Open Access
Original contribution

Table I.

PCR conditions and primers used in the study.

PCR conditions (°C/s)
Gene/target Primers Sequence 5’– 3’ Denaturation Annealing Extension No. of cycles Length of PCR product (bp) References
18S rRNA gene/ RIB19 CGGGATCCAACCTGGTTGATCCTGC 92/60 S4/60 72/120 30 1,700 da Silveira et al. (2011)
Babesia/ RIB20 CCGAATTCCTTGTTACGACTTCTC
Theileria sp. BabRumF ACCTCACCAGGTCCAGACAG 92/60 54/60 72/120 30 420
BabRumR GTACAAAGGGCAGGGACGTA
 
pCS20 gene /E. AB 128 ACTAGTAGAAATTGCACAATCTAT 94/60 55/60 72/120 4S 279 Mahan et al. (1992)
ruminantium AB 129 TGATAACTIGGTGCGGGAAATCCTT
 
msp4 gene/A. MSP 4S GGGAGCTCCTATGAATTACAGAGAATTGTTTAC 94/30 60/30 68/60 40 8S1 de la Fuente et al. (2001)
marginale/ovis MSP 43 CCCCGGATCCTTAGCTGAACAGGAATCTTGC

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.