Open Access
Research Article

Table 2.

The primer sequences for cloning the gene fragments encoding the recombinant proteins expressed in E. coli.

Gene name Forward primer Reverse primer
ATS GTAGATATGATACGGATATT TTTTGATGGCTCCAGAACAA
PF3D7_0937600 ATGGCACCGAAAAATGGA TATTTTATCATTGTTACAA
PF3D7_0100300 ATGGCACTAAAAAAAG CGTTCTTGATTTCTACCATCGCA
PF3D7_0600400 ATGGGATCAGATTATTCG ACTATTACAATACGCTTC

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.