Open Access
Research Article

Table 1

Sequence of gene-specific primers for qPCR assays.

Gene name Primer sequence (5′ – 3′)
Atp51 UP – AGCCTGACCTTGGAACTGGG, LP – CAGGGATTTCAGCAGGGGTT
Mapk9 UP – CCCTATGTGGTGACTCGCTAT, LP – ACATAATTCCTCACGGTTGG
Ptp4a1 UP – GGCTGCTGTATTGCTGTCCA, LP – CATCAGGCACCCCAGTTTTA
Bnip2 UP –GCCAACCTGGCTCATTAGAA, LP – CAAATCATCCGACCACACAG
Pdss2 UP – GCAGATTGGAGAGGCTCAAG, LP – CTCCAGTGCCTTGTTTCCAT
Ppp2r4 UP – TTGTGGATGAGAAGGCAGTG, LP – GGTCCACAGCTGGTTGGAGT
Gdil UP – GGACAGGTCTTACCGAATGC, LP – ATGCCCATCAGATTAGAAGC
Sec61a1 UP – TCAGCCCCACCACTGTCAAC, LP – TCGGAAGCCCTGGAAATAGA
Tm7sf2 UP – CTCGCCTTGGTTCCTTTGAC, LP – CAGAGGGCATCACCCACATA
Rps8 UP – GGGCACTCGCTACATGTTCT, LP – GCCCATTCCCTTGATGTCTA
Mrp120 UP – GGAGGTGCTGAAACATGCTC, LP – GTTCCGCTTCTTCAGTCTGC
Tfrc UP – CCAGTGTTGGAACAGGTCTT, LP – CTCCGAAGTCTCCTGCACTC
GAPDH UP – TGTGGAAGGACTCATGACCA, LP – GGATGCAGGGATGATGTTCT

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.