Open Access

Table 1

Sequences of the primers used in this study.

GenBank accession Gene and primer sequence Target gene length
XM_002368164.2 T. gondii SAG1 (TgSAG1)
 Sense primer 5′–ATCGCCTGAGAAGCATCACTG–3′ 101 bp
 Antisense primer 5′–CGAAAATGGAAACGTGACTGG–3′
NM_007393.5 β-actin
 Sense primer 5′–GATGCAGAAGGAGATTACTG–3′ 91 bp
 Antisense primer 5′–ACCGATCCACACAGAGTA–3′
NM_001146325.1 TIGIT
 Sense primer 5′–GGCATGTCGCTTCAGTCTTC–3′ 139 bp
 Antisense primer 5′–CTCCCCTTGTAAATCCCACC–3′
NM_178687.2 CD226
 Sense primer 5′–ACCACATGGCTTTCTTGCTC–3′ 112 bp
 Antisense primer 5′–CAGCATGAGAGTTGGACCAG–3′

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.