. [CrossRef] [PubMed] [Google Scholar]
  62. Winiecka-Krusnell J, Dellacasa-Lindberg I, Dubey JP, Barragan A. 2009. Toxoplasma gondii: Uptake and survival of oocysts in free-living amoebae. Experimental Parasitology, 121, 124–131. [CrossRef] [PubMed] [Google Scholar]
  63. Wolyniak EA, Hargreaves BR, Jellison KL. 2009. Retention and release of Cryptosporidium parvum oocysts by experimental biofilms composed of a natural stream microbial community. Applied and Environmental Microbiology, 75, 4624–4626. [CrossRef] [PubMed] [Google Scholar]
  64. Wolyniak EA, Hargreaves BR, Jellison KL. 2010. Seasonal retention and release of Cryptosporidium parvum oocysts by environmental biofilms in the laboratory. Applied and Environmental Microbiology, 76, 1021–1027. [CrossRef] [PubMed] [Google Scholar]
  65. Zahedi A, Ryan U. 2020. Cryptosporidium – An update with an emphasis on foodborne and waterborne transmission. Research in Veterinary Science, 132, 500–512. [CrossRef] [PubMed] [Google Scholar]
  66. Zhang L, Sheoran AS, Widmer G. 2009. Cryptosporidium parvum DNA replication in cell-free culture. Journal of Parasitology, 95, 1239–1242. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Lefebvre M, Razakandrainibe R, Schapman D, François A, Genty D, Galas L, Villena I, Favennec L & Costa D. 2023. Interactions between free-living amoebae and Cryptosporidium parvum: an experimental study. Parasite 30, 31.

All Figures

thumbnail Figure 1

Enumeration of Acanthamoeba castellanii in the presence or absence of Cryptosporidium parvum oocysts over time in the unfavorable phagocytosis condition (1A) and in the favorable phagocytosis condition (1C) and enumeration of C. parvum oocysts in the presence or absence of A. castellanii over time in the unfavorable phagocytosis condition (1B) and in the favorable phagocytosis condition (1D). p-value: *** < 0.001. (magnification ×200 for A. castellanii and ×400 for C. parvum).
In the text
thumbnail Figure 2

Percentage of Acanthamoeba castellanii cysts in the unfavorable phagocytosis condition (2A) and in the favorable phagocytosis condition (2B) and Vermamoeba vermiformis cysts in the unfavorable phagocytosis condition (2C) and in the favorable phagocytosis condition (2D) over time in the presence or absence of Cryptosporidium parvum oocysts. p-value: ** < 0.01; *** < 0.001.
In the text
thumbnail Figure 3

Evaluation of the infectivity of Cryptosporidium parvum oocysts over time in the presence of Acanthamoeba castellanii. p-value: *** < 0.01.
In the text
thumbnail Figure 4

Confocal imaging (A) and 3D projection (B) of co-incubated free-living amebae and Cryptosporidium parvum oocysts (green). Red arrows point to oocysts internalized in FLA.
In the text
thumbnail Figure 5

Images obtained from transmission electronic microscopy (TEM) of Cryptosporidium parvum sporozoites (5A), C. parvum oocysts (5B) and vegetative forms of Acanthamoeba castellanii (5C and 5D).
In the text
thumbnail Figure 6

Transmission electron microscopy (TEM) observations of vegetative forms of Acanthamoeba castellanii co-incubated with Cryptosporidium parvum. Red arrows show sporozoites inside trophozoites of A. castellanii (6A and 6B).
In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.