Open Access

Table 1.

Oligonucleotide primers used for PCR assays in the present study.

Primer name Primer sequence (5′–3′) Position Accession no.
Diro12S-F (forward) CATTTTAATTTTTAACTCTATTT 22–44 GQ292761
Diro12S-R (reverse) GATGGTTTGTACCACTTTAT 483–502 GQ292761
Diro18S-F (forward) CCATGCATGTCTAAGTTCAA 2–21 AF036638
Diro18S-R (reverse) TCGCTACGGTCCAAGAATTT 872–891 AF036638
Diro18S-F2 (forward) CTGAATACTCGTGCATGGAA 755–744 AF036638
Diro18S-R2 (reverse) TTACGACTTTTGCCCGGTT 1706–1724 AF036638
Diro18S-F3 (forward) AATTCCTAGTAAGTGTGAGTCATC 1533–1556 AF036638
Diro5.8S-R (reverse) TAGCTGCGTTCTTCATCGAT 540–559 AF217800
Diro-cox1-F (forward) GCTTTGTCTTTTTGGTTTACTTTT 1–24 AF271614
Diro-cox1-R (reverse) TCAAACCTCCAATAGTAAAAAGAA 1067–1090 NC_005305

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.