Open Access
Research Article

Table 1.

Primer sequences for PCR detection of five human malaria parasites

Plasmodium spp Size (bp) Primers Primer sequences (5′→3′)
Nested 1st round primers Genus-specific 1600–1700 rPLU1 TCAAAGATTAAGCCATGCAAGTGA
rPLU5 CCTGTTGTTGCCTTAAACTTC
Nested 2nd round primers Genus-specific 235 rPLU3 TTTTTATAAGGATAACTACGGAAAAGCTGT
rPLU4 TACCCGTCATAGCCATGTTAGGCCAATACC
Nested 2nd round species-specific primers P. vivax 121 rVIV1 CGCTTCTAGCTTAATCCACATAACTGATAC
rVIV2 ACTTCCAAGCCGAAGCAAAGAAAGTCCTTA
P. falciparum 206 rFAL1 TTAAACTGGTTTGGGAAAACCAAATATATT
rFAL2 ACACAATGAACTCAATCATGACTACCCGTC
P. ovale 226 rOVA1 ATCTCTTTTGCTATTTTTTAGTATTGGAGA
rPLU2 ATCTAAGAATTTCACCTCTGACATCTG
P. malariae 145 rMAL1 ATAACATAGTTGTACGTTAAGAATAACCCC
rMAL2 AAAATTCCCATGCATAAAAATTATACAAA
P. knowlesi 153 Pmk8 GTTAGCGAGAGCCACAAAAAAGCGAAT
Pmkr9 ACTCAAAGTAACAAAATCTTCCGTA
Single-Step PCR primers P. knowlesi 200 Pkr140-5F CAGAGATCCGTTCTCATGATTTCCATGG
Pkr140-5R CTRAACACCTCATGTCGTGGTAG

Current usage metrics show cumulative count of Article Views (full-text article views including HTML views, PDF and ePub downloads, according to the available data) and Abstracts Views on Vision4Press platform.

Data correspond to usage on the plateform after 2015. The current usage metrics is available 48-96 hours after online publication and is updated daily on week days.

Initial download of the metrics may take a while.