Open Access
Table 1.
primers used for detection by PCR of Babesia ovis and Theileria spp. from sheep and goats in this study.
| Primer specificity | Target Gene | Name | Type | Primers 5′–3′ | Product size (bp) | Reference |
|---|---|---|---|---|---|---|
| Catch-all | 18S rRNA | RLB-F | Forward primer | GAGGTAGTGACAAGAAATAACAATA | 460–520 | Gubbels et al. [20] |
| RLB-R | Reverse primer | TCTTCGATCCCCTAACTTTC | ||||
| B. ovis | 18S rRNA | Bbo-F | Forward primer | TGGGCAGGACCTTGGTTCTTCT | 549 | Aktas et al. [5] |
| Bbo-R | Reverse primer | CCGCGTAGCGCCGGCTAAATA | ||||
| Theileria spp. | 18S rRNA | Thei F1 | Forward primer | AACCTGGTTGATCCTGCCAG | 1700 | Heidarpour Bami et al. [21] |
| Thei R1 | Reverse primer | AAACCTTGTTACGACTTCTC | ||||
| 18S rRNA | Thei F2 | Forward primer | TGATGTTCGTTTYTACATGG | 1417–1426 | Heidarpour Bami et al. [21] | |
| Thei R2 | Reverse primer | CTAGGCATTCCTCGTTCACG |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
