Open Access
Table 1
Primers used in this study.
Gene/region | Primers and sequences 5′–3′ | Cycling conditions | References |
---|---|---|---|
28S | LSU | Initial denaturation of 7 min at 95 °C; 40 cycles of 40 s at 95 °C, 45 s at 57 °C and 1 min and 30 s at 72 °C; 10 min at 72 °C for final extension | [34, 43] |
TAGGTCGACCCGCTGAAYTTAAGCA | |||
1500R | |||
GCTATCCTGAGGGAAACTTCG | |||
1200R | |||
GCATAGTTCACCATCTTTCGG | |||
ITS | GLYP1 | Initial denaturation of 7 min at 95 °C; 40 cycles of 40 s at 95 °C, 45 s at 57 °C and 1 min 30 s at 72 °C; 10 min at 72 °C for final extension | [36, 56] |
GCTGAGAAGACGACCAAACTTGAT | |||
BD2 | |||
TATGCTTAAATTCAGCGGGT | |||
COI | JB3 | Initial denaturation of 5 min at 94 °C; 40 cycles of 30 s at 92 °C, 45 s at 47 °C and 1 min 30 s at 72 °C; 10 min at 72 °C for final extension | [42, 55] |
TTTTTTGGGCATCCTGAGGTTTAT | |||
JB4.5 | |||
TAAAGAAAGAACATAATG AAAATG |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.