Open Access
Research Article

Table 1

Primers used in real-time quantitative PCR.

Target gene Primer name Primer sequence (5′ → 3′) Reference sequence (Acc. No./ID)
IL-6 F1 TCTGCAAGAGACTTCCATCC M24221.1
R1 CAATCAGAATTGCCATTGC
IL-10 F2 ATGCCTGGCTCAGCACTGC NM_010548.2
R2 GGAGTCGGTTAGCAGTATGTTG
IL-12 F3 GTAAATGTTAAATGCCCGCAG M86671.1
R3 GTACCTACGCAGCCCTGATTG
IL-1β F4 CAGCAGCACATCAACAAGAG NM_008361.4
R4 GTCTAATGGGAACGTCACACA
INF-γ F5 CGCTACACACTGCATCTTG NM_008337.4
R5 GCTGATGGCCTGATTGTC
TNF-α F6 GCACAGAAAGCATGATCCG NM_001278601.1
R6 TGAGTGTGAGGGTCTGGGC
TGF-β F7 CAGATCCTGTCCAAACTAAG NM_011577
R7 GCACTGCTTCCCGAATGTC

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.