Open Access
Research Article

Table 1

Primer sequences

Pathogen Target gene Assay Oligonucleotide sequences (5′ → 3′) Product size (bp) Annealing temperature (°C) Reference
Theileria spp 18S rRNA PCR GAAACGGCTACCACATCT 778 55 Cao et al. [4]
AGTTTCCCCGTGTTGAGT
nPCR TTAAACCTCTTCCAGAGT 581 55
TCAGCCTTGCGACCATAC
T. annulata Tams-1 PCR GTAACCTTTAAAAACGT 721 55 Martin-Sanchez et al. [14]
GTTACGAACATGGGTTT
nPCR CACCTCAAAACATACCCC 453 60
TGACCCACTTATCGTCC
T. orientalis MPSP PCR CTTTGCCTAGGATACTTCCT 776 58 Ota et al. [16]
ACGGCAAGTGGTGAGAACT
T. sinensis MPSP PCR CACTGCTATGTTGTCCAAGAGATATT 887 56 Liu et al. [13]
AATGCGCCTAAAGATAGTAGAAAAC

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.