Open Access
Research Article

Table 1

List of Primer used in this experiment.

Primer name Sequence (5′–3′) Product size Use
DG-F1 GTIGCIATHAARAARGTIYTICARGAY 600 bp For Preliminary identification of GSK-3β
DG-R1 YTTRWRYTCIRTRTARTTIGGRTTCAT
Orf-F1 ATGAGTGGACGGCCGAGGACG 1248 bp Primer extension
Orf-R1 AGTGGCCCCGTGTAAATAAAG
GSK-F1 CGCCTGGACCACTGTAACAT 351 bp For transcriptional analysis
GSK-R1 CGAGCAGATGTACGACACGT
Actin-F1 AGCGTGGCTACTCTTTCACC 229 bp
Actin-R1 GATTCCATACCCAGGAACGA
T7-GSK-F1 TAATACGACTCACTATAGGGTACTGCGCTTCAAGAACCGCGAA 318 bp For ds RNA synthesis
T7-GSK-R1 TAATACGACTCACTATAGGGTACTTTTAGTACGCCCGTCTCTGG

Note. The underlined bases denote T7 promoter sequences.

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.