Open Access
Table I.
PCR conditions and primers used in the study.
| PCR conditions (°C/s) |
||||||||
|---|---|---|---|---|---|---|---|---|
| Gene/target | Primers | Sequence 5’– 3’ | Denaturation | Annealing | Extension | No. of cycles | Length of PCR product (bp) | References |
| 18S rRNA gene/ | RIB19 | CGGGATCCAACCTGGTTGATCCTGC | 92/60 | S4/60 | 72/120 | 30 | 1,700 | da Silveira et al. (2011) |
| Babesia/ | RIB20 | CCGAATTCCTTGTTACGACTTCTC | ||||||
| Theileria sp. | BabRumF | ACCTCACCAGGTCCAGACAG | 92/60 | 54/60 | 72/120 | 30 | 420 | |
| BabRumR | GTACAAAGGGCAGGGACGTA | |||||||
| pCS20 gene /E. | AB 128 | ACTAGTAGAAATTGCACAATCTAT | 94/60 | 55/60 | 72/120 | 4S | 279 | Mahan et al. (1992) |
| ruminantium | AB 129 | TGATAACTIGGTGCGGGAAATCCTT | ||||||
| msp4 gene/A. | MSP 4S | GGGAGCTCCTATGAATTACAGAGAATTGTTTAC | 94/30 | 60/30 | 68/60 | 40 | 8S1 | de la Fuente et al. (2001) |
| marginale/ovis | MSP 43 | CCCCGGATCCTTAGCTGAACAGGAATCTTGC | ||||||
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.
