Open Access
Research Article

Table 1

Primers used for RT-qPCR in this study.

Target Source (Genbank) Target gene Primer sequence (5′ – 3′) Amplicon length (bp) Average Tm (°C) Amplification efficiency (%)
TrxR-L_fw XM_004353581 thioredoxin reductase 1 GGATTCGACCAACAGCTCG 212 59.5 96.3
TrxR-L_rev cytoplasmic, putative GGATTCGACCAACAGCTCG 59.5
TrxR-S_fw M_004351629 thioredoxin-disulfide CTCTCGAACCCCAAGATC 182 56.3 97.3
TrxR-S_rev reductase CACCTGACCATTCAGGAAC 57.5
Trx-1_fw XM_004335461 thioredoxin-1, putative GGACTTCTTTGCCACGTG 184 56.3 95.5
Trx-1_rev GCACCTTGCTGCCGTTC 57.3
Prx-2_fw XM_004333592 peroxiredoxin 2 GACACACCTACCGTGGTC 226 58.4 77.9
Prx-2_rev GTTGACCTTCTCGAAGTAGG 58.4
Prx-3_fw XM_004348492 2cys peroxiredoxin CAACGACTTGCCAGTGGG 157 58.4 94.1
Prx-3_rev CCTTGAAGTACTCCTTGGAC 58.4
Grx-1_fw XM_004339700 glutaredoxin, putative CGCCAAGAACACCGTTATG 203 57.5 90.3
Grx-1_rev CCAATGTGCTCACTGTCGATG 56.3
Grx-2_fw XM_004339719 glutaredoxin, putative GGAGATGAGAGCGTTCAG 184 56.3 98.8
Grx-2_rev CTCTTGGCCTGCATCTCG 58.4
GR_fw XM_004338198 glutathione-disulfide CGACACTCTCTACAACAACC 149 59.5 90.6
GR_rev reductase CTTCTCGTCACGCTTGGAC 61.6
Gpx_fw XM_004335951 glutathione peroxidase Hyr1 CTGCAACCAGTTCGGCAG 193 58.4 91.7
Gpx_rev CGAAGTTCCACTTGATGCG 57.5
18S_fw 18S-rRNA-gene CCCAGATCGTTTACCGTGAA 180 58.4 97.5
18S_rev TAAATATTAATGCCCCCAACTATCC 60.9
HPRT_fw XM_004337011 hypoxanthine-guanine phosphoribosyltransferase GGAGCGGATCGTTCTCTG 201 58.4 102
HPRT_rev ATCTTGGCGTCGACGTGC 58.4

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.