Open Access
Research Article

Table 3

Oligonucleotide primers used for PCR.

DNA region Primer name Orientation Primer sequence (5’ to 3’) Reference
18S rRNA ERlB1 Forward ACCTGGTTGATCCTGCCAG [10]
  PrimerB Reverse GATCCTTCTGCAGGTTCACCTAC [10]
  18S1F Forward GGATAACCGTGGTAATTCTATG [13]
  18S11R Reverse TCCTATGTCTGGACCTGGTGAG [13]
  Primer 3L Forward CTAGTGATTGGAATGATGGG [18]
  Primer 1H Reverse TATCCCCATCACGATGCATAC [18]
  NSF1179/18 Forward AATTTGACTCAACACGGG [9]
  Sar-UF Forward GCTTTCGACGGTAGTGTATTGGA This study
  Sar18S674F Forward GCGAAAGCATTTGCCAARGATG This study
  Sar18S1149F Forward AGTATGGTCGCAAGGCTG This study
  Sar18S619R Reverse ACGCTATTGGAGCTGGAATTAC This study
  ShR2 Reverse AGTTTCAGCCTTGCGACCATA This study
  18SR11-1 Reverse TCCCATGTCTGGACCTGGTGAG This studya
 mtDNA cox1 SF1 Forward ATGGCGTACAACAATCATAAAGAA [6]
  SR5 Reverse TAGGTATCATGTAACGCAATATCCAT [6]
  COIRm Reverse CCCAGAGATAATACAAAATGGAA [6]
  CoxS1R Reverse TTACCCATGACCACACCTGTAGTACC [6]
  Sarf-COX1F Forward TTCTCTACGTCTGGTCGATAGT This study
  Sarf-COX1R Reverse AATACTATCGACCAGACGTAGAGA This study
  Sarc-COX1R Reverse AGTATGAGCATTAAAGCCGTGAA This study
  Sarh-COX1R Reverse AACATACAGCACTCCAGATT This study
  Sarb-COX1R Reverse AGACGTACAGAATACCACATC This study
a

Modification of primer 18S11R described in reference [13].

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.