Table 2
Primers used for PCR amplification and sequencing; primers used only for sequencing are indicated by an asterisk. 28S = a portion of the large subunit ribosomal RNA (rRNA) gene, 18S = a portion of the small subunit rRNA gene, ITS = the internal transcribed spacer region of the rRNA gene. For primer orientation, + = sense, − = antisense.
| Parasite | Marker | Primer Name | Primer Orientation | Primer Sequence (5′–3′) | Reference |
|---|---|---|---|---|---|
| Acanthocephalan | 28S | LSU amplicon 1 forward | + | CAAGTACCGTGAGGGAAAGTTGC | [39] |
| LSU amplicon 2 reverse | – | CTTCTCCAACKTCAGTCTTCAA | [39] | ||
| LSU amplicon 3 forward | + | CTAAGGAGTGTGTAACAACTCACC | [39] | ||
| LSU amplicon 4 reverse | – | CTTCGCAATGATAGGAAGAGCC | [39] | ||
| LSU amplicon 1 reverse* | + | CAGCTATCCTGAGGGAAAC | [39] | ||
| LSU amplicon 2 forward* | – | ACCCGAAAGATGGTGAACTATG | [39] | ||
| LSU amplicon 3 reverse* | + | AATGACGAGGCATTTGGCTACCTT | [39] | ||
| LSU amplicon 4 forward* | – | GATCCGTAACTTCGGGAAAAGGAT | [39] | ||
| c72 | + | GTGCAGATCTTGGTGGTAGT | [28] | ||
| c9 | – | TACTTAAGAGAGTCATAGTT | [28] | ||
| 18S | SSU forward | + | AGATTAAGCCATGCATGCGT | [40] | |
| SSU reverse | – | GCAGGTTCACCTACGGAAA | [40] | ||
| SSU internal forward* | + | AGACGAACAACTGCGAAAGC | This study | ||
| SSU internal reverse* | – | AGTTGTTCGTCTTGCGGTGA | This study | ||
| ITS | BD1 | + | GTCGTAACAACGTTTCCGTA | [64] | |
| BD2 | – | TATGCTTAARTTCAGCGGGT | [64] | ||
| Digenean | 28S | LSU5 | + | TAGGTCGACCCGCTGAAYTTAAGCA | [53] |
| 28S_ECD2 | – | CTTGGTCCGTGTTTCAAGACGGG | [96] | ||
| ITS2 | GA1 | + | AGAACATCGACATCTTGAAC | [13] | |
| ITS2-2 | – | CCTGGTTAGTTTCTTTTCCTCCGC | [30] |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.