Open Access
Research Article

Table 1

Primer sequences used for the gene amplification of different pathogens.

Pathogen gene Primer name Sequence (5′–3′) Annealing temperature (°C) Fragment size (bp) Reference
CRT ompA Rr190.70p ATGGCGAATATTTCTCCAAAA 60 346 Jia et al. [4]
Rr190.602n AGTGCAGCATTCGCTCCCCCT
190.70-38s1 AAAACCG CTTTATTCACC 58
190.602-384r1 GGCAAC AAGTTACCTCCT
CRT 17kDa 17K3 GCTTTACAAAATTCTAAAAACCATATA 50 395 Jia et al. [4]
17K5 TGTCTATCAATTCACAACTTGCC
17KD113s1 ATTGTCCGTCAGGTTGGC 52
17KD408r1 CGGGCGGTATGAATAAGC
SFGR Candidatus Rickettsia longicornii ompA H-LompA-F TTTAATTGATTTAATTTTTATTAAGGTTTACATATGGCG 60 647 Jiang et al. [3]
H-LompA-R GTCTTGACAGTTATTATACCTCCTCCAT
SFGR Candidatus Rickettsia longicornii ompB H-LompB-F1 GTTCAGCTATGGGTGCTGCTATACAG 63 1203 Jiang et al. [3]
H-LompB-R1 GCACTAGCACTTGCTAAAGTACCGT
SFGR Candidatus Rickettsia longicornii sca4 H-Lsca4-F2 AGTTCTCAGTCCAGCACAACAAC 63 885 Jiang et al. [3]
H-Lsca4-R2 GCCTTTACCAGCTCATCTACTTT
SFGR Candidatus Rickettsia longicornii rrs H-L16S-F TGCAAGTCGAACGGACTAATTGG 65 976 Jiang et al. [3]
H-L16S-R AATGAGGGTTGCGCTCGTTG
SFTSV Small S-F1 ACACAAAGACCCCCTTCATTTGGA 58 588 Liu et al. [10]
S-R1 TGGAGGAGGGCCACATCCAG
SFTSV medium M-F1 GATGAGATGGTCCATGCTGATTCT 58 560 Liu et al. [10]
M-R1 CTCATGGGGTGGAATGTCCTCAC
SFTSV large L-F1 ACACAGAGACGCCCAGATGAAC 60 684 Liu et al. [10]
L-R1 GCCTCAAGCTCTTCCTCACTCTTCTG
T. orientalis MPSP P1 CACGCTATGTTGTCCAAGAG 53 875 Ota et al. [15]
P2 TGTGAGACTCAATGCGCCTA
T. sinensis MPSP P3 CACTGCTATGTTGTCCAAGAGATATT 56 887 Liu et al. [8]
P4 AATGCGCCTAAAGATAGTAGAAAAC

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.