Open Access
Research Article

Table 1

Characteristics of the four primer sets used to amplify the marker regions.

Target name Primer name Primer sequence (5′–3′) T m Hairpin Tm Target Amplicon length (bp) Haplotypes SNPs
CDS-1 GT1-F CTCCTTGCTGCTCAGAACGA 60 none ATP synthase 175 2 7
GT1-R CAAGAGAGGAGCAGTGGCAA 60 44.6
CDS-2 GT2-F TGCAAACTACTAAGGGCGCA 60 none U3 small nucleolar RNA-associated protein 11 ((LOC34621252) 246 2 1
GT2N-R CGCCTTCTCTTGAGCCTTGA 60 none
CDS-3 GT3-F AATCGAATCGGTGCAGTGCTTA 60.7 none Uncharacterized (LOC34620832) 220 3 2
GT3N-R GACTGAACGTGTGAGAGGGG 59.3 none
CDS-4 GT4-F GTAGATGGGTCCTTGAAGGCT 59.2 none ATP-dependent RNA helicase rrp3 (LOC34619020) 179 2 3
GT4N-F CAGACGCCTAAGGAACCGAA 60 37.6

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.