Open Access
Table 3
Molecular targets tested, PCR conditions, and references.
PCR name (target gene) | Primer name | Primer sequence (5′ – 3′) | Size (bp) | Originally designed on | Species targeted and specific detection | Ref. | Cycling conditions |
---|---|---|---|---|---|---|---|
A-16S* | Em rrn-F | CTGTGATCTTGGTGTAGTAGTTGAGATTT | 84 | Echinococcus multilocularis | Echinococcus multilocularis | [19] | 10 min/95 °C, 40 cycles: 30 s/94 °C, 30 s/60 °C, 10 s/72 °C |
(16S-rrnL) | Em rrn-R | GGCTTACGCCGGTCTTAACTC | |||||
Hydrolysis probe | FAM-TGGTCTGTTCGACCTTTTTAGCCTCCAT-TAMRA | (RT-cycles) 2 min/50 °C, 10 min/95 °C, 40 cycles: 75 s/95 °C, 1 min/60 °C | |||||
B1-2-Multiplex TRACHSEL | Cest1 | TGCTGATTTGTTAAAGTTAGTGATC | 395 | Echinococcus multilocularis | Echinococcus multilocularis | [35] | (Multiplex PCR) 40 cycles: 30 s/94 °C, 90 s/58 °C, 10 s/72 °C |
Cest2 | CATAAATCAATGGAAACAACAACAAG | ||||||
(nad1 and | Cest4 | GTTTTTGTGTGTTACATTAATAAGGGTG | 117 | Echinococcus granulosus | Echinococcus granulosus | ||
12S-rrnS) | Cest5 | GCGGTGTGTACMTGAGCTAAAC | Sensu stricto | ||||
Cest3 | YGAYTCTTTTTAGGGGAAGGTGTG | 267 | Taenia spp. | Taenia spp. | |||
Cest5 | GCGGTGTGTACMTGAGCTAAAC | ||||||
C-JB11.5 | ND1 JB11.5 | TTATGGTAGATATTATAG | 183 | Echinococcus granulosus | Echinococcus spp., 1 | [5] | 40 cycles: 30 s/94 °C, 30 s/50 °C, 30 s/72 °C |
(nad1) | ND1 JB12.5 | CACACACATAAAACAAGC | mutation between G6/G7 | ||||
D-EMH15 (12S-rrnS) | EM-H15 | CCATATTACAACAATATTCCTATC | 200 | Echinococcus multilocularis | Echinococcus multilocularis | [12] | 40 cycles: 30 s/95 °C, 30 s/55 °C, 30 s/72 °C |
EM-H17 | GTGAGTGATTCTTGTTAGGGGAAG | ||||||
E-EM29 | EM29 | GATTTGCTGATTTGTTAAAGTTAGTGATC | 252 | Echinococcus multilocularis | Echinococcus multilocularis | [30] | 45 cycles: 30 s/95 °C, 45 s/56 °C, 60 s/72 °C |
(nad1) | EM281 | AGAACTTAAAAACGAATATTTATTGTAACT | |||||
F-EG1 | Eg1f | CATTAATGTATTTTGTAAAGTTG | 255 | Echinococcus granulosus | Echinococcus granulosus | [31] | 40 cycles 30 s/94 °C, 30 s/53 °C, 45 s/72 °C |
(12S-rrnS) | Eg1r | CACATCATCTTACAATAACACC | Sensu stricto | ||||
G-12S | 12S-Echino-F | AAAKGGTTTGGCAGTGAGYGA | 268 | Echinococcus spp. | Echinococcus spp. | [28] | 40 cycles: 30 s/94 °C, 30 s/55 °C, 1 min/72 °C |
(12S-rrnS) | 12S-Echino-R (Cest5) | GCGGTGTGTACCTGAGCTAAAC | |||||
H-COX1 | CO1-F | TTTTTTGGGCATCCTGAGGTTTAT | 446 | Fasciola hepatica | Echinococcus spp., 1 | [4] | 30 cycles: 30 s/94 °C, 40 s/52 °C, 45 s/72 °C |
(cox1) | CO1-R | TAAAGAAAGAACATAATGAAAATG | mutation between G6/G7 | ||||
I-JB11 | ND1 JB11 | AGATTCGTAAGGGGCCTAATA | 529 | Fasciola hepatica | Echinococcus spp., 4 | [5] | 40 cycles: 30 s/94 °C, 30 s/50 °C, 60 s/72 °C |
(nad1) | ND1 JB12 | ACCACTAACTAATTCACTTTC | mutations between G6/G7 | ||||
J-Alea | Alea-F | CCTAAAAATGTCTATGATTGGTCCACTA | 167 | Random nucleic sequence | Alea plasmid | [20] | (qPCR) 2 min/50 °C, 10 min/95 °C, 40 cycles: 75 s/95 °C, 1 min/60 °C |
Alea-R | GGGAGTACCTTGCCATACAAAATT | ||||||
Alea-probe | VIC-TTAAATCAACTCCTAAATCCGCGCGATAGG-TAMRA |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.