Open Access
Research Article

Table 1

The primers used in the characterization of G. duodenalis in the present study.

Gene Primer sequence (5′ – 3′) Fragment length (bp) Annealing temperature (°C) Usage (s) References
SSU rRNA Gia2029: AAGTGTGGTGCAGACGGACTC ~497 55 Specific nested PCR of G. duodenalis [2]
Gia2150c: CTGCTGCCGTCCTTGGATGT
RH11: CATCCGGTCGATCCTGCC ~292 59
RH4: AGTCGAACCCTGATTCTCCGCCCAGG
bg G7: AAGCCCGACGACCTCACCCGCAGTGC ~753 65 Genotyping of G. duodenalis [9]
G759: GAGGCCGCCCTGGATCTTCGAGACGAC
Forward: GAACGAGATCGAGGTCCG ~511 55
Reverse: CTCGACGAGCTTCGTGTT
gdh Ghd1: TTCCGTRTYCAGTACAACTC ~530 50 Genotyping of G. duodenalis [5]
Gdh2: ACCTCGTTCTGRGTGGCGCA
Gdh3: ATGACYGAGCTYCAGAGGCACGT 50
Gdh4: GTGGCGCARGGCATGATGCA
tpi AL3543: AAATIATGCCTGCTCGTCG) ~605 50 Genotyping of G. duodenalis [19]
AL3546: CAAACCTTITCCGCAAACC)
AL3544: CCCTTCATCGGIGGTAACTT) ~530 50
AL3545: GTGGCCACCACICCCGTGCC)

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.