Open Access
Issue
Parasite
Volume 29, 2022
Article Number 8
Number of page(s) 5
DOI https://doi.org/10.1051/parasite/2022009
Published online 11 February 2022

© E. Čisovská Bazsalovicsová et al., published by EDP Sciences, 2022

Licence Creative CommonsThis is an Open Access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Introduction

Sparganosis is a food- and water-borne parasitic zoonosis caused by tapeworm larvae of the genus Spirometra Faust, Campbell & Kellogg, 1929 (Cestoda: Diphyllobothriidea). The first larval stage (procercoid) of these tapeworms develops in the first intermediate hosts, copepods (Cyclops sp.). The second intermediate or paratenic hosts are many wild and domesticated vertebrates, including amphibians, reptiles, birds, and mammals, in which plerocercoids (spargana) develop mainly in subcutaneous tissues, but also in musculature and internal organs [14]. The definitive hosts are wild and domesticated carnivores. Humans become infected either by drinking water containing infected copepods or by consuming plerocercoids in raw or inadequately cooked meat of the second intermediate or paratenic host [9, 14].

Taxonomy of the genus Spirometra has always been complicated due to high intraspecific variability, uniformity of most diphyllobothriid taxa, and lack of reliable species-specific morphological markers [14]. A recent phylogenetic analysis of members of the genus Spirometra based on the sequences of the mitochondrial cytochrome c oxidase subunit 1 gene (cox1 mtDNA) revealed the presence of six molecularly well-defined and geographically distinct lineages (lin.) corresponding to separate species, namely Spirometra erinaceieuropaei (Rudolphi 1819) (European lin.), Spirometra decipiens (Diesing, 1850) complex 1 (American lin. 1), Spirometra decipiens complex 2 (American lin. 2), Spirometra folium (Diesing, 1850) (African lin.), Spirometra mansoni (Cobbold, 1883) (Eurasian, Oceanic, and African lin.), and Spirometra sp. 1 (Asian lin. 2) [14].

The type species S. erinaceieuropaei (syn. Spirometra erinacei) was described more than 200 years ago on the basis of plerocercoids found in the European hedgehog (Erinaceus europaeus) at an unknown locality (probably Brandenburg or former Prussia) in Europe [19]. The geographic distribution of this species was long considered cosmopolitan, because it was misidentified with the widespread but genetically distinct S. mansoni, which occurs in East and Southeast Asia, namely China, Thailand, Vietnam, Laos, Myanmar, India, Indonesia, Japan, and also Australia [14]. Even though a recent comprehensive phylogenetic study revealed that Asian and Australian Spirometra specimens are related to S. mansoni, its occurrence was surprisingly confirmed by molecular methods from edible frogs (Pelophylax esculentus) in Romania (south-eastern Europe). On the other hand, S. erinaceieuropaei was found to be restricted exclusively to north-eastern Europe [14].

In the past two decades, the occurrence of S. erinaceieuropaei in wild carnivores, mustelids, wild boars, and snakes has been reported in several northern and eastern European countries, mainly in the vicinity of the Białowieża National Park in eastern Poland [49, 14] and in western Belarus [22, 24, 25], but also in Serbia [17], Estonia [10], Latvia [1], Ukraine, and Finland [11, 14, 15]. The genetic structure of S. erinaceieuropaei based on the mitochondrial cox1 gene is so far available only for the populations from Poland and Latvia [1, 7] and only single sequences were published for tapeworms from Finland and Ukraine [14, 15].

The main objective of the current study was to evaluate, for the first time, genetic interrelationships among different European populations of S. erinaceieuropaei using complete cox1 sequences. Since only three specimens from Finland have been sequenced so far, additional isolates from European lynx (Lynx lynx) from three localities in Finland were used to obtain a broader dataset on S. erinaceieuropaei from this northernmost locality of its occurrence.

Materials and methods

Fifteen immature and adult tapeworms were isolated from three Eurasian lynx from southern Finland in 2008 and 2010. A single tapeworm was obtained from a lynx that was legally hunted near Metsäkylä village in Hamina municipality, another specimen originated from a dead lynx found in Savonlinna municipality, and 13 tapeworms were isolated from a lynx near Kallasti farm in Ylämaa municipality, which was euthanized due to severe injury. Material was provided by the Natural Resources Institute and the Finnish Food Safety Authority EVIRA with special permissions of hunting rules and regulations, following ethics guidelines. Tapeworms were washed in saline solution and preserved in 70% ethanol for further analysis.

All specimens were initially identified as diphyllobothriid tapeworms (genera Dibothriocephalus and/or Spirometra) based on their external morphological characteristics. Taxonomic identification of diphyllobothriids is quite complicated due to the numerous unstable and overlapping morphological characters of each taxon, making the definition of species boundaries difficult or even impossible [14]. Moreover, tapeworms recovered from post mortem hosts were either immature or even fragmented and decomposed, making correct identification impossible [13, 21]. Therefore, accurate taxonomic determination must rely on species-specific molecular markers.

Genomic DNA was isolated from 20 mg of tissue of the distal part of tapeworm using a QIAamp® DNA Kit (QIAGEN, Hilden, Germany), according to the manufacturer’s instructions, diluted in deionized water and stored at −20 °C. Details of PCR amplification, sequencing, sequence assembly and sequence analyses were published previously [1]. The anterior part of each tapeworm was stained and mounted on microscopic slides as morphological voucher and was deposited in the Helminthological Collection of the Institute of Parasitology, Biology Centre of the Czech Academy of Sciences, České Budějovice, Czech Republic (IPCAS No. C-101).

The initial molecular genotyping was based on the partial sequences (640 bp) of the large subunit of the ribosomal RNA gene (lsrDNA). The aim was to distinguish between the genera Spirometra and Dibothriocephalus, which could infect Eurasian lynx in Finland. PCR amplification of the lsrDNA was performed using the forward primer LSU-5 (5′–TAGGTCGACCCGCTGAAYTTAAGCA–3′) and the reverse primer 1500R (5′–GCTATCCTGAGGGAAACTTCG–3′) [18]. The 5′-end of the lsrDNA was sequenced from both directions using the LSU-5 primer and two internal primers, 300F (5′–CAAGTACCGTGAGGGAAAGTTG–3′) and 400R (5′–GCAGCTTGACTACACCCG–3′) [18]. Fourteen of the fifteen tapeworms had identical lsrDNA sequence structure, and the lsrDNA of one specimen from Kallasti differed by one mutation (99.8% pairwise sequence identity). The sequences were deposited in the GenBank, EMBL and DDBJ databases under accession numbers MW365689MW365702. They showed 99.8–100% similarity/identity with the lsrDNA of S. erinaceieuropaei from Eurasian lynx (MT313931) and grey wolf (MT321262) from Latvia [1].

To confirm these results, all tapeworms were also analysed using complete mitochondrial cox1, which has been showed to be the most reliable identification tool for diphyllobothriids [14]. PCR amplification and sequencing were performed using the primers Diphyllo-Cox1-F (5′–TAGACTAAGTGTTTTCAAAACACTA–3′) and Diphyllo-Cox1-R (5′–ATAGCATGATGCAAAAGG–3′) [27]. Two internal primers, DCox1-R2 (5′–AAACACCGGCTCACGTAAAG–3′) and Cox1-R3 (5′–CGCAAATGCCGAATAAAGAG–3′) [7] were used to sequence the complete cox1 from both directions. The sequences were deposited in the GenBank, EMBL and DDBJ databases under accession numbers MW357422, MW357425MW357433, MW357435MW357437, and MW357539MW357540.

The newly obtained data from 15 S. erinaceieuropaei from Finland were used in the study of genetic interrelationships among populations together with the previously published data, namely: (i) 50 cox1 haplotypes (Ha1–Ha50; MK523394MK523443 and MT131826MT131829) detected in 319 individuals from canids, mustelids, and reptiles from different localities in north-eastern Poland [7, 14]; (ii) 12 cox1 haplotypes (CO1-Ha1-Ha12/LV; MT941768MT941770 and MT951146MT951155) detected in three individuals from Eurasian lynx and nine specimens of grey wolf (Canis lupus) from Latvia [1]; (iii) one haplotype (MT131830) detected in a single tapeworm from grey wolf from Chernobyl in Ukraine [14]; and (iv) one haplotype (MT131825) of single tapeworm from Eurasian lynx from Kallasti in Finland [14] (Fig. 1, blue points). Genetic variability among populations from four European countries was visualised by a haplotype network using PopArt [16] with the TCS 1.21 algorithm [2].

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Scheme of the distribution of Spirometra erinaceieuropaei (S. e.) from Finland (FI), Poland (PL), Latvia (LV), and Ukraine (UA) analysed molecularly in the current work (blue points) and its findings from neighbouring Estonia (EE), Belarus (BY), and Ukraine (UA) based on its morphology (green points). The map was obtained from https://d-maps.com.

Results

Analysis of the complete cox1 sequences (1566 bp) of 15 S. erinaceieuropaei specimens from Finland revealed a high degree of sequence similarity (99.6–99.9%) within the population. Seven cox1 haplotypes CO1–Ha1–Ha7/FI were determined; haplotypes CO1–Ha2/FI and CO1–Ha4/FI were each detected in a single tapeworm, while haplotypes CO1–Ha5–7/FI were each shared by two individuals. Three tapeworms possessed CO1–Ha3/FI and four individuals were characterised by CO1–Ha1/FI.

The haplotype network based on the complete cox1 sequences showed a star-like pattern and provided pilot information on the interrelationships of S. erinaceieuropaei from north-eastern Europe (Fig. 2A). The entire dataset contained 70 variable characters, 33 of which were parsimony informative. No specific subdivision of lineages depending on locality was detected. Several haplotypes, including the central haplotype, were shared by S. erinaceieuropaei from Finland, Latvia and Poland, countries of the Baltic region. The tapeworms from Finland and Latvia shared one haplotype, while specimens from Finland and Poland shared two haplotypes (Fig. 2A). This suggests that S. erinaceieuropaei from Finland, Latvia and Poland form a common group referred to as “the Baltic lineage”. In contrast, the single haplotype of S. erinaceieuropaei from Ukraine was on a separate mutational pathway displayed by six substitutions (Fig. 2A), indicating a genetic distance between the tapeworms from Ukraine and the Baltic lineage. Datasets from Finland and Latvia were analysed separately in an individual haplotype network, confirming an overlapping genetic structure of S. erinaceieuropaei from these two countries (Fig. 2B).

Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Haplotype network diagram based on mitochondrial cox1 haplotypes of Spirometra erinaceieuropaei from: (A) Finland (current data), Latvia [1], Poland [7, 14], and Ukraine [14]; and (B) specifically for Finland and Latvia. The sizes of haplotypes are proportional to the number of samples. Codes denote haplotype identifiers detected in individuals from Finland. Each hatch mark represents a single mutation, while black dots symbolise intermediate missing or unsampled haplotypes.

Discussion

The current study provided pilot data on the genetic interrelationships of European populations of S. erinaceieuropaei and opened several perspectives for future studies. One of the challenges is to determine the geographic boundaries of the Baltic lineage. In addition to Finland, Latvia, and Poland, tapeworms morphologically identified as S. cf. erinaceieuropaei were also detected in a stray cat from Estonia [10] and in several mammals in south-western Belarus [23, 24, 25, 26] (Fig. 1, green points). Moreover, the white spot on the map of the north-eastern distribution of S. erinaceieuropaei is Lithuania (Fig. 1, LT), the only Baltic country for which no data on this tapeworm are available. Screening and molecular genotyping of S. erinaceieuropaei from the above mentioned countries would provide a more complex picture of its geographic distribution in north-eastern Europe and better specification of the Baltic lineage.

Haplotype diversity detected in the current work decreased from the southern geographical regions towards the northern ones. The highest number of haplotypes (50) was reported from Poland [7], followed by 12 haplotypes in Latvia [1] and seven in Finland (current work). However, these data are based on a rather unequal number of analysed samples (319/Poland; 13/Latvia; 15/Finland) and require further studies supplemented with more material.

The specific cox1 haplotype of a tapeworm from Ukraine provided the preliminary evidence for a different genetic structure of S. erinaceieuropaei from Eastern Europe. Since the data are based on only one specimen, no decisive conclusions can be drawn about genetic interrelationships between the tapeworms from Ukraine and the Baltic region. It is obvious that molecular analysis based on a broader set of samples is necessary to determine the diversity of Spirometra from different Eastern European countries. In particular, S. cf. erinaceieuropaei was morphologically confirmed in wildlife in the northern part of Ukraine [11], in the Białowieża Forest and Biarezinski Biosphere Reserve in Belarus [23, 24, 25, 26] (Fig. 1, green points), and in several localities in Russia (e.g. Tver, Moscow region and Astrakhan Reserve) [3, 12].

The numerous findings of S. erinaceieuropaei in wildlife from different European regions acquired after the year 2000 have demonstrated the importance of ongoing screening of the causative agents of sparganosis for a better understanding of their current distribution in Europe. Reliable molecular markers must be applied to determine whether south-eastern Europe is a region with exclusive presence of S. mansoni, or a place with sympatric occurrence of S. mansoni and S. erinaceieuropaei. Their overlapping distribution cannot be ruled out since the latter species has been confirmed morphologically in wild boars in Serbia [17, 20] and in forest cats from the Odesa region of south-eastern Ukraine [11]. It is now evident that a multidisciplinary approach using morphological, biological and molecular methods needs to be applied for accurate determination of spatial distribution of S. erinaceieuropaei and S. mansoni in Europe and an assessment of the interrelationships among their populations.

Conflict of interest

The authors declare that they have no conflict of interest.

Acknowledgments

This work was supported financially by the Slovak Research and Development Agency under contract APVV-15-0004, Slovak Grant Agency VEGA 2/0027/21, Bilateral Mobility Project SAS-ASCR 21-11 and the EXPRO programme of the Czech Science Foundation, project no. 19-28399X.

References

  1. Bagrade G, Králová-Hromadová I, Bazsalovicsová E, Radačovská A, Kołodziej-Sobocińska M. 2021. The first records of Spirometra erinaceieuropaei (Cestoda: Diphyllobothriidae), a causative agent of human sparganosis, in Latvian wildlife. Parasitology Research, 120, 365–371. [CrossRef] [PubMed] [Google Scholar]
  2. Clement M, Posada D, Crandall KA. 2000. TCS: a computer program to estimate gene genealogies. Molecular Ecology, 9, 1657–1659. [CrossRef] [PubMed] [Google Scholar]
  3. Dubinina MN. 1951. On the biology and distribution of Diphyllobothrium erinacei-europaei (Rud., 1819) Iwata, 1933. Zoologicheskii Zhurnal, 30, 421–429. [Russian]. [Google Scholar]
  4. Kołodziej-Sobocińska M, Tokarska M, Kowalczyk R. 2014. The first report of sparganosis (Spirometra sp.) in Eurasian badger (Meles meles). Parasitology International, 63, 397–399. [CrossRef] [PubMed] [Google Scholar]
  5. Kołodziej-Sobocińska M, Miniuk M, Ruczyńska I, Tokarska M. 2016. Sparganosis in wild boar (Sus scrofa) – implications for veterinarians, hunters, and consumers. Veterinary Parasitology, 227, 115–117. [CrossRef] [PubMed] [Google Scholar]
  6. Kołodziej-Sobocińska M, Yakovlev Y, Schmidt K, Hurníková Z, Ruczyńska I, Bednarski M, Tokarska M. 2018. Update of the helminth fauna in Eurasian lynx (Lynx lynx) in Poland. Parasitology Research, 117, 2613–2621. [CrossRef] [PubMed] [Google Scholar]
  7. Kołodziej-Sobocińska M, Stojak J, Kondzior E, Ruczyńska I, Wójcik JM. 2019. Genetic diversity of two mitochondrial DNA genes in Spirometra erinaceieuropaei (Cestoda: Diphyllobothriidae) from Poland. Journal of Zoological Systematics and Evolutionary Research, 57, 764–777. [CrossRef] [Google Scholar]
  8. Kondzior E, Tokarska M, Kowalczyk R, Ruczyńska I, Sobociński W, Kołodziej-Sobocińska M. 2018. The first case of genetically confirmed sparganosis (Spirometra erinaceieuropaei) in European reptiles. Parasitology Research, 117, 3659–3662. [CrossRef] [PubMed] [Google Scholar]
  9. Kondzior E, Kowalczyk R, Tokarska M, Borowik T, Zalewski A, Kołodziej-Sobocińska M. 2020. Multispecies reservoir of Spirometra erinaceieuropaei (Cestoda: Diphyllobothriidae) in carnivore communities in north-eastern Poland. Parasites & Vectors, 13, 560. [CrossRef] [PubMed] [Google Scholar]
  10. Konyaev SV, Syatkovskaya OS, Filimonova AY. 2011. The finding of adult form Spirometra erinacei from the cat in Estonia. Russian Veterinary Journal, 3, 40–41 [Russian]. [Google Scholar]
  11. Kornyushin V, Malyshko EI, Malega AM. 2011. The helminths of wild predatory mammals of Ukraine. Cestodes. Vestnik Zoologii, 45, 483–490. [Google Scholar]
  12. Kozlov DP. 1977. Guide for the determination of the helminths of carnivores of USSR. Leningrad: Nauka. [Google Scholar]
  13. Králová-Hromadová I, Radačovská A, Čisovská Bazsalovicsová E, Kuchta R. 2021. Ups and downs of infections with the broad fish tapeworm Dibothriocephalus latus in Europe from 1900 to 2020: part I. Advances in Parasitolology, 114, 75–166. [CrossRef] [Google Scholar]
  14. Kuchta R, Kołodziej-Sobocińska M, Brabec J, Młocicki D, Sałamatin R, Scholz T. 2021. Sparganosis (Spirometra) in Europe in the molecular era. Clinical Infectious Diseases, 72, 882–890. [CrossRef] [PubMed] [Google Scholar]
  15. Lavikainen A, Haukisalmi V, Deksne G, Holmala K, Lejeune M, Isomursu M, Jokelainen P, Näreaho A, Laakkonen J, Hoberg EP, Sukura A. 2013. Molecular identification of Taenia spp. in the Eurasian lynx (Lynx lynx) from Finland. Parasitology, 140, 653–662. [CrossRef] [PubMed] [Google Scholar]
  16. Leigh JW, Bryant D. 2015. PopART: full-feature software for haplotype network construction. Methods in Ecology and Evolution, 6, 1110–1116. [CrossRef] [Google Scholar]
  17. Nevolko OM, Litvinenko OP. 2014. Sparganosis in wild pigs. Veterinary Medicine, 99, 150–153. [Google Scholar]
  18. Olson PD, Cribb TH, Tkach VV, Bray RA, Littlewood DT. 2003. Phylogeny and classification of the Digenea (Platyhelminthes: Trematoda). International Journal for Parasitology, 33, 733–755. [CrossRef] [PubMed] [Google Scholar]
  19. Rudolphi CA. 1819. Entozoorum synopsis, cui accedunt mantissa duplex et indices locupletissimi. Berolini: Sumptibus Augusti Rücker. [CrossRef] [Google Scholar]
  20. Rukavina J, Džmurov N, Delič S. 1957. Larvae of Diphyllobothrium erinaceieuropaei in pigs. Veterinaria Sarajevo, 6, 46–55. [Google Scholar]
  21. Scholz T, Kuchta R, Brabec J. 2019. Broad tapeworms (Diphyllobothriidae), parasites of wildlife and humans: recent progress and future challenges. International Journal for Parasitology, Parasites and Wildlife, 9, 359–369. [CrossRef] [Google Scholar]
  22. Shimalov VV. 2009. Spirometrosis and sparganosis and other diphyllobothriases in the Republic of Belarus and their medical significance. Meditsinskaya Parazitologiya i Parazitarnye Bolezni, 3, 48–52 [Russian]. [Google Scholar]
  23. Shimalov VV, Shimalov VT. 2000. Helminth fauna of the wolf (Canis lupus Linnaeus, 1758) in Belorussian Polesie. Parasitology Research, 86, 163–164. [CrossRef] [PubMed] [Google Scholar]
  24. Shimalov VV, Shimalov VT. 2002a. Helminth fauna of the European polecat (Mustela putorius Linnaeus, 1758) in Belorussian Polesie. Parasitology Research, 88, 259–260. [CrossRef] [PubMed] [Google Scholar]
  25. Shimalov VV, Shimalov VT. 2002b. Helminth fauna of the racoon dog (Nyctereutes procyonoides Gray, 1834) in Belorussian Polesie. Parasitology Research, 88, 944–945. [CrossRef] [PubMed] [Google Scholar]
  26. Shimalov VV, Shimalov VT. 2003. Helminth fauna of the red fox (Vulpes vulpes Linnaeus, 1758) in southern Belarus. Parasitology Research, 89, 77–78. [PubMed] [Google Scholar]
  27. Yanagida T, Matsuoka H, Kanai T, Nakao M, Ito A. 2010. Anomalous segmentation of Diphyllobothrium nihonkaiense. Parasitology International, 59, 268–270. [CrossRef] [PubMed] [Google Scholar]

Cite this article as: Čisovská Bazsalovicsová E, Radačovská A, Lavikainen A, Kuchta R & Králová-Hromadová I. 2022. Genetic interrelationships of Spirometra erinaceieuropaei (Cestoda: Diphyllobothriidea), the causative agent of sparganosis in Europe. Parasite 29, 8.

All Figures

Thumbnail: Figure 1 Refer to the following caption and surrounding text. Figure 1

Scheme of the distribution of Spirometra erinaceieuropaei (S. e.) from Finland (FI), Poland (PL), Latvia (LV), and Ukraine (UA) analysed molecularly in the current work (blue points) and its findings from neighbouring Estonia (EE), Belarus (BY), and Ukraine (UA) based on its morphology (green points). The map was obtained from https://d-maps.com.

In the text
Thumbnail: Figure 2 Refer to the following caption and surrounding text. Figure 2

Haplotype network diagram based on mitochondrial cox1 haplotypes of Spirometra erinaceieuropaei from: (A) Finland (current data), Latvia [1], Poland [7, 14], and Ukraine [14]; and (B) specifically for Finland and Latvia. The sizes of haplotypes are proportional to the number of samples. Codes denote haplotype identifiers detected in individuals from Finland. Each hatch mark represents a single mutation, while black dots symbolise intermediate missing or unsampled haplotypes.

In the text

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.