Open Access
Table 1
Characteristics of the four primer sets used to amplify the marker regions.
Target name | Primer name | Primer sequence (5′–3′) | T m | Hairpin Tm | Target | Amplicon length (bp) | Haplotypes | SNPs |
---|---|---|---|---|---|---|---|---|
CDS-1 | GT1-F | CTCCTTGCTGCTCAGAACGA | 60 | none | ATP synthase | 175 | 2 | 7 |
GT1-R | CAAGAGAGGAGCAGTGGCAA | 60 | 44.6 | |||||
CDS-2 | GT2-F | TGCAAACTACTAAGGGCGCA | 60 | none | U3 small nucleolar RNA-associated protein 11 ((LOC34621252) | 246 | 2 | 1 |
GT2N-R | CGCCTTCTCTTGAGCCTTGA | 60 | none | |||||
CDS-3 | GT3-F | AATCGAATCGGTGCAGTGCTTA | 60.7 | none | Uncharacterized (LOC34620832) | 220 | 3 | 2 |
GT3N-R | GACTGAACGTGTGAGAGGGG | 59.3 | none | |||||
CDS-4 | GT4-F | GTAGATGGGTCCTTGAAGGCT | 59.2 | none | ATP-dependent RNA helicase rrp3 (LOC34619020) | 179 | 2 | 3 |
GT4N-F | CAGACGCCTAAGGAACCGAA | 60 | 37.6 |
Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.
Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.
Initial download of the metrics may take a while.