Open Access
Issue
Parasite
Volume 29, 2022
Article Number 54
Number of page(s) 7
DOI https://doi.org/10.1051/parasite/2022054
Published online 09 November 2022

© C. Kitajima et al., published by EDP Sciences, 2022

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Worms of the genus Setaria are mosquito-borne filarial nematodes found in the abdominal cavity of cattle and other ungulates. Setaria digitata, S. labiatopapillosa, and S. marshalli infect cattle, in which adult worms are generally nonpathogenic. However, infective larvae transmitted by mosquitoes to non-natural hosts, including goats, sheep, and horses, fail to migrate to the site of infection and cause cerebrospinal seteriasis, a serious and often fatal neuropathological disorder [6, 8].

Setaria marshalli may show transplacental infection in cattle and is typically detected in calves younger than two years old [2, 15]. Adult worms inhabiting the abdominal cavity of calves can cause fibrinous inflammation in the host diaphragm, peritoneum, and omentum [2]. The unique life cycle of the species is highlighted by the congenital intrauterine infection of cow fetuses [13]. However, studies on the pathogenicity of Setaria parasites are limited due to the lack of clear symptoms being present in definitive hosts [9], and basic information regarding the parasite is required, including its prevalence in calves [16].

Setaria digitata, S. labiatopapillosa, and S. marshalli can be differentiated based on morphological features [2, 4, 7, 8, 10, 11, 13, 14]. However, misidentification may occur without specialized knowledge and parasitological techniques [13]. Moreover, no DNA sequence for S. marshalli is available in the International Nucleotide Sequence Database (INSD). Therefore, it is important to establish a precise DNA barcode for this species to enable further epidemiological studies using molecular tools. Furthermore, such genetic information is valuable to clarify the phylogenetic relationships between S. marshalli and its congeners.

Here, filarial nematodes obtained from a calf in Japan were identified as S. marshalli based on morphological features. Moreover, the cytochrome oxidase subunit I (COI) of the mitochondrial DNA (mtDNA) was sequenced for the first time to establish a DNA barcode that can be used for species identification as well as to evaluate the phylogenetic relationships between Setaria nematodes.

Materials and methods

This study was conducted in strict accordance with the recommendations of the Guide for the Care and Use of Laboratory Animals of Iwate University. The study protocol was approved by the Committee on the Ethics of Animal Experiments of Iwate University (permission No. A201944).

Seven filarial nematodes (one male and six females) were collected from the abdominal cavity of a 2-month-old male calf (Holstein, born in Morioka, Iwate, Japan) necropsied in January 2021. The worms were killed and uncoiled in hot water to preserve their morphology and stored in 70% ethanol. Morphological identification was performed using one male and two females. After measuring the total length of each worm, a small piece of the midbody was cut for DNA extraction. The remaining parts were cleared in lactophenol (40 mL glycerin, 20 mL lactic acid, 20 mL phenol, and 20 mL distilled water). Morphological structures at the anterior and posterior ends of the worms were observed using a light microscope and measured using ImageJ software [12]. The results of morphological analyses were compared with those of previous studies [2, 8, 14].

Molecular analysis was performed for all seven worms. DNA was extracted from samples using a High Pure polymerase chain reaction (PCR) Template Preparation Kit (Roche, Mannheim, Germany), following the manufacturer’s instructions, and stored at −20 °C prior to analysis. A partial COI region of the mitochondrial genome was amplified by PCR reactions using the following primers: COIintF (5′–TGATTGGTGGTTTTGGTAA–3′) and COIintR (5′–ATAAGTACGAGTATCAATATC–3′) [1]. PCR reactions were performed in 25 μL consisting of 2 μL of DNA template, 0.75 μL of each primer (10 μM), 12.5 μL of 2 × Gflex buffer, and 0.625 U of Tks Gflex DNA polymerase (Takara Bio Inc, Shiga, Japan). PCR cycling conditions were as follows: denaturation at 94 °C for 60 s; 40 cycles of 98 °C for 10 s, 52 °C for 15 s, and 68 °C for 30 s; followed by preservation at 10 °C. The PCR products were purified using a NucleoSpin Gel and PCR Clean-up Kit (Takara Bio Inc, Shiga, Japan) and directly sequenced in both directions using a Big Dye Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA) on a 3500 Genetic Analyzer (Applied Biosystems). The representative sequence was deposited at the INSD under the accession number LC719467.

The obtained COI sequences were aligned with those of Setaria worms found in the INSD using GENETYX v15 (Genetyx, Tokyo, Japan). A maximum likelihood (ML) phylogenetic tree was constructed using MEGA-X software [5], with the COI sequence of Wuchereria bancrofti (AJ271612) used as an outgroup. MEGA-X determined the Tamura–Nei model (+ G) to be the best fit for our dataset and we used it for ML phylogenetic tree construction. Nonparametric bootstrap replication (1000 replicates) was applied to assess nodal support of the phylogeny.

Results

The anterior end of each worm was enclosed by a peri-buccal crown with cuticular projections (denticles). The females and male had bifid (Fig. 1A) and simple (Fig. 1B) lateral lips, respectively. The esophagus comprised anterior muscular and posterior glandular parts (Figs. 2A and 2B). The vulva of females was at the esophageal region (Fig. 2C). The posterior end was loosely coiled in females (Fig. 3A) and tightly coiled in the male (Fig. 3B). The caudal end of females possessed a terminal knob with several spines and a pair of lateral caudal appendages (Fig. 3C). In contrast, the caudal end of the male displayed four pairs of precloacal papillae, a single median papilla anterior to the cloaca, four pairs of post-cloacal papillae, and lateral caudal appendages on both sides (Figs. 3D and 3E). Moreover, there was slight asymmetry in the arrangement of both pre- and post-cloacal papillae in the male (Figs. 3D and 3E). The right and left spicules of the male differed in length and shape, with the right one being short and stout and the left one being long and slender with a pointed tip (Figs. 3F and 3G). Based on the morphological features described above, the filarial nematodes obtained in this study were identified as S. marshalli. The morphometry of the parasites along with those of S. marshalli from previous studies are shown in Table 1, while that of S. digitata and S. labiatopapillosa are presented in Table S1. Setaria marshalli can be distinguished from these two congeneric species by the shape of the lateral lips (bifid) in females and by the numbers and positions of papillae at the caudal ends of males.

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

(A) Lateral lips of a female and (B) a male nematode.

Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Esophagus of a nematode. (A) The border between (a) the muscular and (b) the glandular part of the esophagus. (B) The border between (b) the posterior end of the glandular part of the esophagus and (c) the intestinal canal. (C) The anterior esophagus of a female. Arrow indicates the vulval opening.

Thumbnail: Figure 3 Refer to the following caption and surrounding text. Figure 3

General view of the posterior parts of the nematodes. (A) A female and (B) male nematode. (C) Arrowheads indicate a pair of lateral caudal appendages of a female. (D) The cloacal anterior side of a male with four pairs of precloacal papillae (arrowheads) and one median papilla anterior to the cloaca (arrow). (E) The cloacal posterior side of a male with four pairs of post-cloacal papillae (arrowheads) and a pair of lateral caudal appendages (arrows). (F) (a) The right and (b) left spicules of the posterior end of a male. (G) The right spicule of a male.

Table 1

Morphological characteristics of Setaria marshalli.

Partial sequences (596 bp) of the COI of the seven nematodes were identical, and they were most similar to that of S. cervi (MK360913) (545/596 bp, identity: 91%). The single nucleotide polymorphisms (SNPs) detected among the congeners are shown in Figure S1. However, nodal supports within the ML phylogenetic tree (Fig. 4) were low.

Thumbnail: Figure 4 Refer to the following caption and surrounding text. Figure 4

Maximum likelihood (ML) phylogenetic tree based on nucleotide sequences of mitochondrial DNA of the cytochrome oxidase subunit I (COI) region. Setaria marshalli is shown in bold red. All sequences of the species obtained in this study were identical and deposited at the INSD under accession No. LC719467.

Discussion

The measurements and morphological characteristics of the worms (Table 1) were consistent with those described for S. marshalli in previous studies [8, 14], except for the measurement of the right spicule (Table 1). However, the study referred to [14] provided a mean value for this structure, whereas the right spicule was measured from a single male specimen in the present study. Therefore, such a mismatch in results is a product of individual differences among worms.

The mtDNA sequence of the COI region is a useful species differentiation marker for S. marshalli; it was identical among all the samples and displayed adequate differences (545/596 bp) to that of the most closely related species, S. cervi (Fig. S1). This DNA barcoding of S. marshalli will play an important role in further epidemiological studies.

The phylogenetic relationships between S. marshalli and other Setaria species were analyzed for the first time. However, their relationships remain unclear because nodal supports within the Setaria clade were too low (Fig. 4). Further analyses that use longer sequences are required to reveal the relationships among Setaria nematodes.

In fact, the partial sequence of the COI region used in this study completely matched that section of the complete mitochondrial genome of S. labiatopapillosa (MH937750), as found in the INSD [3]. However, as there were no morphological species identification or morphometric measurements of organs in the previous study [3], it is likely that S. marshalli was misidentified as S. labiatopapillosa. Therefore, DNA analysis should not be performed without accompanying accurate morphological identification. It is extremely important to conduct morphological and molecular analyses simultaneously to obtain accurate molecular information on worms.

In conclusion, we performed molecular characterization for S. marshalli for the first time, and an accurate DNA barcode was successfully obtained for the species. The results of the present study will contribute to epidemiological surveys of Setaria nematodes in the future.

Supplementary files

Thumbnail: Figure S1: Refer to the following caption and surrounding text. Figure S1:

Alignment of mitochondrial DNA of the cytochrome oxidase subunit I (COI) region. The nucleotide sequences used in the maximum likelihood (ML) tree were included. A dot in the alignment indicates that the sequence was identical to that of S. marshalli.

Table S1: Morphological characteristics and measurements of the Setaria nematodes. Access Supplementary Material

Acknowledgments

This work was supported by the Tohoku Initiative for Fostering Global Researchers for Interdisciplinary Sciences (TI FRIS) of the MEXT’s Strategic Professional Development Program for Young Researchers. The authors declare that they have no competing interests.

References

  1. Casiraghi M, Anderson TJ, Bandi C, Bazzocchi C, Genchi C. 2001. A phylogenetic analysis of filarial nematodes: comparison with the phylogeny of Wolbachia endosymbionts. Parasitology, 122, 93–103. [CrossRef] [PubMed] [Google Scholar]
  2. Fujii T, Hayashi T, Ishimoto A, Takahashi S, Asano H, Kato T. 1995. Prenatal infection with Setaria marshalli (Boulenger 1921) in cattle. Veterinary Parasitology, 56, 303–309. [CrossRef] [PubMed] [Google Scholar]
  3. Gao J-F, Hou M-R, Cui Y-C, Shi T-R. 2019. The complete mitochondrial genome of Setaria labiatepapillosa (Spirurida: Setariidae). Mitochondrial DNA Part B, 4, 1632–1633. [CrossRef] [Google Scholar]
  4. Itagaki S, Taniguchi M. 1954. Studies on the life-history of Setaria digitata (Linstow, 1906) Railliet et Henry, 1909, Parasitic filarid, and its pathogenicity against domestic animals (sheep, goat and horse). Medical Entomology and Zoology, 4, 89–100 (in Japanese). [CrossRef] [Google Scholar]
  5. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. 2018. MEGA X: Molecular evolutionary genetics analysis across computing platforms. Molecular Biology and Evolution, 35, 1547–1549. [CrossRef] [PubMed] [Google Scholar]
  6. Lee H, Hwang H, Ro Y, Kim JH, Lee K, Choi E, Bae Y, So B, Lee I. 2021. Setaria digitata was the main cause of equine neurological ataxia in Korea: 50 cases (2015–2016). Journal of Veterinary Medical Science, 83, 869–875. [CrossRef] [PubMed] [Google Scholar]
  7. Mrifag R, Lemrabott MA, El Kharrim K, Belghyti D, Basco LK. 2021. Setaria labiatopapillosa (Filarioidea, Nematoda) in Moroccan cattle: atypical localization and morphological characterization of females and microfilariae by light and scanning electron microscopy. Parasitology Research, 120, 911–918. [CrossRef] [PubMed] [Google Scholar]
  8. Nakano H, Tozuka M, Ikadai H, Ishida H, Goto R, Kudo N, Katayama Y, Muranaka M, Anzai T, Oyamada T. 2007. Morphological survey of bovine Setaria in the abdominal cavities of cattle in Aomori and Kumamoto Prefectures, Japan. Journal of Veterinary Medical Science, 69, 413–415. [CrossRef] [PubMed] [Google Scholar]
  9. Ohishi I. 1995. Setaria, in Veterinary Clinical Parasitology. Parasitology Ecovc, Editor. Asakura publishing: Tokyo. p. 165–176 (in Japanese). [Google Scholar]
  10. Raju Kumar L, Udaya Kumar M. 2016. Ultrastructural studies on Setaria digitata by scaning electron microscopy. Journal of Parasitic Diseases, 40, 1199–1203. [CrossRef] [PubMed] [Google Scholar]
  11. Rhee JK, Choi EY, Park BK, Jang BG. 1994. Application of scanning electron microscopy in assessing the prevalence of some Setaria species in Korean cattle. Korean Journal of Parasitology, 32, 1–6. [CrossRef] [PubMed] [Google Scholar]
  12. Schneider CA, Rasband WS, Eliceiri KW. 2012. NIH Image to ImageJ: 25 years of image analysis. Nature Methods, 9, 671–675. [CrossRef] [PubMed] [Google Scholar]
  13. Shoho C, Uni S. 1977. Scanning electron microscopy (SEM) of some Setaria species (Filarioidea, Nematoda). Zeitschrift für Parasitenkunde, 53, 93–104. [CrossRef] [PubMed] [Google Scholar]
  14. Taniguchi M. 1953. Genus of Setaria. Journal of Veterinary Medicine, 775–778 (in Japanese). [Google Scholar]
  15. Tung KC, Lai CH, Ooi HK, Yang CH, Wang JS. 2003. Cerebrospinal setariosis with Setaria marshalli and Setaria digitata infection in cattle. Journal of Veterinary Medical Science, 65, 977–983. [CrossRef] [PubMed] [Google Scholar]
  16. Wee SH, Jang H, Joo HD, Kang YB, Lee CG. 1996. Setaria marshalli infection in neonatal calves. Korean Journal of Parasitology, 34, 207–210. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Kitajima C, Ichijo T & Ichikawa-Seki M. 2022. The first genetic characterization of Setaria marshalli (Nematoda, Spirurida) with reliable DNA barcoding based on a mitochondrial genetic marker. Parasite 29, 54.

All Tables

Table 1

Morphological characteristics of Setaria marshalli.

All Figures

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

(A) Lateral lips of a female and (B) a male nematode.

In the text
Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Esophagus of a nematode. (A) The border between (a) the muscular and (b) the glandular part of the esophagus. (B) The border between (b) the posterior end of the glandular part of the esophagus and (c) the intestinal canal. (C) The anterior esophagus of a female. Arrow indicates the vulval opening.

In the text
Thumbnail: Figure 3 Refer to the following caption and surrounding text. Figure 3

General view of the posterior parts of the nematodes. (A) A female and (B) male nematode. (C) Arrowheads indicate a pair of lateral caudal appendages of a female. (D) The cloacal anterior side of a male with four pairs of precloacal papillae (arrowheads) and one median papilla anterior to the cloaca (arrow). (E) The cloacal posterior side of a male with four pairs of post-cloacal papillae (arrowheads) and a pair of lateral caudal appendages (arrows). (F) (a) The right and (b) left spicules of the posterior end of a male. (G) The right spicule of a male.

In the text
Thumbnail: Figure 4 Refer to the following caption and surrounding text. Figure 4

Maximum likelihood (ML) phylogenetic tree based on nucleotide sequences of mitochondrial DNA of the cytochrome oxidase subunit I (COI) region. Setaria marshalli is shown in bold red. All sequences of the species obtained in this study were identical and deposited at the INSD under accession No. LC719467.

In the text
Thumbnail: Figure S1: Refer to the following caption and surrounding text. Figure S1:

Alignment of mitochondrial DNA of the cytochrome oxidase subunit I (COI) region. The nucleotide sequences used in the maximum likelihood (ML) tree were included. A dot in the alignment indicates that the sequence was identical to that of S. marshalli.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.