Open Access
Research Article

Table 2

Primer sequences targeting the metallopeptidase 10 (nas 10) locus, product size, and annealing temperature (T a/°C). In bold, a deliberate second mismatch.

Name Primer sequences (5′–3′) Genotyping pattern (bp) T a/°C
nas 10 F: GATGTTCCTGCAAGTGATTG 451 bp 53
R: CGCTATTAAGAGAGGGATCG
Primer set-1 Out-F1: TATGGCAAATATTATTATCGTA 373 bp (control fragment) 49
Out-R1: TATTTCCGACAGCAAACAA 296 bp (T allele)
In-F1: GCATTGTACACTTCGTATATT 117 bp (C allele)
In-R1: ATTTCTYCAGCAATCGTAAG 373 bp (control fragment)
Primer set-2 Out-F2: GAAAGACAGGTTCATCTCA 321 bp (control fragment) 49
Out-R1: TATTTCCGACAGCAAACAA 117 bp (G allele)
In-F2: AACGGATATGAATGATCCC 216 bp (C allele)
In-R2: HAAATGAAAGTAGAAAGAATTTAC 321 bp (control fragment)

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.