Open Access
Research Article

Table 1

Primer sequences and reaction conditions used in nested PCR amplifications.

Gene Primer sequences (5′ – 3′) Nucleotide fragment (bp) Annealing temperature (°C) Reference
SSU rRNA Gia2029 (AAGTGTGGTGCAGACGGACTC) 292 55 [3]
Gia2150c (CTGCTGCCGTCCTTGGATGT)
RH11 (CATCCGGTCGATCCTGCC) 59
RH4 (AGTCGAACCCTGATTCTCCGCCCAGG)
bg BG1(AAGCCCGACGACCTCACCCGCAGTGC) 511 65 [15]
BG2(GAGGCCGCCCTGGATCTTCGAGACGAC)
BG3 (GAACGAACGAGATCGAGGTCCG) 55
BG4 (CTCGACGAGCTTCGTGTT)
gdh Gdh1 (TTCCGTRTYCAGTACAACTC) 520 50 [4]
Gdh2 (ACCTCGTTCTGRGTGGCGCA)
Gdh3 (ATGACYGAGCTYCAGAGGCACGT) 50
Gdh4 (GTGGCGCARGGCATGATGCA)
tpi AL3543 (AAATIATGCCTGCTCGTCG) 530 50 [28]
AL3546 (CAAACCTTITCCGCAAACC)
AL3544 (CCCTTCATCGGIGGTAACTT) 50
AL3545 (GTGGCCACCACICCCGTGCC)

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.