Open Access
Research Article

Table 1

Primer sequences and reaction conditions used in nested PCR amplifications.

Locus Primer sequences (5′ – 3′) Nucleotide fragment (bp) Annealing temperature (°C) Reference
Cryptosporidium spp. SSU rRNA SSU-F2: TTCTAGAGCTAATACATGCG ~1325 55 Xiao et al. [37]
SSU-R2: CCCATTTCCTTCGAAACAGGA
SSU-F3: GGAAGGGTTGTATTTATTAGATAAAG 826–864 55
SSU-R4: CTCATAAGGTGCTGAAGGAGTA
C. parvum gp60 AL3531: ATAGTCTCCGCTGTATTC 1280 52 Alves et al. [1]
AL3535: GGAAGGAACGATGTATCT
AL3532: TCCGCTGTATTCTCAGCC 800–850 50
AL3534: GCAGAGGAACCAGCATC
G. duodenalis SSU rRNA Gia2029: AAGTGTGGTGCAGACGGACTC 497 55 Appelbee et al. [2]
Gia2150c: CTGCTGCCGTCCTTGGATGT
RH11: CATCCGGTCGATCCTGCC 292 59
RH4: AGTCGAACCCTGATTCTCCGCCCAGG
G. duodenalis tpi AL3543: AAATIATGCCTGCTCGTCG 605 50 Cacciò and Ryan [4]
AL3546: CAAACCTTITCCGCAAACC
AL3544: CCCTTCATCGGIGGTAACTT 530 50
AL3545: GTGGCCACCACICCCGTGCC

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.