Open Access
Table 2
Primer sequences targeting the metallopeptidase 10 (nas 10) locus, product size, and annealing temperature (T a/°C). In bold, a deliberate second mismatch.
| Name | Primer sequences (5′–3′) | Genotyping pattern (bp) | T a/°C |
|---|---|---|---|
| nas 10 | F: GATGTTCCTGCAAGTGATTG | 451 bp | 53 |
| R: CGCTATTAAGAGAGGGATCG | |||
| Primer set-1 | Out-F1: TATGGCAAATATTATTATCGTA | 373 bp (control fragment) | 49 |
| Out-R1: TATTTCCGACAGCAAACAA | 296 bp (T allele) | ||
| In-F1: GCATTGTACACTTCGTATATT | 117 bp (C allele) | ||
| In-R1: ATTTCTYCAGCAATCGTAAG | 373 bp (control fragment) | ||
| Primer set-2 | Out-F2: GAAAGACAGGTTCATCTCA | 321 bp (control fragment) | 49 |
| Out-R1: TATTTCCGACAGCAAACAA | 117 bp (G allele) | ||
| In-F2: AACGGATATGAATGATCCC | 216 bp (C allele) | ||
| In-R2: HAAATGAAAGTAGAAAGAATTTAC | 321 bp (control fragment) |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.