Open Access
Research Article

Table 1

Primer and randomly amplified polymorphic DNA (RAPD) sequences used in this study.

Target Marker Primer name Primer sequence (5′–3′) Reference
Parasite ITS2 3S GGTACCGGTGGATCACGTGGCTAGTG [12]
ITS2-2 CCTGGTTAGTTTCTTTTCCTCCGC [20]
GA1 AGAACATCGACATCTTGAAC [5]
ITS2-2 CCTGGTTAGTTTCTTTTCCTCCGC [20]
28S 28S_300F CAAGTACCGTGAGGGAAAGTTG [59]
28S_ECD2 CTTGGTCCGTGTTTCAAGACGGG [59]
LSU5 TAGGTCGACCCGCTGAAYTTAAGCA [32]
1200R GCATAGTTCACCATCTTTCGG [32]
COI Dice1F TTWCNTTRGATCATAAG [46]
Dice11R GCWGWACHAAATTTHCGATC [61]
Host COI LCO1490Mba GTAGAACTAAYCATAARGATATTGG [43]
HCO2198Mba TAAACTTCTGGGTGRCCAAAAAAYCA [43]
RAPD E18 GGACTGCAGA [1]

ITS2 = second internal transcribed spacer region of the ribosomal RNA (rRNA) gene, 28S = large subunit rRNA gene, COI = cytochrome c oxidase I mitochondrial DNA.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.