Open Access
Research Article

Table 1

Primer sequences for qRT-PCR analysis of gene transcripts.

Gene Primer sequences (5′–3′) Expected size (bp) Annealing temperature (°C)
NTNG1 F: CAAAGACAGGTTCGCATT 214 59.5
R: CCTTCCGTGCACTTTTAT
EphA3 F: CCAGCGATGTATGGAGTTA 180 58.5
R: CTTTCTGCCAGCAGTCTAG
NCOA1 F: GATCTAACCTCCCTTCTGCTTTT 228 61
R: GGAACAGAGAGGACAACGCA
SCD F: CGCTGGCACATCAACTTTACC 124 56.6
R: TTTCCTCTCCAGTTCTTTTCATCC
GHR F: AGGTTGCTCAGCCACAAA 281 58.9
R: TGGGGAAAGGACCACATT
SMAD3 F: CGACTACAGCCATTCCATCC 120 60.5
R: TGGTCACTGGTCTCTCCATCT
TGFBR1 F: ATTCTGTGGCTTTGCCTGAA 175 60
R: GCAGTTTCCTGGGTCTGAAG
IGF1 F: GACAGGAATCGTGGATGAGTG 270 57
R: AACAGGTAACTCGTGCAGAGC
LPL F: GTCATCGTGGTGGACTGG 398 59.3
R: TGGAAAGTGCCTCCGTTA
GAPDH F: CTGACCTGCCGCCTGGAGAAA 149 59.0
R: GTAGAAGAGTGAGTGTCGCTGTT

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.